Primer-probe combination and detection method for simultaneous detection of Marek's virus vaccine strain SC9-1 and wild-type strain.

Abstract

This invention discloses a primer-probe combination and detection method for simultaneously detecting Marek's virus (MDV) vaccine strain SC9-1 and wild-type strain. The method uses specific primers and probes designed from the chimeric region of the SC9-1 vaccine strain genome (with the Meq gene deleted) and the Meq gene sequence of the virulent wild-type MDV strain. By optimizing the concentration ratio of the two primer-probe combinations and the annealing temperature in the reaction system, Marek's virus vaccine strain SC9-1 and wild-type strain can be detected simultaneously in a single-tube reaction. This achieves simultaneous identification and quantitative detection of the two strains in mixed infection samples. This method exhibits good specificity, sensitivity, and repeatability. Using this method to sample and test chicken flocks immunized with SC9-1 can accurately monitor the replication and transmission level of wild-type virus in the flock, providing timely and effective data support for early warning of disease risk in chicken flocks.

Description

Technical Field

[0001] This invention belongs to the field of animal disease detection technology, specifically relating to primer and probe combinations and detection methods for simultaneously detecting Marek's disease virus vaccine strain SC9-1 and wild-type strain. Background Technology

[0002] Marek's disease is a lymphoproliferative neoplasm disease of chickens caused by Marek's disease virus (MDV), belonging to the family Herpesviridae, subfamily Alphaherpesvirinae. It is highly contagious and has a high mortality rate. For a long time, both domestically and internationally, MDV control has relied on vaccination. MDV includes three serotypes: MDV-1, MDV-2, and MDV-3, of which only the highly virulent MDV-1 serotype is pathogenic. The HVT vaccine for MDV-3 was the first to be used, but with the increasing virulence of wild-type viruses, the protective effect of HVT against MDV has significantly decreased. In 1998, my country introduced the naturally attenuated MDV vaccine CVI988 / Rispens strain from the Netherlands, which gradually became the mainstream vaccine on the market. However, with the use of vaccines and the continuous evolution of wild-type strains, some wild-type strains have now broken through the immune protection of the CVI988 / Rispens vaccine.

[0003] The Meq gene of MDV-1 is the most important oncogenic gene of MDV. Studies have shown that the recombinant MDV vaccine strain SC9-1, after knocking out the Meq gene, provides significantly better protection against wild-type MDV strains than the CVI988 / Rispens strain, and is currently widely used in high-incidence MD areas in my country, such as Guangdong, Guangxi, Yunnan, and Fujian provinces. However, while vaccination with the vaccine strain can establish persistent infection and lifelong immunity in chickens, effectively preventing disease, it cannot prevent infection, replication, and horizontal transmission of virulent wild-type MDV. Therefore, in most cases, immunized chickens will be simultaneously infected with both the vaccine strain and virulent wild-type MDV. For such mixed infection samples, simultaneous quantitative identification and detection of the MDV vaccine strain and the virulent wild-type strain is of great significance for assessing vaccine immunization quality in production, early warning of disease risk after wild-type infection, as well as scientific research, epidemiological investigations, and pathogen eradication.

[0004] Currently, the development of identification and detection methods for virulent wild-type SC9-1 and MDV strains largely focuses on establishing conventional PCR qualitative detection methods. Even the few established quantitative real-time PCR methods require integration with conventional PCR gel running for identification. Patent application CN201810003970.5 discloses primers, probes, and a kit for differentiating serum type I Marek's virus gene-deleted vaccines, attenuated vaccines, and wild-type viruses. This method uses qualitative detection results from two sets of primers and probes to differentiate between serum type I Marek's virus gene-deleted vaccines, attenuated vaccines, and wild-type viruses in a single infected sample. However, this method is limited by the singularity of the sample infection and is not applicable to mixed infection samples where SC9-1 vaccine virus and wild-type virus coexist. Since Marek's disease vaccine can prevent chickens from getting sick but cannot prevent wild-type virus infection, Marek's vaccine strain and wild-type virulent strain can infect chickens at the same time. In many cases, both vaccine virus and virulent strain are present in the chicken's body, and the replication levels of the vaccine virus and wild-type virus in the chicken's body are correlated with the risk of disease. Quantitative identification and detection of the two in mixed infection samples of SC9-1 vaccine virus and wild-type virus has important application value, which current detection methods cannot yet do. Summary of the Invention

[0005] This invention addresses the problem that existing technologies cannot simultaneously detect samples infected with a mixture of Marek's disease virus SC9-1 vaccine strain and wild-type strain, and cannot accurately quantify the infection. It provides a primer-probe combination and detection method for simultaneously detecting Marek's disease virus SC9-1 vaccine strain and wild-type strain, thus solving the aforementioned problems.

