Subtropical japonica rice specific transposon insertion marker and application thereof

Abstract

The present disclosure provides a subtropical japonica rice specific transposon insertion marker and its application. First, the insertion site of the subtropical japonica rice specific transposon insertion marker is located between the 1,905,300th and the 1,905,301th nucleotides of the chromosome 1 of the IRGSP-1.0 version of the rice Nipponbare reference genome, and the variety of subtropical japonica rice contains a 345 bp long transposon insertion at the insertion site, while the varieties of other rice groups do not contain the transposon insertion. Further, the above transposon insertion marker is provided for identifying subtropical japonica rice. The subtropical japonica rice specific transposon insertion marker of the present disclosure has important application value for accurate identification of rice groups, classification of germplasm resources, screening of breeding materials, detection of hybrid rice germplasm purity, etc., which can significantly improve the efficiency of molecular marker assisted selection and shorten the breeding period.

Description

Technical Field

[0001] This disclosure relates to the field of biotype identification technology, and in particular to a transposon insertion marker specific to subtropical japonica rice and its application. Background Technology

[0002] Rice (Oryza sativa L.) is an important food crop, mainly divided into two major subspecies, indica and japonica, and two minor subspecies, aus and aromatic (3K RGP: The 3,000 rice genomes project). GigaScience 2014, 3:7; WS Wang, R. Mauleon, ZQHu , et al. : Genomic variation in 3,010 diverse accessions of Asian cultivated rice. Nature 2018, 557:43; D. Guo, Y. Li, H. Lu , et al. : A pangenome reference of wild and cultivated rice. Nature 2025, 642:662-671). Among them, japonica rice can be further divided into three ecotypes: temperate japonica, subtropical japonica, and tropical japonica (3K RGP: The 3,000 rice genomesproject). GigaScience 2014, 3:7; WS Wang, R. Mauleon, ZQ Hu , et al. : Genomic variation in 3,010 diverse accessions of Asian cultivated rice. Nature 2018, 557:43; D. Guo, Y. Li, H. Lu , et al. : A pangenome reference of wild and cultivated rice. Nature(2025, 642:662-671). Different ecotypes of rice exhibit significant differences in adaptability, stress resistance, yield, and quality. Subtropical japonica rice is mainly distributed in subtropical regions such as the Yangtze River basin in China, southern Korea, and Kyushu in Japan. This ecotype is intermediate in genetic background and physiological characteristics between temperate and tropical japonica rice, exhibiting transitional features. They have a wider range of temperature and humidity adaptability, better heat tolerance than temperate japonica rice, and relatively strong resistance to subtropical diseases such as rice blast. Their overall agronomic traits are well-balanced. Accurate and rapid identification of different ecotypes of japonica rice is of great significance for rice germplasm resource identification, variety protection, genetic improvement, and marker-assisted selection breeding.

[0003] Currently, the identification of different ecotypes of japonica rice relies mainly on morphological characteristics or phylogenetic analysis based on whole-genome sequencing. However, morphological characteristics are easily affected by the environment, have poor stability, and are time-consuming and inefficient; while whole-genome sequencing, although accurate, is costly and complex to operate, making it difficult to promote on a large scale in grassroots breeding work.

[0004] Therefore, there is an urgent need to develop a stable, easy-to-operate, and low-cost molecular marker to identify different ecotypes of japonica rice and to recognize subtropical japonica rice. Summary of the Invention

[0005] This disclosure provides a transposon insertion marker specific to subtropical japonica rice and its application, in order to at least solve the above-mentioned technical problems existing in the prior art.

[0006] According to a first aspect of this disclosure, a transposon insertion marker specific to subtropical japonica rice is provided, the insertion site being located between nucleotides 1,905,300 and 1,905,301 on chromosome 1 of the Nipponbare rice reference genome of version IRGSP-1.0. At this insertion site, subtropical japonica rice varieties contain a transposon insertion of 345 bp in length, while varieties of other rice groups do not contain the transposon insertion.

[0007] In one possible implementation, the transposer is Olo24 The transposon belongs to the MITE type, and its nucleotide sequence is shown in SEQ ID NO:1.

[0008] In one embodiment, the other rice groups include indica subspecies, Osage subspecies, fragrant rice subspecies, and / or other non-subtropical japonica rice subspecies (tropical japonica rice or temperate japonica rice).

