The acquisition of maize waterlogging-resistant major QTL qWTCTBN6.1, and the development and application of its molecular marker primers.

Abstract

The application belongs to the field of molecular biology, and discloses obtaining of a main-effect QTL qWTCTBN6.1 of corn waterlogging tolerance, and development and application of a molecular marker primer thereof. The application provides that the main-effect QTL qWTCTBN6.1 of a waterlogging tolerance coefficient of corn tassel branch number is located on the sixth chromosome of corn, the site is a main-effect QTL site for controlling a waterlogging phenotype variation, a fine haplotype SNP marker closely linked to the site is located at the 179642663th base of the sixth chromosome of the corn B73 reference genome, a waterlogging tolerance coefficient phenotype contribution rate of the tassel branch number is 9.85%, a PARMS marker designed by using the SNP is used for detecting a corn inbred line population, it is found that the marker is simple in operation and clear in typing, and has a good selection effect on a corn ear position, leaf width, row grain number and other traits under waterlogging stress, and can be used for molecular marker assisted selection breeding of a corn field plant type waterlogging tolerance trait.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to the acquisition of maize waterlogging-resistant major QTL qWTCTBN6.1, and the development and application of its molecular marker primers. Background Technology

[0002] Maize is a globally crucial dual-purpose crop for both food and cash crops, and is a typical dryland crop, highly sensitive to waterlogging stress. Waterlogging damage occurs at all stages of maize's growth, hindering normal plant growth and development, ultimately leading to yield reduction. Waterlogging is one of the major abiotic stress factors limiting global maize production capacity. Therefore, clarifying the genetic regulation of waterlogging tolerance in maize and breeding new waterlogging-tolerant maize varieties are crucial for mitigating waterlogging stress and stabilizing maize yield.

[0003] Poor field drainage and intermittent, continuous rainfall are the main contributing factors to waterlogging stress during the maize growth cycle. Water requirements vary significantly across different growth stages of maize, with daily water requirements decreasing in the following order: flowering-silking stage, tasseling-flowering stage, jointing-tasseling stage, silking-harvest stage, and lowest water requirement during sowing-emergence stage. Tolerance to waterlogging stress differs across growth stages; waterlogging at the jointing stage results in the most severe damage to plant growth, development, and yield traits, followed by the seedling, tasseling, and milk stages. The number of grains per ear and the 100-grain weight are core traits determining maize yield, and the severity of waterlogging stress increases with prolonged stress duration. In farmland soils with inadequate irrigation and drainage systems and high groundwater levels, maize roots are chronically hypoxic, significantly inhibiting root absorption and utilization of soil nutrients and hindering normal plant metabolism and growth. Existing research confirms that flooding during the jointing stage has a greater negative impact on maize yield than flooding during the tasseling stage. Flooding during the jointing stage primarily inhibits female ear differentiation and development, leading to a significant decrease in the number of grains per ear and ultimately reducing yield, while its impact on thousand-grain weight is relatively small. In terms of variety, plant type, and planting density, tall maize varieties and maize populations planted in high-density patterns are more sensitive to flooding stress, suffering significantly more damage than dwarf varieties and low-density planting populations. Production surveys and experimental data show that flooding stress lasting more than 4 days during the seedling, jointing, and tasseling stages, and more than 6 days during the grain-filling stage, all have a significant negative impact on maize yield.

[0004] Screening and breeding waterlogging-tolerant maize germplasm resources is an effective breeding method to enhance maize's adaptability to stress and reduce yield losses caused by extreme rainy weather. Currently, there are numerous reports on maize's waterlogging tolerance characteristics, but systematic screening and precise identification of waterlogging tolerance evaluation indicators for maize inbred lines remain relatively weak. Different studies have varying timing, duration, and intensity of waterlogging stress, resulting in different stress resistance variation characteristics for various maize traits. Furthermore, genotypic differences exist in the responses of maize inbred lines with different genetic backgrounds to waterlogging stress, leading to the lack of a unified and standardized waterlogging tolerance evaluation system and difficulty in unifying and quantifying identification standards. Genetic studies have shown that superior maize germplasm contains abundant genetic variation in waterlogging tolerance, and that waterlogging tolerance is a typical quantitative trait, synergistically regulated by multiple QTL loci. Since the heritability of maize yield and related stress resistance traits is generally low under flood stress, waterlogging tolerance phenotypic identification is easily affected by environmental factors, and traditional phenotypic breeding has limited efficiency. Therefore, marker-assisted selection (MAS) can serve as an efficient auxiliary strategy for maize waterlogging tolerance breeding. In summary, identifying key genes for waterlogging tolerance in maize, elucidating their molecular regulatory mechanisms of stress tolerance, creating superior waterlogging-tolerant new germplasm, and breeding new waterlogging-tolerant varieties are the most economical and efficient technical approaches to reduce waterlogging damage to maize, increase maize yield per unit area, and expand the suitable planting range of maize.