[0006] The technical solution of the present invention is as follows:

[0007] This invention provides a primer-probe combination for simultaneously detecting Marek's virus vaccine strain SC9-1 and wild-type strain, the nucleotide sequence (5'-3') of which is as follows:

[0008] SC9-F: AGTCACAATGCGGATCACGT (SEQ ID NO.1);

[0009] SC9-R: GGAGTTGGTGCTGGAATGT (SEQ ID NO. 2);

[0010] SC9-P: CCTGTACCGTGCCCGCCTTC (SEQ ID NO.3);

[0011] WTMDV-F:GTGACCCTTGGACTGCTTAC (SEQ ID NO.4);

[0012] WTMDV-R:ATTGTGGAGCGTTAGGTTCATC (SEQ ID NO.5);

[0013] WTMDV-P: TTCCTGAACCTCCCATTTGCACTCC (SEQ ID NO. 6).

[0014] Preferably, the 5' end of the probe SC9-P and the probe WTMDV-P is labeled with a fluorescent reporter group, and the fluorescent reporter groups of the two probes are different, while the 3' end is labeled with a fluorescent quencher group.

[0015] Preferably, the fluorescent reporter group labeled by probe SC9-P is FAM and the fluorescent quencher group is BHQ1; the fluorescent reporter group of probe WTMDV-P is VIC and the fluorescent quencher group is BHQ1.

[0016] The present invention also provides a kit comprising the above-described primer-probe combination.

[0017] Preferably, the kit further includes: recombinant plasmid standards, dual real-time PCR premix, nucleic acid extraction reagents, and a standard curve establishment tool.

[0018] This invention also provides a dual TaqMan probe-based quantitative PCR method for simultaneously detecting Marek's disease virus SC9-1 vaccine strain and wild-type strain, comprising the following steps:

[0019] S1: Extract DNA from the sample to be tested;

[0020] S2: Using the DNA as a template, a dual real-time PCR amplification reaction is performed in the same reaction system using the primer and probe combination described above.

[0021] S3: The results were determined by collecting signals from different fluorescence channels, and the SC9-1 vaccine strain and MDV wild-type strain were quantitatively analyzed using standard curves established with recombinant plasmid standards.

[0022] Preferably, the recombinant plasmid standard comprises an SC9-1 specific target fragment plasmid and an MDV wild-type strain Meq gene target fragment plasmid; the SC9-1 specific target fragment plasmid is constructed by using SC9-1 vaccine strain DNA as a template, amplifying with primers F1-SC9 and R1-SC9, and cloning into a vector, wherein the primer nucleotide sequences (5'-3') are:

[0023] F1-SC9: ATAATGCCTTTAACCCTTTCCTTTAT (SEQ ID NO.7);

[0024] R1-SC9: TATTATTTTGGTTCGGGGAGGTTG (SEQ ID NO. 8).

[0025] Preferably, the MDV wild-type Meq gene target fragment plasmid is constructed by using Md5 super-virulent strain DNA as a template, amplifying with primers F1-Md5 and R1-Md5, and cloning into a vector; the primer nucleotide sequences (5'-3') are:

[0026] F1-Md5:ATGTCTCAGGAGCCAGAGCC (SEQ ID NO.9);

[0027] R1-Md5:TCAGGGTCTCCCGTCACCT (SEQ ID NO. 10).

[0028] Preferably, the 20 μL system of the dual real-time PCR reaction comprises: 10 μL of 2×Probe qPCR Mix; 0.8 μL each of primers SC9-F, SC9-R, WTMDV-F, and WTMDV-R, each with a final concentration of 10 μmol / L; 0.4 μL each of probes SC9-P and WTMDV-P, each with a final concentration of 10 μmol / L; 1 μL of template DNA; and ddH2O added to a total volume of 20 μL.

[0029] Preferably, the procedure for the dual fluorescence quantitative PCR reaction is as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 10 s; annealing at 60℃ for 30 s; fluorescence signal acquisition; for a total of 40 cycles.

[0030] Preferably, the method for judging the results of the dual TaqMan probe real-time PCR method for simultaneously detecting Marek's disease virus SC9-1 vaccine strain and wild-type strain is as follows:

[0031] The result determination method is as follows: if the Ct value of the sample detected by the first pair of primers SC9-F (SEQ ID NO.1), SC9-R (SEQ ID NO.2) and probe SC9-P (SEQ ID NO.3) is ≤36, and the Ct value of the sample detected by the second pair of primers WTMDV-F (SEQ ID NO.4), WTMDV-R (SEQ ID NO.5) and probe WTMDV-P (SEQ ID NO.6) is >36, then the SC9-1 vaccine strain in the sample is determined to be positive, and the wild-type strain is determined to be negative.

[0032] If the Ct value of the sample detected by the first pair of primers SC9-F (SEQ ID NO.1), SC9-R (SEQ ID NO.2) and probe SC9-P (SEQ ID NO.3) is >36, and the Ct value of the sample detected by the second pair of primers WTMDV-F (SEQ ID NO.4), WTMDV-R (SEQ ID NO.5) and probe WTMDV-P (SEQ ID NO.6) is ≤36, then the SC9-1 vaccine strain in the sample is determined to be negative, and the wild-type strain is determined to be positive.

[0033] If the Ct value of the sample detected by the first pair of primers SC9-F (SEQ ID NO.1), SC9-R (SEQ ID NO.2) and probe SC9-P (SEQ ID NO.3) is ≤36, and the Ct value of the sample detected by the second pair of primers WTMDV-F (SEQ ID NO.4), WTMDV-R (SEQ ID NO.5) and probe WTMDV-P (SEQ ID NO.6) is ≤36, then it is determined that both the SC9-1 vaccine strain and the wild-type strain are positive in the sample, and the sample is a mixed infection sample.