[0009] According to a second aspect of this disclosure, this disclosure provides a PCR primer set for amplifying the transposon insertion marker, the PCR primer set being designed based on the flanking sequences on both sides of the insertion site of the transposon insertion marker, and capable of specifically amplifying the transposon insertion marker.

[0010] In one embodiment, the upstream 200bp flanking sequence and the downstream 200bp flanking sequence of the flanking sequence are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0011] In a preferred embodiment, the nucleotide sequences of the PCR primer combination are shown in SEQ ID NO:4 and SEQ ID NO:5.

[0012] According to a third aspect of this disclosure, this disclosure provides a kit for identifying subtropical japonica rice, the kit comprising the above-described PCR primer combination.

[0013] In one embodiment, the kit further includes: PCR reaction buffer, DNA polymerase, dNTPs and / or standard control samples (including a positive control of rice genomic DNA known to be from subtropical japonica rice and a negative control of rice genomic DNA known to be from non-subtropical japonica rice).

[0014] According to a fourth aspect of this disclosure, this disclosure provides the use of the above-described transposon insertion marker, the above-described PCR primer combination, or the above-described kit in any of the following: A1. Application in identifying or assisting in the identification of subtropical japonica rice; A2. Application in the preparation of products for identification or auxiliary identification of subtropical japonica rice.

[0015] According to the fifth aspect of this disclosure, this disclosure provides a method for identifying whether a rice variety to be tested belongs to subtropical japonica rice, comprising the following steps: S1. DNA Extraction: Extract genomic DNA from the rice sample to be tested (such as leaves, seeds, etc.); S2. PCR amplification: Using the genomic DNA as a template, PCR amplification is performed using the above-mentioned PCR primer combination to obtain PCR amplification products; S3. Result Interpretation: The PCR amplification products were detected by agarose gel electrophoresis. If the PCR amplification product contains the transposon insertion marker, the rice to be tested is determined to be subtropical japonica rice. If the PCR amplification product does not contain the transposon insertion marker (i.e. only contains flanking sequences), then the rice to be tested is determined to belong to other rice groups (such as indica subspecies, fragrant rice subspecies, Osmodium subspecies and / or other non-subtropical japonica rice subspecies).

[0016] According to one possible implementation of this disclosure, at least the following beneficial effects are achieved: 1. High specificity: The transposon insertion markers specific to subtropical japonica rice disclosed in this invention are stably present in subtropical japonica rice varieties, but absent in other groups, enabling accurate identification of subtropical japonica rice with a single marker and avoiding the cumbersome use of multiple markers.

[0017] 2. Simple and rapid operation: The PCR detection method developed based on the transposon insertion marker specific to subtropical japonica rice disclosed in this paper can determine the results with only one PCR reaction and conventional agarose gel electrophoresis. It is simple to operate, low in cost, and high in throughput, which greatly improves the efficiency of molecular marker-assisted selection.

[0018] 3. High application value: The transposon insertion marker specific to subtropical japonica rice disclosed in this paper has broad practical prospects in the precise identification of rice groups, classification of germplasm resources and screening of breeding materials, and detection of hybrid rice germplasm purity.

[0019] It should be understood that the description in this section is not intended to identify key or essential features of the embodiments of this disclosure, nor is it intended to limit the scope of this disclosure. Other features of this disclosure will become readily apparent from the following description. Attached Figure Description

[0020] The above and other objects, features, and advantages of this disclosure will become readily apparent from the following detailed description of exemplary embodiments, taken in conjunction with the accompanying drawings. Several embodiments of this disclosure are illustrated in the drawings by way of example and not limitation, in which: In the accompanying drawings, the same or corresponding reference numerals indicate the same or corresponding parts.

[0021] Figure 1 The location of the subtropical japonica rice-specific transposon insertion marker in the rice genome is shown in (A), and the structural diagrams in different taxa are shown in (B); in A, TSD (Target Site Duplication) represents the target site repetitive sequence.

[0022] Figure 2 The results of the identification of 57 different rice varieties based on genome sequence using transposon insertion markers specific to subtropical japonica rice are shown in Table 1; among them, the rice varieties represented by Acc_1 to Acc_57 are shown in Table 1.