[0005] Plant type traits are core agronomic traits in maize cultivation and breeding, and the degree of damage to plant type traits under waterlogging stress varies significantly among different genotypes of maize. Based on this, this study introduces the waterlogging tolerance coefficient (WTC) as an evaluation index. By calculating the relative ratio of each trait under stress conditions to those under normal growth conditions, the waterlogging tolerance of various maize plant types and agronomic traits is quantitatively evaluated.

[0006] Based on the aforementioned research foundation and current production status, this study collected 567 backbone inbred lines from the core maize-producing areas of Southwest my country and the Huang-Huai-Hai Plain as experimental materials to construct a superior germplasm association population with rich genetic diversity. Using the DNBSEQ-T7 / PE150 sequencing platform, 20X deep whole-genome resequencing was completed for all germplasm, combined with precise field waterlogging stress identification experiments. Genome-wide association analysis was used to explore superior allelic variations in maize's waterlogging tolerance, and functional markers for superior haplotypes were developed and their breeding effects evaluated. The aim is to provide key candidate targets and theoretical support for the genetic improvement of waterlogging-tolerant maize germplasm, create stable waterlogging-tolerant intermediate breeding materials, and lay a germplasm and theoretical foundation for the breeding of high-yielding, waterlogging-tolerant maize varieties. Summary of the Invention

[0007] The purpose of this invention is to provide a reagent for detecting the base at position 179642663 on chromosome 6 of the maize genome and its application in the screening and breeding of maize for waterlogging tolerance.

[0008] Another objective of this invention is to provide the application of a reagent for detecting base 179642663 on chromosome 6 of the maize genome in the preparation of a screening kit for maize waterlogging tolerance.

[0009] The final objective of this invention is to provide a method for screening and breeding maize with waterlogging tolerance traits.

[0010] To achieve the above objectives, the present invention is implemented through the following technical solution:

[0011] Obtaining the main effect QTL qWTCTBN6.1 for controlling the number of tassel branches in maize:

[0012] 1) Through genome-wide association analysis, this invention detected the major-effect QTL qWTCTBN6.1 on chromosome 6 of maize, which regulates the waterlogging tolerance coefficient of maize tassel branch number. This interval contains 18 significant SNP sites with a total length of 2.117 Mb (Chr6: 179208950-181326364). Furthermore, a superior haplotype SNP marker closely linked to it was discovered, located at 179642663 bases on chromosome 6 of the maize B73 reference genome (Zm-B73-REFERENCE-NAM-5.0), which explained 9.85% of the phenotypic contribution of waterlogged tassel branch number.

[0013] 2) For the above-mentioned SNP molecular markers, the applicant has developed PARMS marker primers, which are as follows:

[0014] qWTCTBN6.1F1 (Waterlogging Resistance Haplotype G): GAAGGTCGGAGTCAACGGATT TCTCGTCTCGTGCATGAGAAATG, as shown in SEQ ID NO.3;

[0015] qWTCTBN6.1F2 (Water-sensitive haplotype C): GAAGGTGACCAAGTTCATGCT TCTCGTCTCGTGCATGAGAAATC, as shown in SEQ ID NO.4;

[0016] And qWTCTBN6.1R: CCCAGATATAGCTTGACCACTCTC, as shown in SEQ ID NO.5.

[0017] The scope of protection of this invention also includes:

[0018] Application of reagents for detecting base position 179642663 on chromosome 6 of the maize genome in screening breeding for waterlogging tolerance.