[0034] If the Ct value of the sample detected by the first pair of primers SC9-F (SEQ ID NO.1), SC9-R (SEQ ID NO.2) and probe SC9-P (SEQ ID NO.3) is >36, and the Ct value of the sample detected by the second pair of primers WTMDV-F (SEQ ID NO.4), WTMDV-R (SEQ ID NO.5) and probe WTMDV-P (SEQ ID NO.6) is >36, then it is determined that both the SC9-1 vaccine strain and the wild-type strain in the sample are negative.

[0035] Preferably, the sample to be tested is selected from chicken feather marrow, skin, muscle and internal organ tissue samples or farm environmental samples.

[0036] The primer and probe combination, kit, and detection method provided by this invention can be used to detect whether a sample has been successfully inoculated with the Marek's SC9-1 vaccine strain, and to accurately quantify the SC9-1 copy number in a single infected sample of the SC9-1 vaccine strain, so as to clarify the quality of vaccine immunization and prevent the risk of missed immunization and immunization failure.

[0037] The primer and probe combination, kit, and detection method provided by this invention can be used to detect whether samples immunized with SC9-1 are infected with virulent wild Marek's disease strain. For mixed infection samples, the copy number of SC9-1 vaccine virus and virulent wild virus strain can be accurately and quantitatively detected simultaneously in a single test to determine whether virulent wild virus infection exists in the flock and to accurately determine the in vivo replication trend of vaccine virus and wild virus strain in mixed infection samples, assess the risk of disease, and can also be applied to MDV eradication in flocks.

[0038] The beneficial effects of this invention are as follows:

[0039] This invention provides a primer-probe combination for the simultaneous detection of Marek's virus vaccine strain SC9-1 and wild-type strain, and successfully establishes a TaqMan probe-based dual-fluorescence quantitative PCR method for identifying and detecting MDV SC9-1 vaccine strain and wild-type strain. Since Marek's disease vaccine strain and virulent wild-type strain can simultaneously infect chickens, and in many cases chickens may harbor both vaccine virus and virulent strain simultaneously, this study selected the chimeric region of the SC9-1 vaccine strain genome after the deletion of the Meq gene and the Meq gene sequence of the virulent wild-type MDV strain. Specific primers and probes were designed for each, and reaction conditions were optimized to establish a dual TaqMan quantitative PCR detection method. This method enables simultaneous quantitative identification and detection of SC9-1 vaccine virus and virulent wild-type strain in mixed infection samples, which is of great significance: First, it allows for monitoring the colonization of the vaccine strain in chickens to assess immunization quality and efficacy; second, it allows for accurate monitoring of the transmission level of wild-type virus in chicken flocks and the contamination of MDV in the farming environment, providing data support for early warning of disease risk in chicken flocks; third, it can assist scientific research in evaluating the replication kinetics of vaccine and wild-type virus in vivo to further explore the pathogenesis and control strategies of MD; in addition, the establishment of this detection method and the development and application of related reagent kits can provide important assistance for epidemiological investigations and pathogen eradication. The dual TaqMan probe fluorescence quantitative PCR method provided by this invention provides important technical support for the assessment of SC9-1 vaccine immunization quality, early warning of disease risk after infection with wild-type virus, epidemiological investigation, pathogen purification, and related scientific research in actual production.

[0040] Addressing the limitations of existing technologies (such as patent application CN109355434A), which primarily rely on primer design based on partial deletions of the Meq gene (e.g., knocking out only the first 460bp), this invention leverages the unique biological characteristics of the SC9-1 vaccine strain, which achieves a complete 1020bp Meq gene knockout. It specifically designs primers and probes targeting the chimeric region following the Meq gene deletion in the SC9-1 vaccine strain genome, thus constructing a unique molecular target. Since wild-type strains and other Marek's disease vaccine strains do not possess this recombinant chimeric sequence, this method fundamentally solves the signal interference problem caused by target overlap, exhibiting extremely high strain specificity. Furthermore, since Meq gene knockout is a routine procedure for attenuating virulent wild-type Marek's disease strains, this method may also be applicable to the specific detection of other MDV vaccine strains constructed by knocking out the entire 1020bp Meq gene and their differentiation from virulent MDV strains.

[0041] Furthermore, patent application CN201810003970.5 discloses primers, probes, and a kit for differentiating between serotype I Marek's virus gene-deleted vaccines, attenuated vaccines, and wild-type viruses. This method uses qualitative detection results from two sets of primers and probes to differentiate between these three vaccines in a single infection sample. However, this method is limited by the singularity of the infection and is not applicable to mixed infection samples where SC9-1 vaccine virus and wild-type virus coexist. This invention fills this gap by designing primers and probes specifically targeting SC9-1 based on the genomic sequence characteristics of the SC9-1 strain. This allows for the specific amplification of only SC9-1 nucleic acid samples, enabling precise quantitative differentiation and detection of both SC9-1 vaccine virus and wild-type virus in mixed infection samples. Since Marek's vaccine can prevent chickens from getting sick but cannot prevent wild-type virus infection, Marek's vaccine strain and wild-type virulent strain can infect chickens at the same time. In many cases, both vaccine virus and virulent strain are present in chickens at the same time, and the replication levels of vaccine virus and wild-type virus in chickens are correlated with the risk of disease. Therefore, the primer-probe combination and detection method provided by this invention have important application value.