[0023] Figure 3 The results of PCR detection of 30 different groups of rice materials using transposon insertion markers specific to subtropical japonica rice are shown in Table 2; where M is a DNA molecular weight marker; the rice varieties represented by 1 to 30 are shown in Table 2. Detailed Implementation

[0024] To make the objectives, features, and advantages of this disclosure more apparent and understandable, the technical solutions in the embodiments of this disclosure will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of this disclosure, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this disclosure without creative effort are within the scope of protection of this disclosure.

[0025] The insertion site of the transposon insertion marker specific to subtropical japonica rice disclosed in this study is located between nucleotides 1,905,300 and 1,905,301 on chromosome 1 of the Nipponbare rice reference genome (IRGSP-1.0 version). Figure 1 At this insertion site, subtropical japonica rice varieties contain a 345 bp MITE-type gene. Olo24 Transposons are inserted, while other rice varieties lack this feature. Olo24 Insert the rotary connector.

[0026] The Olo24 The nucleotide sequence of the transposon is shown in SEQ ID NO:1, as follows: GGGCCAGTTTAGTTCCCAAAAATTTTCTCCTTCCCCTATCACATCGAATCTTTGGACACATGTATGGAGCATTAAATGTGGACAAAAAGAAAAACCAATTGCACAGTTTAGCTATAAATCACGAGACGAATCTTTTGAGCCTAATTAGGCCATGATTAGCCATAAGTGGTAC AGTAACCCACATGTGCTAATGACGGCTTAAGTAGGCTCAAAAGATTCGTCTCGCGGTTTCCAGGCGAGTTCTGAAGTTAGTTTTTTCATTCGTGTCCGAAAACCCCTTCCGACATCCAGTCAAACGTCTGATGTGACACCCAAAAATTTCCTCTTCCCCAACTAAACACAGCC The Olo24 The upstream 200bp flanking sequence of the transposon is shown in SEQ ID NO:2, as follows: CATGGAGAAGGAGAACATGTATGATGATAATGCAGAACCTGTAAGAGCAAACCGGTCGTTCTGCGATGTTAACATTTTGCTGAAGTTTTTGTGTCTGTAACATCAAGTCCCAGTAAATAAATAACTCATTTTTTTTTTGTACACAGAGTCCACTTTGTCTTCAGATTTCTTTAGCAGTGGTGCCTGAAGCCTGAAACTGA The Olo24 The downstream 200bp flanking sequence of the transposon is shown in SEQ ID NO:3, as follows: AACACAAGCTTGACTTGCATTGCATATCTGAATCTCTTTATTTCCCCGTTTCTGAACTTAGCTTGGCATGCACATGCATAGTTTCAGTGGGTGATATACGGGGAAAAATGAACGAAACGTCTAAAACCAAAATTAATGTATGAATAAAAAAATATACCAGTATTATTAACGGTTCAAAATCTAATACTGTAAAATAGACT Example 1 This embodiment demonstrates the identification of subtropical japonica rice based on genome sequence using transposon insertion markers specific to subtropical japonica rice as disclosed in this invention. The specific process is as follows: I. Materials Fifty-seven rice accessions with known affiliations and genome assembly were selected, as shown in Table 1. These included 11 temperate japonica rice accessions, 9 subtropical japonica rice accessions, 8 tropical japonica rice accessions, 11 indica rice accessions, 11 Australopithecus accessioni accessions, and 7 aromatic rice accessions.

[0027] Table 1 Information on 57 rice samples

[0028] II. Methods 1. Extract the transposon insertion marker specific to subtropical japonica rice as shown in SEQ ID NO:1. Olo24 Transposon sequence, shown in SEQ ID NO:2 Olo24 The upstream 200bp flanking sequence of the transposon, shown in SEQ ID NO:3 Olo24 Downstream 200bp flanking sequence of the transposon.