[0019] Application of reagents for detecting base 179642663 on chromosome 6 of the maize genome in the preparation of a screening kit for maize waterlogging tolerance.

[0020] In the above-described applications, if a homozygote is detected with a base G at position 179642663 on chromosome 6 of the maize genome, the maize is determined to be waterlogged tolerant maize; if a homozygote is detected with a base C at position 179642663 on chromosome 6 of the maize genome, the maize is determined to be waterlogged sensitive maize.

[0021] In the above-described applications, preferably, the reagent is a primer.

[0022] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by this invention:

[0023] qWTCTBN6.1F1 (waterlogging resistant haplotype G): GAAGGTCGGAGTCAACGGATTTCTCGTCTCGTGCATGAGAAATG, as shown in SEQ ID NO.3; qWTCTBN6.1F2 (waterlogging sensitive haplotype C): GAAGGTGACCAAGTTCATGCTTCTCGTCTCGTGCATGAGAAATC, as shown in SEQ ID NO.4; and qWTCTBN6.1R: CCCAGATATAGCTTGACCACTCTC, as shown in SEQ ID NO.5.

[0024] In the above-described applications, the waterlogging resistance coefficient of the tassel branches of the waterlogged corn is greater than 0.7, while the waterlogging resistance coefficient of the tassel branches of the waterlogged sensitive corn is less than 0.5.

[0025] A method for screening and breeding maize with waterlogging tolerance includes detecting base 179642663 on chromosome 6 of the maize genome using conventional methods in the art. The conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry method.

[0026] The above-described applications or methods include waterlogging tolerance traits such as ear height, leaf width, and / or yield waterlogging tolerance coefficient.

[0027] The reference genome of maize used in this invention is Zm-B73-REFERENCE-NAM-5.0.

[0028] Compared with the prior art, the present invention has the following advantages:

[0029] This invention is the first to finely map a novel major QTL controlling the waterlogging tolerance coefficient of maize tassel branch number based on genome-wide association analysis. The major QTL is located on chromosome 6, which contains 18 significant SNP loci with a total length of 2.117 Mb (Chr6: 179208950-181326364). All of these loci are major QTL loci controlling waterlogging tolerance phenotypic variation. The superior haplotype SNP marker closely linked to it is located at 179642663 bases on chromosome 6 of the maize B73 reference genome (Zm-B73-REFERENCE-NAM-5.0), explaining 9.85% of the contribution of waterlogged tassel branch number phenotype. The PARMS marker developed based on its optimal allele can be used for marker-assisted selection breeding.

[0030] The applicant verified, through field waterlogging-tolerant plant type phenotypic traits of tassel branch number in 567 maize inbred lines, that the superior haplotype qWTCTBN6.1 can increase the waterlogging tolerance coefficient of tassel branch number by 16.59% in natural populations. Furthermore, it exhibits good selection effects on traits such as ear height, leaf width, and number of kernels per ear under waterlogging stress in maize, and has received strong selection in breeding practice. This superior haplotype provides genetic resources for the creation of waterlogging-tolerant maize lines. Attached Figure Description

[0031] Figure 1 These are some field photos from the first domestic field waterlogging tolerance test of maize using 567 inbred lines.

[0032] The control group had 2 replicates, and the waterlogging treatment group had 3 replicates.

[0033] Figure 2 The distribution of plant type traits, including the number of male spike branches and the waterlogging tolerance coefficient, during the week of waterlogging in the field at the jointing stage of an inbred line population.

[0034] Figure 3 This is a schematic diagram of the qWTCTBN6.1 site association analysis.

[0035] Association analysis of 13.2 million polymorphic variation sites with a minimum allele frequency greater than 0.05 at the qWTCTBN6.1 locus with the male branch waterlogging tolerance coefficient phenotype in 567 different inbred lines. Each dot represents a polymorphic site.

[0036] Figure 4 A schematic diagram for the analysis of superior haplotype effects;

[0037] A comparative analysis of the waterlogging tolerance coefficients of male spike branch number in 253 Hap1 inbred lines and 231 Hap2 inbred lines was conducted. Each box represents the median and interquartile range, extended to the maximum and minimum values. The significance of the differences was estimated by one-way ANOVA.