[0042] Regarding detection efficiency and accuracy, this study precisely standardized the annealing temperature of the dual PCR system to 60℃ and optimized the concentrations of the two primer pairs and probes in the reaction system to a 1:1:1:1 ratio (0.4 μL each). This ratio prevented excessive competition for enzymes and substrates when the concentration of one virus was too high, thus ensuring that even with significant differences in vaccine and wild-type virus content, the low viral load signal would not be overwhelmed. This ensured stable capture efficiency of low-abundance targets even in complex environments with high sample interference, achieving detection limits of 1.00 × 10¹ copies / μL for the SC9-1 vaccine strain and 1.42 × 10¹ copies / μL for the wild-type strain. Simultaneous linear amplification of the dual-channel signal was achieved within 40 cycles. 1 -10 9 The correlation coefficient R over a wide range of copies / μL 2 All values ​​are greater than or equal to 0.999, ensuring the accuracy of quantitative detection of clinical mixed infection samples. Unlike existing technologies that require two independent systems for testing, this invention achieves single-tube dual amplification, not only doubling the detection throughput and significantly reducing the testing cost for large batches of clinical samples, but also eliminating inter-tube errors through synchronous monitoring within the same system, making the analysis of the load ratio between vaccine and wild-type virus more accurate. It solves the problem that SYBR Green I cannot distinguish between sequence-similar vaccine strains and wild-type virus strains within a single tube, and cannot achieve real-time quantification via dual channels.

[0043] Furthermore, this method employs a fully enclosed detection mode, completely blocking aerosol contamination. Combined with automated equipment, it enables a simplified "sample loading and immediate testing" process, significantly shortening the detection cycle. Practical application results on laying hen samples from Yulin and other areas of Guangxi Zhuang Autonomous Region further confirm that this method can accurately capture low viral nucleic acid loads in clinical samples, providing practical and robust technical support for assessing the replication kinetics of the SC9-1 vaccine in vivo, accurately monitoring early immunization, and MD purification engineering. Attached Figure Description

[0044] Figure 1 This is a design site diagram of primer-probe combinations for simultaneously detecting Marek's virus vaccine strain SC9-1 and wild-type strains, provided by the present invention.

[0045] Figure 2 This is a PCR result diagram of the standard plasmid construction in the dual TaqMan probe fluorescence quantitative PCR method provided by the present invention.

[0046] Figure 3 The figure shows the specificity test results of the FAM channel in the dual TaqMan probe fluorescence quantitative PCR method provided by this invention for detecting the SC9-1 vaccine strain.

[0047] Figure 4 The figure shows the specificity test results of the VIC channel in the dual TaqMan probe fluorescence quantitative PCR method provided by this invention for detecting MDV wild-type strains.

[0048] Figure 5 The amplification curve of the sensitivity test for detecting SC9-1 positive standard in the FAM channel of the dual TaqMan probe fluorescence quantitative PCR method provided by this invention.

[0049] Figure 6 The standard curve fitting diagram for detecting SC9-1 positive standard in the FAM channel of the dual TaqMan probe fluorescence quantitative PCR method provided by this invention.

[0050] Figure 7 The amplification curve of the sensitivity test for detecting MDV wild-type positive standards in the VIC channel of the dual TaqMan probe fluorescence quantitative PCR method provided by this invention.

[0051] Figure 8 The standard curve fitting diagram of the VIC channel for detecting positive standards of MDV wild-type virus strains in the dual TaqMan probe fluorescence quantitative PCR method provided by this invention. Detailed Implementation

[0052] The technical solution of the present invention will be described in detail below with reference to the embodiments and accompanying drawings. It should be understood that the following embodiments are for explanation and illustration only and are not intended to limit the scope of protection of the present invention.

[0053] The biomaterials used in the following examples:

[0054] The MDV vaccine strains CVI988 / Rispens and SC9-1 were donated to Beijing Lingyu Biotechnology Co., Ltd. MDV vaccine strains 814 and HVT, as well as the highly virulent MDV strains Md5 and RB1B, are nucleic acid samples preserved in the inventor's laboratory. The highly virulent strains WTMDV-1 to WTMDV-7 are nucleic acid samples isolated from wild strains in Guangdong, Guangxi, Yunnan, and Fujian provinces of my country. DNA samples of chicken infectious anemia (CIAV) and avian adenovirus (FAdV), as well as cDNA samples of avian Newcastle disease virus (NDV), avian leukosis virus (ALV), avian reticuloendotheliosis virus (REV), avian influenza virus (AIV) H9 subtype, and chicken infectious bursal disease virus (IBDV) are nucleic acid samples preserved in the inventor's laboratory.

[0055] The main reagents used in the following examples include: real-time PCR reagents from Novizan Biotech (Beijing), *E. coli* DH5α competent cells and plasmid vector pCE3; agarose gel DNA purification kit from TransGen Biotech (Beijing); and bacterial plasmid miniprep kit from TransGen Biotech (Beijing). Primers and probes used for PCR were synthesized by Sangon Biotech (Shanghai).