[0029] 2. Download the genome assembly sequences of each rice variety from the following website. Acc_1:https: / / www.ncbi.nlm.nih.gov / assembly / GCA_052625515.1 / ; Acc_2:https: / / www.ncbi.nlm.nih.gov / assembly / GCA_965117795.1 / ; Acc_3:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH117.te_GWHDREF00000000 / GWHDREF00000000.genome.fasta.gz ; Acc_4:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH193.te_GWHDRGP00000000 / GWHDRGP00000000.genome.fasta.gz ; Acc_5:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH205.te_GWHDRGZ00000000 / GWHDRGZ00000000.genome.fasta.gz ; Acc_6:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG17.fixed.fa.gz ; Acc_7:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG4.fixed.fa.gz ; Acc_8:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG63.fixed.fa.gz ; Acc_9:https: / / www.ncbi.nlm.nih.gov / nuccore / VYIH00000000; Acc_10:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH005.te_GWHDRAP00000000 / GWHDRAP00000000.genome.fasta.gz ; Acc_11:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH013.te_GWHDRAX00000000 / GWHDRAX00000000.genome.fasta.gz ; Acc_12:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH040.te_GWHDRBS00000000 / GWHDRBS00000000.genome.fasta.gz ; Acc_13:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH135.te_GWHDRET00000000 / GWHDRET00000000.genome.fasta.gz ; Acc_14:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH137.te_GWHDREV00000000 / GWHDREV00000000.genome.fasta.gz ; Acc_15:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH142.te_GWHDRFA00000000 / GWHDRFA00000000.genome.fasta.gz ; Acc_16:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH145.te_GWHDRFD00000000 / GWHDRFD00000000.genome.fasta.gz ; Acc_17:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH146.te_GWHDRFE00000000 / GWHDRFE00000000.genome.fasta.gz ; Acc_18:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH191.te_GWHDRGN00000000 / GWHDRGN00000000.genome.fasta.gz ; Acc_19:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH204.te_GWHDRGY00000000 / GWHDRGY00000000.genome.fasta.gz ; Acc_20:https: / / www.ncbi.nlm.nih.gov / assembly / GCF_001433935.1; Acc_21:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH022.te_GWHDRBE00000000 / GWHDRBE00000000.genome.fasta.gz ; Acc_22:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH047.te_GWHDRBY00000000 / GWHDRBY00000000.genome.fasta.gz ; Acc_23:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH168.te_GWHDRFV00000000 / GWHDRFV00000000.genome.fasta.gz ; Acc_24:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH212.te_GWHDRHF00000000 / GWHDRHF00000000.genome.fasta.gz ; Acc_25:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG14.fixed.fa.gz ; Acc_26:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG15.fixed.fa.gz ; Acc_27:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG31.fixed.fa.gz ; Acc_28:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG32.fixed.fa.gz ; Acc_29:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH051.te_GWHDRCA00000000 / GWHDRCA00000000.genome.fasta.gz ; Acc_30:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH133.te_GWHDRER00000000 / GWHDRER00000000.genome.fasta.gz ; Acc_31:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH178.te_GWHDRGD00000000 / GWHDRGD00000000.genome.fasta.gz ; Acc_32:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH222.te_GWHDRHO00000000 / GWHDRHO00000000.genome.fasta.gz ; Acc_33:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH166.te_GWHDRFT00000000 / GWHDRFT00000000.genome.fasta.gz ; Acc_34:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH184.te_GWHDRGI00000000 / GWHDRGI00000000.genome.fasta.gz ; Acc_35:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH011.te_GWHDRAV00000000 / GWHDRAV00000000.genome.fasta.gz ; Acc_36:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG9.fixed.fa.gz ; Acc_37:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG33.fixed.fa.gz ; Acc_38:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG5.fixed.fa.gz ; Acc_39:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG61.fixed.fa.gz ; Acc_40:https: / / zenodo.org / doi / 10.5281 / zenodo.12770803 ; Acc_41: https: / / www.ncbi.nlm.nih.gov / assembly / GCA_040181785.1 / ; (The "Oryza sativa Indica Group" listed on the webpage is incorrect. Consulting the relevant literature "K. Sedeek, N. Mohammed, Y. Zhou, et al.: Multitrait engineering of Hassawi red rice forsustainable cultivation. Plant Sci 2024, 341:112018." confirms that the corresponding variety is indeed Oryza sativa Indica.) Acc_42:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH144.te_GWHDRFC00000000 / GWHDRFC00000000.genome.fasta.gz; Acc_43:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH227.te_GWHDRHS00000000 / GWHDRHS00000000.genome.fasta.gz; Acc_44:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_NH241.te_GWHDRIB00000000 / GWHDRIB00000000.genome.fasta.gz; Acc_45:https: / / download.cncb.ac.cn / gwh / Plants / Oryza_sativa_AUS449_GWHESQL00000000 / GWHESQL00000000.genome.fasta.gz; Acc_46: https: / / zenodo.org / doi / 10.5281 / zenodo.12770803; Acc_47:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG49.fixed.fa.gz; Acc_48:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG6.fixed.fa.gz; Acc_49:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG60.fixed.fa.gz; Acc_50:https: / / www.ncbi.nlm.nih.gov / nuccore / VYIG00000000; Acc_51:http: / / ricerc.sicau.edu.cn / ; Acc_52:https: / / zenodo.org / record / 3355330#.X5KEU1MzbOQ; Acc_53:https: / / zenodo.org / record / 3355330#.X5KEU1MzbOQ; Acc_54:https: / / figshare.com / s / e8bd43ec6e29f56d9edd; Acc_55:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / TG81.fixed.fa.gz; Acc_56:https: / / www.ncbi.nlm.nih.gov / nuccore / VYID00000000; Acc_57:https: / / cgm.sjtu.edu.cn / TGSrice / data / chromosome-level_scaffolds / WW8.fixed.fa.gz; 3. Use the following command line to create an index for the genome assembly sequences of each rice variety: makeblastdb -inRiceGenome.fasta -dbtype nuc, where RiceGenome.fasta refers to the filename where the genome assembly sequences of each rice variety are stored; 4. The 400bp flanking sequences (upstream 200bp flanking sequences + downstream 200bp flanking sequences) marked with BLAST software were compared with the genome assembly sequences of various rice varieties. The command line used was as follows: blastn -task blastn -query FlankingSeq.fasta -db RiceGenome.fasta -out Results.txt -outfmt7 -evalue 10; 5. If the upstream and downstream flanking sequences are directly connected in the alignment results, it indicates that the sequence does not contain [a specific sequence]. Olo24 Insert the transposon; otherwise, contain Olo24 Insert the rotary connector.