[0038] Figure 5 A schematic diagram illustrating the genetic effect evaluation of qWTCTBN6.1 in the trait of leaf width waterlogging tolerance coefficient;

[0039] The scatter plots represent the distribution of the stain resistance coefficient, each box represents the median and interquartile range and extends to the maximum and minimum values, and the error bars represent the SD. The significance of the differences was estimated by one-way ANOVA.

[0040] Figure 6 A schematic diagram illustrating the genetic effects of qWTCTBN6.1 on the trait of high waterlogging tolerance at the ear position;

[0041] The scatter plots represent the distribution of the stain resistance coefficient, each box represents the median and interquartile range and extends to the maximum and minimum values, and the error bars represent the SD. The significance of the differences was estimated by one-way ANOVA.

[0042] Figure 7 A schematic diagram illustrating the genetic effect evaluation of the row number stain resistance coefficient trait in qWTCTBN6.1;

[0043] The scatter plots represent the distribution of the stain resistance coefficient, each box represents the median and interquartile range and extends to the maximum and minimum values, and the error bars represent the SD. The significance of the differences was estimated by one-way ANOVA.

[0044] Figure 8 A schematic diagram illustrating the development and utilization of the optimal haplotype functional marker for qWTCTBN6.1;

[0045] In the figure: green: qWTCTBN6.1 type has weak waterlogging resistance; blue: qWTCTBN6.1 type has strong waterlogging resistance; gray: negative control, the substrate for spotting is blank. Detailed Implementation

[0046] Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the field; unless otherwise specified, the reagents or materials described are all publicly available.

[0047] The reference genome for maize in this invention is Zm-B73-REFERENCE-NAM-5.0 (MaizeGDB GenomeCenter).

[0048] Example 1:

[0049] Obtaining the main effect QTL qWTCTBN6.1 for maize tassel branch number waterlogging tolerance coefficient:

[0050] 1. Materials and Methods

[0051] 1.1 Materials

[0052] A total of 567 backbone inbred lines from maize producing areas in Southwest China and the Huang-Huai-Hai Plain were collected. A population of superior germplasm with different characteristics was established. The whole genome was resequencing at a depth of 20X based on the DNBSEQ-T7 / PE150 sequencing platform, and 13.2 million high-quality SNP markers were obtained.

[0053] 1.2 Experimental Methods

[0054] 1.2.1 Phenotypic Identification

[0055] The first domestic field flood resistance trial of related populations was conducted at the experimental base of the Agricultural Science Research Institute in Gucheng County, Hubei Province. Under actual production conditions, the flood resistance of core maize germplasm resources was assessed through field trials. In early April 2024, 567 related populations were sown, divided into a control group and a flood-treated group. The control group contained two biological replicates, with each seed sample planted in a single row; the flood-treated group contained three biological replicates, also with each seed sample planted in a single row. After sowing, when the maize plants reached the spikelet differentiation stage (jointing stage), the flood-treated group was flooded for one week, with the water level in the flood-treated group approximately 10 cm high, submerging the first leaf of the plant; while the control group received no treatment and was allowed to grow normally. After the maize plants have completed their growth period, the agronomical traits of maize plant type under control (CK) and waterlogging (WT) conditions were measured and recorded, including the number of tassel branches (cm), ear height (cm), length of leaves above the ear (cm), width of leaves above the ear (cm), number of tassel branches, length of the main axis of the tassel (cm), and number of leaves above the ear. After the maize plants matured, the agronomical traits of maize plant type in the field were measured and recorded under control (CK) and waterlogging (WT) conditions, including ear length (cm), ear diameter (cm), ear weight (g), 100-kernel weight (g), number of tassel branches (g), number of rows per ear, and number of kernels per row per ear. Subsequently, the waterlogging tolerance coefficient (WTC) for each trait was calculated; the waterlogging tolerance coefficient is the ratio of the trait value under waterlogging conditions to that under control conditions.