[0056] The main instruments used in the following examples are: CFX Duet quantitative PCR instrument (Bio-Rad); ProFlex PCR instrument (Thermo Fisher Scientific); and DS-11+ Nanodrop micro spectrophotometer (DeNovix).

[0057] Unless otherwise specified, the reagents used in the following examples are all conventional reagents in the art, commercially available or prepared according to conventional methods in the art. Unless otherwise specified, the experimental methods and conditions used in the following examples are all conventional experimental methods and conditions in the art, and can be found in relevant experimental manuals, public literature, or manufacturer's instructions. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0058] Example 1: Establishment of the detection method

[0059] 1. Design of primer-probe combinations

[0060] To address the genetic differences between the SC9-1 vaccine strain and the virulent MDV strain in the wild, specific primer pairs and TaqMan probes were designed using Oligo7 software. Since the SC9-1 vaccine strain was constructed by knocking out the 1020bp full sequence of the Meq gene in the genome of its maternal strain GX0101, this study specifically selected the chimeric region of the Meq gene deletion site in the SC9-1 vaccine strain genome as the detection target. Figure 1 The design, which spans chimeric sites, ensures absolute detection specificity for the SC9-1 strain and can be used to track and monitor the colonization of the SC9-1 vaccine strain in chickens to assess immunization quality.

[0061] Meanwhile, taking advantage of the genetic characteristics of the complete deletion of the Meq gene in the SC9-1 vaccine strain, wild-type universal primers and probes were designed for the conserved region of the type I MDVMeq gene based on sequence alignment analysis (Table 1).

[0062] Table 1 Primers and probes for quantitative real-time PCR

[0063]

[0064] 2. Preparation of recombinant plasmid positive standards

[0065] Using SC9-1 vaccine strain and Md5 superviral strain nucleic acid samples as templates, primers were designed with the Meq gene deletion chimeric region of SC9-1 and the Meq gene sequence of Md5 as target fragments (Table 2) to amplify the target genes and construct recombinant plasmid standards. The amplification results are shown in Table 2. Figure 1 As shown. The PCR product used to construct the SC9-1 target fragment is 334 bp in size. Figure 2 a) The PCR product size used to construct the Md5 target fragment is 1020 bp ( Figure 2 b).

[0066] Table 2 Primers used to construct recombinant plasmid standards

[0067]

[0068] The two PCR products were purified by gel extraction, cloned into the pCE3 vector, and transformed into DH5α competent cells. Positive bacteria were screened and identified by sequencing, and named pCE3-SC9-1 and pCE3-Md5, respectively. Recombinant plasmids were extracted, and their concentrations were determined using a micro-spectrophotometer and converted to copy numbers. The concentration of the pCE3-SC9-1 standard plasmid was 6.4 × 10⁻⁶. 9 copies / uL, after dilution, prepared into 1×10 1 ~1×10 9 Recombinant plasmid positive standards with a concentration of copies / µL. The pCE3-Md5 standard plasmid concentration is 1.42 × 10⁻⁶. 10 The concentration of copies / uL was diluted to prepare a solution of 1.42 × 10⁻⁶. 1 ~1.42×10 9 Recombinant plasmid positive standards with a concentration of copies / μL should be stored at -20℃ for later use. Reference formula: copies / μL = concentration (ng / μL) × Avogadro's constant × 10⁻⁶ -9 / (660 × number of bases).

[0069] 3. Optimization of the reaction system and amplification procedure

[0070] Reaction system: 10 μL of 2×Probe qPCR Mix, working concentration of probe and upstream and downstream primers of 10 μmol / L, 1 μL of DNA template, and ddH2O added to a total volume of 20 μL.

[0071] The reaction system concentrations were optimized for both sets of primers and probes. Based on the optimization principle of minimizing Ct value and maximizing ΔRn value, the optimal reaction system for this dual real-time PCR system was determined as follows: 10 μL 2×Probe qPCR Mix; 0.8 μL each of primers SC9-F, SC9-R, WTMDV-F, and WTMDV-R (working solution concentration 10 μmol / L); 0.4 μL each of probes SC9-P and WTMDV-P (working solution concentration 10 μmol / L); 1 μL template DNA; and ddH2O added to a total volume of 20 μL.

[0072] Amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 60℃ annealing for 30 s, fluorescence signal acquisition, for a total of 40 cycles.