[0030] III. Results Genomic sequence identification results as follows Figure 2 As shown, the results indicate that all nine subtropical japonica rice varieties contain the following at the corresponding positions (i.e., insertion sites) in their genomes. Olo24 The insertion frequency of the transposon was 100% in the population; however, none of the 11 temperate japonica rice, 8 tropical japonica rice, 11 indica rice, 11 Australopithecus rice, and 7 aromatic rice varieties contained the transposon at the corresponding location in their genomes. Olo24 The transposon insertion frequency was 0%. The results were completely consistent with expectations, confirming that the subtropical japonica rice-specific transposon insertion markers disclosed in this paper can accurately distinguish subtropical japonica rice from other rice groups (Indica subspecies, Osage subspecies, Aromatic rice subspecies, Temperate japonica rice, and Tropical japonica rice).

[0031] Example 2 This embodiment describes a method for identifying subtropical japonica rice using a PCR-based approach with transposon insertion markers specific to subtropical japonica rice as disclosed herein. The specific process is as follows: I. Materials Thirty rice materials with known affiliations were selected, as shown in Table 2, including five varieties each of temperate japonica rice, subtropical japonica rice, tropical japonica rice, indica rice, Australopithecus rice, and fragrant rice.

[0032] Table 2 Information on 30 rice materials used for PCR amplification detection

[0033] II. Methods 1. Genomic DNA was extracted from each rice material using the standard CTAB method, as detailed below: 1) In a 2.0 mL centrifuge tube, add 500 μl of 2×CTAB and 20 μl of β-mercaptoethanol (2%), and preheat at 65 °C; 2) Take 1-2g of fresh tissue material, rinse it with distilled water, rinse it twice with sterile ddH2O, put it into a mortar pre-cooled with liquid nitrogen, add liquid nitrogen and grind it into powder, add a small amount of PVP (polyvinylpyrrolidone K30) in the middle, use a clean sterile stainless steel spoon to transfer the powder into a preheated centrifuge tube, the total volume reaches 1 ml, mix well and incubate in a 65℃ water bath for 45-60 minutes, and gently rotate the test tube from time to time. 3) Add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) and gently invert to mix. Let stand for 5 min to allow the reaction to proceed fully. Then centrifuge at 12,000 rpm for 5 min at room temperature and transfer the supernatant to another new tube. 4) Add an equal volume of chloroform / isoamyl alcohol (24:1) and gently invert to mix. Let stand for 5 min to allow the reaction to proceed fully. Centrifuge at 12,000 rpm for 5 min at room temperature and transfer the supernatant to another new tube. 5) Repeat step 4). 6) Add 2 volumes of ice-cold 100% ethanol or 0.7 volumes of isopropanol, incubate at -20°C for 30 min or at -80°C for 10 min, and centrifuge at 12000 rpm for 10 min after flocculent precipitate appears and recover the DNA precipitate. 7) Wash the precipitate with 70% ethanol, dry it, and then dissolve it in an appropriate amount of sterile TE buffer; 8) 0.8% agarose gel electrophoresis was used to detect the integrity of genomic DNA.