[0056] 1.2.2 Genome-wide association analysis of maize plant architecture waterlogging tolerance loci

[0057] For the raw sequencing data after sequencing, data quality control was performed to obtain high-quality clean data. This clean data was then aligned to a reference genome for variant detection. The reference genome used was AGPv5, downloaded from http: / / plants.ensembl.org / Zea_mays / Info / Index. BWA software was used to align PE reads with the B73 reference genome sequence, obtaining alignment results in AM format. The SAM format file was converted to BAM format using samtools software. Then, the reads in the BAM file were sorted using the SortSam tool in Picard, and PCR duplicates were removed to obtain the final BAM file suitable for variant calling. Finally, the HaplotypeCaller module of GATK was used for variant detection, including SNPs and InDels. Q and K were calculated using STRUCTURE and TESSEL 5.0 software, respectively. After correction, the P-value was set to 1.0 × 10⁻⁶. -5 As a threshold for the significance of GWAS results.

[0058] 1.2.3 Development of optimal haplotype molecular markers

[0059] Based on the B73 genome and differentially expressed site information provided by qWTCTBN6.1 sequencing, specific primers were designed and detected using PARMS technology. Three marker-specific primers were included, and these needed to be custom-designed and synthesized according to the experimental objectives. One primer was a locus-specific primer, and the other two were allele-specific primers for SNPs. A 21-base universal adapter sequence was added to the 5' end of each of these two primers for matching amplification with fluorescent universal primers. The adapter sequence matching FAM fluorescence was GAAGGTGACCAAGTTCATGCT, and the adapter sequence matching HEX fluorescence was GAAGGTCGGAGTCAACGGATT.

[0060] 1.2.4 Genotype Analysis

[0061] Small-scale DNA extraction from maize was performed using the CTAB (Cetyltrimethyl Ammonium Bromide) method (Saghai-Maroof et al 1984), followed by PARMS SNP detection.

[0062] 2. Results and Analysis

[0063] 2.1 Evaluation of the waterlogging resistance of 567 inbred lines

[0064] During spikelet differentiation (jointing stage), the field waterlogging group was treated with waterlogging for one week, while the control group grew normally. At the canopy level, the waterlogging tolerance coefficient for tassel branches was 0.70, ranging from 0.07 to 0.99; the waterlogging tolerance coefficient for spike height was 0.71, ranging from 0.34 to 0.99. There was a significant difference in plant height between the control and waterlogged groups; the waterlogging tolerance coefficient for plant height was 0.83, ranging from 0.30 to 0.99; the waterlogging tolerance coefficient for tassel length was 0.78, ranging from 0.20 to 0.99, with a wide range of variation; leaf length... The waterlogging tolerance coefficient was 0.76, with a variation range of 0.39-0.99; the waterlogging tolerance coefficient for leaf width was 0.76, with a variation range of 0.29-0.99; the overall tolerance coefficient was similar to that for leaf length; the waterlogging tolerance coefficient for tassel branching was 0.70, with a variation range of 0.07-0.99; and the waterlogging tolerance coefficient for ear height was 0.71, with a variation range of 0.34-0.99. Among the field plant type traits, tassel branching and ear height were the most sensitive to waterlogging stress, while plant height and tassel length were relatively less affected by waterlogging stress, but all of their phenotypic variations were very rich (Table 1).

[0065] Based on plant type traits such as the number of male branches and waterlogging tolerance coefficient after one week of waterlogging, the population was divided into 8 levels. Among them, there were 108 inbred lines with a waterlogging tolerance coefficient greater than 0.85, 93 inbred lines with a waterlogging tolerance coefficient less than 0.55, and 283 inbred lines with a waterlogging tolerance coefficient between 0.55 and 0.85. Figure 2 ).

[0066] Table 1. Evaluation of waterlogging tolerance in inbred line populations based on plant type traits.

[0067] .

[0068] CK represents the normal growth group, WT represents the waterlogged treatment group, and T-test two-way ANOVA is used for significance testing.

[0069] 2.2 Identification and genetic effect analysis of the qWTCTBN6.1 gene locus for the tassel branch number and waterlogging tolerance coefficient.

[0070] This application identifies a novel major QTL controlling the number of male tassel branches and waterlogging tolerance in maize based on genome-wide association analysis. This major QTL is located on chromosome 6, and the region contains 18 significant SNP loci with a total length of 2.117 Mb (Chr6: 179208950-181326364), named qWTCTBN6.1. Figure 3 ).