[0073] Example 2: Method Detection and Evaluation

[0074] 1. Specific detection test

[0075] Using optimized reaction conditions, a dual-fluorescence quantitative PCR system was constructed. DNA samples from common avian pathogens, including chicken infectious anemia virus (CIAV) and avian adenovirus (FAdV), as well as cDNA samples from Newcastle disease virus (NDV), avian leukosis virus (ALV), avian reticuloendotheliosis virus (REV), avian influenza virus (AIV), and infectious bursal disease virus (IBDV), and DNA samples from MDV vaccine strains HVT, CVI988 / Rispens, 814, and SC9-1, highly virulent MDV strains Md5 and RB1B, and highly virulent wild strains WTMDV-1 to WTMDV-7, were amplified. Plasmid standards were used as positive controls, and ddH2O as a negative control. The specificity of this detection method was evaluated. Results are as follows: Figure 3 The results showed that the SC9-P probe channel could specifically detect SC9-1 strain nucleic acid samples and pCE3-SC9-1 plasmid DNA samples, but could not detect other MDV strains and other avian pathogen nucleic acids; the WTMDV-P probe channel could not detect SC9-1 strain nucleic acid samples, pCE3-SC9-1 plasmid DNA samples, and other common avian pathogen nucleic acid samples, but could detect pCE3-Md5 plasmid DNA samples, Md5 and RB1B standard super-virulent strain nucleic acid samples, and nucleic acid samples of all MDV wild-type virulent strains WTMDV-1~WTMDV-7. Figure 4 This indicates that the established dual TaqMan probe-based quantitative PCR method has good specificity.

[0076] 2. Sensitivity test and standard curve plotting

[0077] The optimized dual TaqMan probe real-time PCR system was used, with the standard plasmid pCE3-SC9-1 (1×10⁻⁶) serially diluted. 1 ~1×10 9 copies / uL) and pCE3-Md5 (1.42×10) 1 ~1.42×10 9 Using copies / µL as templates, amplification and detection were performed, with three replicates for each concentration to determine the sensitivity of the method established in this study. Standard curves were plotted with the logarithm of the concentrations of pCE3-SC9-1 and pCE3-Md5 plasmid standards on the x-axis and the cycle threshold Ct on the y-axis, respectively. Amplification efficiency was calculated, and the limit of detection was determined.

[0078] Sensitivity analysis of the SC9-1 vaccine strain showed (e.g.) Figure 5 As shown), in 1×10 1 ~1×10 9 Within the range of copies / µL concentration, each dilution gradient (numbered 1-9 in the figure) exhibited typical amplification curves, indicating that the method can achieve a detection limit of 10 for the pCE3-SC9-1 recombinant plasmid. 1 copies / μL. Further construct a standard curve (e.g., copies / μL). Figure 6 As shown in the figure, its linear regression equation is Y = -3.296X + 39.604, R0 2 = 1.000, with an amplification efficiency of 101.1%, showing an excellent linear fit.

[0079] Sensitivity analysis for detecting highly virulent MDV strains in the field showed that ( Figure 7 ), at 1.42×10 1 ~1.42×10 9 Within the concentration range of copies / uL, the amplification signal was stable, and the limit of detection for the pCE3-Md5 recombinant plasmid was 1.42 × 10⁻⁶. 1 copies / uL. Its corresponding standard curve (e.g.) Figure 8 The linear regression equation (as shown) is Y = -3.235X + 39.554, R0 2 = 0.999, amplification efficiency of 103.8%.

[0080] The above results demonstrate that the dual TaqMan probe-based quantitative PCR method established in this study exhibits excellent performance in detecting highly virulent SC9-1 and MDV strains in the field, with good linearity (R0). 2The amplification efficiency is close to the ideal value (100%), proving that the method is reliable, accurate, and fully applicable to the quantitative analysis of clinical samples.

[0081] 3. Stability and repeatability tests

[0082] The selected concentration is 1×10 3 1×10 5 and 1×10 7 pCE3-SC9-1 plasmid with copies / uL and a concentration of 1.42×10⁻⁶ 3 1.42×10 5 and 1.42×10 7 Using pCE3-Md5 plasmid (copies / µL) as a template, an optimized dual TaqMan probe-based quantitative PCR system was employed for amplification. Three replicates were set for each concentration, and the standard deviation and coefficient of variation were calculated to evaluate intra-batch stability. Three parallel experiments were performed, and the standard deviation and coefficient of variation were calculated to evaluate inter-batch stability and repeatability. Intra-batch stability test results showed that the coefficient of variation for Ct values ​​detected in three parallel replicates of each concentration of pCE3-SC9-1 ranged from 0.1596% to 0.4256%; for pCE3-Md5 positive plasmid, it ranged from 0.3645% to 0.5207% (Table 3). The intra-batch detection coefficients of variation for both detection channels were less than 1%, far below the generally acceptable standard of 5%, indicating a high degree of consistency between replicate wells in a single experiment, demonstrating good detection stability of this method. The results of batch-to-batch repeatability tests showed that the coefficients of variation (Ct) for the Ct values ​​of each concentration of the pCE3-SC9-1 positive plasmid in three repeat tests ranged from 0.4702% to 0.7196%; for the pCE3-Md5 positive plasmid, they ranged from 0.2211% to 0.8573% (Table 4). The batch-to-batch Ct values ​​were all less than 1%, indicating that the dual TaqMan probe-based quantitative PCR method provided by this invention is minimally affected by factors such as operation time and reagent batches, and exhibits good reproducibility.