[0034] 2. Design specific PCR primers based on the flanking sequences of the transposon insertion site; Forward primer (F): 5'-AACATCAAGTCCCAGTAAAT-3' (SEQ ID NO:4) Reverse primer (R): 5'-ATCACCCACTGAAACTATGC-3' (SEQ ID NO:5) Expected PCR amplification product length: Subtropical japonica rice: 545 bp (including 197 bp flanking sequence + 345 bp) Olo24 (Transistor insertion +3 bp TSD) Other groups: 197 bp (flanking sequences only) 3. PCR reaction The PCR reaction system (25 μL) is shown in Table 3.

[0035] Table 3 PCR reaction system

[0036] The PCR amplification procedure is as follows: Pre-denaturation: 94°C, 5 min; Denaturation: 94°C, 30 s; Annealing: 53°C, 30 s; Extension: 72°C, 30 s; Number of cycles: 35 cycles; Final extension: 72°C, 5 min.

[0037] PCR products were detected by 2% agarose gel electrophoresis.

[0038] III. Results Agarose gel electrophoresis results are as follows Figure 3 As shown, the results indicate that all five subtropical japonica rice varieties amplified a specific large band of 545 bp, indicating that the corresponding positions (i.e., insertion sites) in their genomes all contain [the specific band]. Olo24 Transposon insertion; and all five temperate japonica rice varieties, five tropical japonica rice varieties, five indica rice varieties, five Australopithecus rice varieties, and five aromatic rice varieties amplified a specific 197 bp band, indicating that the corresponding positions in their genomes do not contain transposon insertions. Olo24 Transposon insertion. The results were completely consistent with expectations, further confirming that the transposon insertion marker specific to subtropical japonica rice disclosed in this paper can accurately distinguish subtropical japonica rice from other rice groups (Indica subspecies, Osage subspecies, Aromatic rice subspecies, Temperate japonica rice, and Tropical japonica rice).

[0039] It should be understood that the various forms of processes shown above can be used to rearrange, add, or delete steps. For example, the steps described in this disclosure can be executed in parallel, sequentially, or in different orders, as long as the desired result of the technical solution of this disclosure can be achieved, and this is not limited herein.

[0040] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of that feature.

[0041] The above description is merely a specific embodiment of this disclosure, but the scope of protection of this disclosure is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this disclosure should be included within the scope of protection of this disclosure. Therefore, the scope of protection of this disclosure should be determined by the scope of the claims.

Claims

1. A method for identifying whether a rice variety to be tested belongs to subtropical japonica rice, characterized in that, Includes the following steps: S1. DNA Extraction: Extract genomic DNA from the rice sample to be tested; S2. PCR amplification: Using the genomic DNA as a template, PCR amplification is performed using the PCR primer combination shown in SEQ ID NO:4 and SEQ ID NO:5 to obtain PCR amplification products; S3. Result Interpretation: The PCR amplification products were detected by agarose gel electrophoresis. If the PCR amplification product contains transposon molecular marker insertion, the rice to be tested is determined to be subtropical japonica rice. If the PCR amplification product does not contain transposon molecular marker insertion, the rice to be tested is determined to belong to other rice groups, including Indica rice subspecies, Osmanthus rice subspecies, Aromatic rice subspecies and / or other japonica rice subspecies that are not subtropical japonica rice; The transposon molecular marker is a subtropical japonica rice-specific transposon insertion marker. Its insertion site is located between nucleotides 1,905,300 and 1,905,301 on chromosome 1 of the Nipponbare rice reference genome of version IRGSP-1.0, and is a transposon with a length of 345 bp as shown in SEQ ID NO:1.

Images