[0071] The lead SNP 179642663 (G / C) at the qWTCTBN6.1 locus was significantly associated with the waterlogging tolerance coefficient of the number of male tassel branches in maize at P = 1.6E-12. This locus is located at base 179642663 on chromosome 6 of the maize genome (maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0, referred to in this invention as the maize B73V5 reference genome), and it explains 9.85% of the phenotypic contribution of the number of male tassel branches to the waterlogging tolerance coefficient.

[0072] PARMS primers were designed for the above SNP sites as follows:

[0073] (1) For the peak SNP marker leadSNP179642663 (G / C) closely linked to qWTCTBN6.1, 200 bp sequences were extracted upstream and downstream of position 179642663 on chromosome 6 of the maize B73V5 reference genome. The PARMS marker detection primer sequences were obtained according to the primer design principles as follows:

[0074] qWTCTBN6.1F1: GAAGGTGACCAAGTTCATGCT TCTCGTCTCGTGCATGAGAAATC, as shown in SEQ ID NO.3;

[0075] qWTCTBN6.1F2: GAAGGTCGGAGTCAACGGATT TCTCGTCTCGTGCATGAGAAATG, as shown in SEQ ID NO.4;

[0076] qWTCTBN6.1R: CCCAGATATAGCTTGACCACTCTC, as shown in SEQ ID NO.5.

[0077] The underlined part of the forward primer is the fluorescent adapter sequence.

[0078] (2) Using the genomic DNA of the maize inbred line population as a template, the above primers were used to perform real-time PCR amplification. The FAM and HEX signals were scanned using a Tecan F200 and the results were output. Finally, the genotype was converted.

[0079] Using the primers described above, the sequence amplified in the stain-resistant material N75 (parent of Yidan 629) is: TCTCGTCTCGTGCATGAGAAAT GCTTCCAGAAAACTCCATTCCGCTCCGCTGTAAATACGAGGGCCTGTCAATTTTTGGGCCGGGCCGCAAGAAATTTTGCTGCCCACGAGCGTGCCTCACAGAGAGTGGTCAAGCTATATCTGGG, as shown in SEQ ID NO.1;

[0080] The sequence amplified in the stain-resistant material Jing 724 (parent stock of Jingke 968) is: TCTCGTCTCGTGCATGAGAAAT C CTTCCAGAAAACTCCATTCCGCTCCGCTGTAAATACGAGGGCCTGTCAATTTTTGGGCCGGGCCGCAAGAAATTTTGCTGCCCACGAGCGTGCCTCACAGAGAGTGGTCAAGCTATATCTGGG, as shown in SEQ ID NO.2;

[0081] Table 2 Amplification System

[0082] .

[0083] Table 3 Amplification Parameters

[0084] .

[0085] The 567 maize inbred lines were divided into two haplotypes, Hap1 and Hap2, based on SNP179642663 (G / C). These were then divided into two groups for comparison of the number of tassel branches after one week of field flooding between the two haplotypes. 253 inbred lines were of the SNP179642663 (G / G) allele (Hap1 genotype), and 231 were of the SNP179642663 (C / C) allele (Hap2 genotype). Other heterozygous sites were filtered out and not included. Compared to the Hap2 haplotype, the Hap1 haplotype inbred lines showed an average increase of 16.59% in the number of tassel branches after field flooding (P = 1.6E-12). Figure 4 Therefore, Hap1 is a superior haplotype of qWTCTBN6.1, accounting for 52.27%.

[0086] Meanwhile, qWTCTBN6.1 is a pleiotropic gene locus; under waterlogging stress, its superior haplotype Hap1 significantly affects ear height, leaf width, and grain number per ear row, thus influencing waterlogging tolerance coefficient. Regarding plant type-related traits, compared to the Hap2 haplotype, the leaf width waterlogging tolerance coefficient of the Hap1 haplotype inbred lines increased by an average of 0.021 (p=0.019). Figure 5The average waterlogging tolerance coefficient decreased by 0.037 (p=0.0025) due to higher ear height. Figure 6 Regarding yield-related traits, under waterlogging stress, the row number of the Hap1 haplotype self-crossing line increased by an average of 0.077 (p=0.0053) compared to the Hap2 haplotype. Figure 7 The results indicate that this locus positively regulates the waterlogging tolerance coefficients of leaf width and ear height, suggesting a certain degree of linkage between superior alleles related to plant architecture and yield-related traits in the field. Conversely, it negatively regulates the waterlogging tolerance coefficient of ear height, suggesting that the superior alleles for waterlogging tolerance in maize tassel branch number may have some linkage burden with other plant architecture-related loci. Furthermore, the frequency of Hap1 in inbred lines is 52.27%, further suggesting that there is significant potential for improving waterlogging tolerance in inbred lines using qWTCTBN6.1 in breeding practice. This could aggregate other gene loci related to plant architecture regulation to achieve improved waterlogging tolerance and high yield.