[0083] Table 3. Results of intra-batch stability tests

[0084]

[0085] Table 4. Results of inter-batch repeatability tests

[0086]

[0087] 4. Summary and Evaluation

[0088] The above results show that this method has good specificity, sensitivity, and repeatability. Based on the standard curve detection results, the method for determining the detection results of samples collected from SC9-1 immunized chicken flocks using the dual TaqMan probe real-time PCR method established in this study is as follows:

[0089] If the Ct value of the sample detected by the first pair of primers and probes shown in SEQ ID NO.1-SEQ ID NO.3 is ≤36, and the Ct value of the sample detected by the second pair of primers and probes shown in SEQ ID NO.4-SEQ ID NO.6 is >36, then the SC9-1 vaccine strain in the sample is determined to be positive and the wild-type strain is negative.

[0090] If the Ct value of the sample detected by the first pair of primers and probes shown in SEQ ID NO.1-SEQ ID NO.3 is >36, and the Ct value of the sample detected by the second pair of primers and probes shown in SEQ ID NO.4-SEQ ID NO.6 is ≤36, then the SC9-1 vaccine strain in the sample is determined to be negative and the wild-type strain is positive.

[0091] If the Ct value of the sample detected by the first pair of primers and probes shown in SEQ ID NO.1-SEQ ID NO.3 is ≤36, and the Ct value of the sample detected by the second pair of primers and probes shown in SEQ ID NO.4-SEQ ID NO.6 is ≤36, then it is determined that both the SC9-1 vaccine strain and the wild strain are positive in the sample, and the sample is a mixed infection sample.

[0092] If the Ct value of the sample detected by the first pair of primers and probes shown in SEQ ID NO.1-SEQ ID NO.3 is >36, and the Ct value of the sample detected by the second pair of primers and probes shown in SEQ ID NO.4-SEQ ID NO.6 is >36, then the sample is determined to be negative for both the SC9-1 vaccine strain and the wild-type strain.

[0093] Example 3: Application of Field Sample Detection

[0094] A random sampling survey was conducted on two laying hen flocks vaccinated with the SC9-1 vaccine located in Yulin City, Guangxi Zhuang Autonomous Region. Ten chickens were randomly selected from each flock, and feather marrow samples were collected. After homogenization, nucleic acids were extracted from the collected samples, and the viral load of the SC9-1 vaccine and virulent MDV in the field was quantitatively detected in all samples using the identification and detection method established in this study. The test results were analyzed to assess the quality of immunization, the degree of environmental pollution, and the risk of Marek's disease.

[0095] Feather marrow samples were collected from three laying hen farms in Yulin City, Guangxi Zhuang Autonomous Region, and tested using the method established in this study. Ten samples were randomly selected from each of the three flocks. The results (Table 5) show that the first flock had a 100% (10 / 10) SC9-1 detection rate and a 0% (0 / 10) MDV wild-type virus detection rate, indicating good immune status. The second flock had an 80% (8 / 10) SC9-1 detection rate and a 10% (1 / 10) MDV wild-type virus detection rate. The wild-type virus load in the positive samples was low (807.2 copies / µL), suggesting possible missed immunization and a low risk of MDV disease in the second flock. MDV wild-type virus contamination exists in the environment of this flock, requiring subsequent environmental cleaning and monitoring for early warning. The detection rate of SC9-1 in the third flock of chickens was 100% (10 / 10), but the overall vaccine virus replication level was low, indicating that the flock's immunization quality was low. The detection rate of mixed infection of vaccine virus and wild virus was 20% (2 / 10), and the wild virus positive samples contained high wild virus loads (74636.64 and 23898.01 copies / uL, respectively), indicating that there was MDV wild virus contamination in the chicken farming environment and that the flock had a high risk of disease. Subsequent self-inspection by the farm revealed that the low overall immunization quality of the flock was due to non-standard immunization procedures.

[0096] Table 5 Results of field sample testing

[0097]

Claims

1. A primer-probe combination for simultaneous detection of Marek's virus vaccine strain SC9-1 and wild-type strain, with the following nucleotide sequence (5'-3'): SC9-F: AGTCACAATGCGGATCACGT (SEQ ID NO.1); SC9-R: GGAGTTGGTGCTGGAATGT (SEQ ID NO. 2); SC9-P: CCTGTACCGTGCCCGCCTTC (SEQ ID NO.3); WTMDV-F:GTGACCCTTGGACTGCTTAC (SEQ ID NO.4); WTMDV-R:ATTGTGGAGCGTTAGGTTCATC (SEQ ID NO.5); WTMDV-P: TTCCTGAACCTCCCATTTGCACTCC (SEQ ID NO. 6).

2. The primer-probe combination according to claim 1, characterized in that, The probes SC9-P and WTMDV-P are labeled with a fluorescent reporter group at their 5' ends, and the fluorescent reporter groups of the two probes are different. The probes are also labeled with a fluorescent quencher group at their 3' ends.

3. A reagent kit, characterized in that, The kit contains the primer-probe combination as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes: recombinant plasmid standards, dual real-time PCR premix, nucleic acid extraction reagents, and standard curve establishment tools.

5. A dual TaqMan probe-based quantitative PCR method for simultaneously detecting Marek's disease virus SC9-1 vaccine strain and wild-type strain, comprising the following steps: S1: Extract DNA from the sample to be tested; S2: Using the DNA as a template, a dual real-time PCR amplification reaction is performed in the same reaction system using the primer and probe combination described in claim 1; S3: The results were determined by collecting signals from different fluorescence channels, and the SC9-1 vaccine strain and MDV wild-type strain were quantitatively analyzed using standard curves established with recombinant plasmid standards.