[0087] Example 2:

[0088] Application of superior haplotype molecular marker primers for waterlogging tolerance coefficient of maize tassel branch number: qWTCTBN6.1

[0089] In field trials, 567 inbred line samples and data on the number of tassel branches and waterlogging tolerance coefficients were collected. Subsequently, DNA was extracted from 24 inbred lines, and genotyping was performed using PARMS primers developed for the optimal allele at the qWTCTBN6.1 locus in Example 1. The results showed that 12 inbred lines with waterlogging tolerance coefficients greater than 0.7 belonged to the Hap1 allele, while all 12 inbred lines with waterlogging tolerance coefficients less than 0.5 contained the unfavorable Hap2 allele (Table 4). These results confirm that the developed functional markers can be used for marker-assisted selection in the genetic improvement of waterlogging-tolerant lines, providing selection targets for creating new waterlogging-tolerant maize germplasm and breeding new waterlogging-tolerant varieties. Figure 8 ).

[0090] Table 4 shows that the PARMS designation qWTCTBN6.1SR can be used for stain resistance assessment.

[0091] .

[0092] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. The application of a reagent for detecting base 179642663 on chromosome 6 of the maize genome in the screening and breeding of maize for waterlogging tolerance, characterized by: If a homozygote is detected at position 179642663 of chromosome 6 of the maize genome with a base of G, the maize is determined to be waterlogged tolerant maize. If a homozygote is detected at position 179642663 of chromosome 6 of the maize genome with a base of C, the maize is determined to be waterlogged sensitive maize. The maize genome is Zm-B73-REFERENCE-NAM-5.

0.

2. The application of a reagent for detecting base 179642663 on chromosome 6 of the maize genome in the preparation of a maize waterlogging tolerance screening kit, characterized in that: If a homozygote is detected at position 179642663 of chromosome 6 of the maize genome with a base of G, the maize is determined to be waterlogged tolerant maize. If a homozygote is detected at position 179642663 of chromosome 6 of the maize genome with a base of C, the maize is determined to be waterlogged sensitive maize. The maize genome is Zm-B73-REFERENCE-NAM-5.

0.

3. The application according to claim 1 or 2, characterized in that, The reagent mentioned is a primer.

4. The application according to claim 3, wherein the primer is: qWTCTBN6.1F1:GAAGGTGACCAAGTTCATGCTTCTCGTCTCGTGCATGAGAAATC, as shown in SEQ ID NO.3; qWTCTBN6.1F2:GAAGGTCGGAGTCAACGGATTTCTCGTCTCGTGCATGAGAAATG, as shown in SEQ ID NO.4; qWTCTBN6.1R: CCCAGATATAGCTTGACCACTCTC, as shown in SEQ ID NO.

5.

5. The application according to claim 1 or claim 2, characterized in that, The waterlogging-resistant corn has a waterlogging resistance coefficient of greater than 0.7 for the number of tassel branches, while the waterlogging-sensitive corn has a waterlogging resistance coefficient of less than 0.5 for the number of tassel branches.

6. A method for screening and breeding maize with waterlogging tolerance, comprising detecting the base at position 179642663 of chromosome 6 of the maize genome, wherein the detection method is: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry. If a homozygote is detected at position 179642663 of chromosome 6 of the maize genome with a base of G, the maize is determined to be waterlogging tolerant maize; if a homozygote is detected at position 179642663 of chromosome 6 of the maize genome with a base of C, the maize is determined to be waterlogging sensitive maize. The maize genome is Zm-B73-REFERENCE-NAM-5.0.

Images