6. The dual TaqMan probe real-time PCR method according to claim 5, characterized in that, The recombinant plasmid standard comprises an SC9-1 specific target fragment plasmid and an MDV wild-type strain Meq gene target fragment plasmid. The SC9-1 specific target fragment plasmid is constructed by amplifying and cloning into a vector using SC9-1 vaccine strain DNA as a template with primers F1-SC9 and R1-SC9. The MDV wild-type strain Meq gene target fragment plasmid is constructed by amplifying and cloning into a vector using Md5 supervirulent strain DNA as a template with primers F1-Md5 and R1-Md5. The primer nucleotide sequence (5'-3') is as follows: F1-SC9: ATAATGCCTTTAACCCTTTCCTTTAT (SEQ ID NO.7); R1-SC9: TATTATTTTGGTTCGGGGAGGTTG (SEQ ID NO.8); F1-Md5:ATGTCTCAGGAGCCAGAGCC (SEQ ID NO.9); R1-Md5:TCAGGGTCTCCCGTCACCT (SEQ ID NO. 10).

7. The dual TaqMan probe real-time PCR method according to claim 5, characterized in that, The dual TaqMan probe-based quantitative PCR reaction system is 20 μL, comprising: 10 μL of 2× Probe qPCR Mix; 0.8 μL each of primers SC9-F, SC9-R, WTMDV-F, and WTMDV-R, each with a final concentration of 10 μmol / L; 0.4 μL each of probes SC9-P and WTMDV-P, each with a final concentration of 10 μmol / L; 1 μL of template DNA; and ddH2O added to a total volume of 20 μL. The dual quantitative PCR reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s; 60℃ annealing for 30 s; fluorescence signal acquisition; for a total of 40 cycles.

8. The dual TaqMan probe real-time PCR method according to claim 6, characterized in that, The result determination method is as follows: if the Ct value of the sample detected by the first pair of primers SC9-F (SEQ ID NO.1), SC9-R (SEQ ID NO.2) and probe SC9-P (SEQ ID NO.3) as described in claim 1 is ≤36, and the Ct value of the sample detected by the second pair of primers WTMDV-F (SEQ ID NO.4), WTMDV-R (SEQ ID NO.5) and probe WTMDV-P (SEQ ID NO.6) is >36, then the SC9-1 vaccine strain in the sample is determined to be positive, and the wild-type strain is determined to be negative. If the Ct value of the sample detected by the first pair of primers SC9-F (SEQ ID NO.1), SC9-R (SEQ ID NO.2) and probe SC9-P (SEQ ID NO.3) as described in claim 1 is >36, and the Ct value of the sample detected by the second pair of primers WTMDV-F (SEQ ID NO.4), WTMDV-R (SEQ ID NO.5) and probe WTMDV-P (SEQ ID NO.6) is ≤36, then the SC9-1 vaccine strain in the sample is determined to be negative, and the wild-type strain is determined to be positive. If the Ct value of the sample detected by the first pair of primers SC9-F (SEQ ID NO.1), SC9-R (SEQ ID NO.2) and probe SC9-P (SEQ ID NO.3) as described in claim 1 is ≤36, and the Ct value of the sample detected by the second pair of primers WTMDV-F (SEQ ID NO.4), WTMDV-R (SEQ ID NO.5) and probe WTMDV-P (SEQ ID NO.6) is ≤36, then it is determined that both the SC9-1 vaccine strain and the wild-type strain are positive in the sample, and the sample is a mixed infection sample; If the Ct value of the sample detected by the first pair of primers SC9-F (SEQ ID NO.1), SC9-R (SEQ ID NO.2) and probe SC9-P (SEQ ID NO.3) as described in claim 1 is >36, and the Ct value of the sample detected by the second pair of primers WTMDV-F (SEQ ID NO.4), WTMDV-R (SEQ ID NO.5) and probe WTMDV-P (SEQ ID NO.6) is >36, then it is determined that both the SC9-1 vaccine strain and the wild-type strain in the sample are negative.

9. The dual TaqMan probe real-time PCR method according to any one of claims 5-8, characterized in that, The samples to be tested were selected from chicken feather marrow, skin, muscle and internal organ tissue samples or farm environment samples.

10. The application of the primer-probe combination of claims 1-2, the kit of claims 3-4, or the dual TaqMan probe fluorescence quantitative PCR method of claims 5-9 in any one of the following (1)-(2): (1) To test whether the sample has been successfully inoculated with the Marek SC9-1 vaccine strain, and to accurately quantify the SC9-1 copy number in a single infected sample of the SC9-1 vaccine strain, so as to clarify the quality of vaccine immunization and prevent the risk of missed immunization and immunization failure. (2) To detect whether the samples after immunization with SC9-1 are infected with the wild virulent Marek's virus, for mixed infection samples, the copy number of SC9-1 vaccine virus and wild virulent virus can be accurately quantitatively detected in a single test to determine whether there is wild virulent virus infection in the flock and to accurately judge the in vivo replication trend of vaccine virus and wild virus in mixed infection samples, and to assess the risk of disease.

Images