A composition, kit and method for detecting and / or aiding in the detection of west nile virus and uses thereof

Abstract

The present application relates to the field of medical preparation, and discloses a composition, a kit, a detection method and application for identifying or assisting in identifying West Nile virus (WNV). The composition for identifying or assisting in identifying WNV comprises an upstream primer of WNV-RPA-F1, a downstream primer of WNV-RPA-R2, sgRNA specific to the virus, AaCas12b protein, 10x AaCas12b reaction buffer and a fluorescent reporter probe; the nucleotide sequence of the WNV-RPA-F1 is SEQ ID No: 7; the nucleotide sequence of the WNV-RPA-R2 is SEQ ID No: 11; the nucleotide sequence of the sgRNA is SEQ ID No: 4; and the fluorescent reporter probe is 5'-FAM-TTTTTTT-BHQ1-3'.

Description

Technical Field

[0001] This invention relates to a composition, kit, detection method, and application for identifying or assisting in the identification of West Nile virus in the field of medical preparations. Background Technology

[0002] West Nile virus (WNV) is a single-stranded positive-sense RNA virus transmitted by mosquitoes, belonging to the Flaviviridae family, and is a zoonotic infectious disease. First discovered in Uganda in 1937, the virus has now spread to multiple continents, becoming a major public health concern internationally. In recent years, the global WNV epidemic has intensified, exhibiting characteristics of endemic transmission and overwintering. Studies have shown that migratory birds may be an important route for virus introduction, and the World Health Organization has listed WNV as a priority pathogen that could cause a public health emergency.

[0003] WNV infection is highly dangerous. Approximately 20% of infected individuals will experience symptoms such as fever, headache, and muscle pain, while some severe cases can develop fatal neuropathic diseases such as encephalitis, meningitis, and acute flaccid paralysis, with a mortality rate as high as 3% to 15%. The elderly and those with weakened immune systems are high-risk groups. Currently, there are no specific antiviral drugs or vaccines for WNV. Therefore, rapid and accurate early diagnosis is crucial for patient management, epidemic monitoring, and prevention and control.

[0004] Currently, laboratory diagnostic methods for WNV mainly include serological testing and viral nucleic acid testing. However, serological methods have inherent limitations: First, due to the extensive antigenic cross-reactivity among members of the Flaviviridae genus, antibody testing is prone to false positives, especially in areas where dengue and Zika viruses are prevalent, making result interpretation difficult; second, antibody production takes time, and it is often undetectable in the early stages of infection, creating a detection window period. Nucleic acid testing (such as RT-PCR and RT-qPCR) can directly detect viral nucleic acid, offering higher sensitivity and specificity. However, these traditional PCR methods rely on sophisticated thermal cyclers and specialized laboratories, resulting in long testing cycles, high costs, and complex operations, making them difficult to promote and apply in resource-constrained grassroots fields or field monitoring points.

[0005] To address these challenges, isothermal amplification (RPA) and CRISPR detection technologies have developed rapidly in recent years. Recombinase polymerase amplification (RPA), as an isothermal amplification technique, can rapidly amplify nucleic acids under isothermal conditions (20-30 minutes), eliminating reliance on thermal cyclers. The CRISPR / Cas system, with its precise nucleic acid recognition and trans-cleavage activity, provides a novel signal readout method for nucleic acid detection. Previous studies have combined RPA with CRISPR / Cas technology for the detection of other pathogens, such as H5 subtype avian influenza virus, validating the feasibility of this approach. However, there are currently no reports of combining RT-RPA with the CRISPR / Cas12b system for a one-step rapid detection of West Nile virus.

[0006] Given the increasingly serious threat of WNV, the limitations of existing serological testing methods, and the dependence of traditional nucleic acid testing on instruments and professionals, there is an urgent need in this field to develop a new WNV detection method that is easy to operate, fast to respond to, provides visible results, is highly sensitive, and is suitable for point-of-care testing (POCT).

[0007] CRISPR detection technology boasts high sensitivity and specificity, enabling rapid and accurate detection of target nucleic acids under isothermal conditions, making it an ideal nucleic acid detection platform. Currently, CRISPR / Cas systems with trans-cleavage activity include Cas13, Cas12a, and Cas12b. In CRISPR detection, the trans-cleavage activity of a specific CRISPR / Cas system is used to detect target nucleic acids. Specifically, in certain CRISPR / Cas systems, the trans-cleavage activity of the Cas protein is activated by the spacer of artificially synthesized crRNA or sgRNA specifically binding to the target sequence. This activates the trans-cleavage activity of the Cas protein, thereby cleaving the fluorescently labeled probe (ssDNA or ssRNA) in the system, generating a fluorescent signal, and thus enabling the detection of the target nucleic acid.

[0008] However, current applications of CRISPR technology in WNV nucleic acid detection are limited, with only a few published articles and patents mentioning it. The main approach is a two-step method using isothermal amplification followed by Cas12a, which reduces detection time to within one hour and offers high specificity. However, in this two-step method, the high concentration of isothermal amplified product still needs to be removed and added to a Cas12a reaction tube for further target fragment identification and cleavage. This process carries a high risk of aerosol contamination, leading to frequent false positives. Furthermore, existing WNV CRISPR detection methods can only detect viral RNA down to 10 copies / μL, indicating a need for further sensitivity improvement. Therefore, there is an urgent need to develop a highly specific and sensitive "one-step + one-tube" rapid detection method for West Nile virus based on RT-RPA-CRISPR / Cas12b to avoid the need for opening the tube during detection, address the high likelihood of false positives, and improve the WNV detection rate. Summary of the Invention

[0009] The main problem this invention aims to solve is how to efficiently identify West Nile virus.

[0010] To address the aforementioned problems, the present invention first provides a composition for identifying or assisting in the identification of West Nile virus.

[0011] The composition provided by this invention for identifying or assisting in the identification of West Nile virus comprises an upstream primer named WNV-RPA-F1, a downstream primer named WNV-RPA-R2, an RT-RPA reaction solution (15% PEG), RT-RPA lyophilized microspheres, sgRNA specific to the virus, AaCas12b protein, 10×AaCas12b reaction buffer, and a fluorescent reporter probe. The WNV-RPA-F1 nucleotide sequence is the DNA of SEQ ID No:7 in the sequence listing; The WNV-RPA-R2 nucleotide sequence is the DNA of SEQ ID No:11 in the sequence listing; The sgRNA is a nucleotide sequence that is the RNA of SEQ ID No:4 in the sequence listing; The fluorescent reporter probe is 5'-FAM-TTTTTTT-BHQ1-3'.

[0012] The present invention also provides a kit for identifying or assisting in the identification of West Nile virus, comprising the composition described above and N; wherein N is RT-RPA reaction solution (15% PEG) and RT-RPA lyophilized microspheres.

[0013] Furthermore, the kit may be an isothermal amplification kit.

[0014] The present invention also provides a method for preparing the composition described above, comprising the steps of separately packaging the WNV-RPA-F1, the WNV-RPA-R2, the sgRNA, the AaCas12b protein, the fluorescent reporter probe and the AaCas12b reaction buffer described above.

[0015] The above preparation method includes the step of separately packaging the WNV-RPA-F1, WNV-RPA-R2, sgRNA, AaCas12b protein, fluorescent reporter probe, sgRNA buffer, and AaCas12b reaction buffer described above.

[0016] The present invention also provides for the use of the composition described above in any of the following: a1) Prepare products for the identification or differentiation of West Nile virus; a2) Identification or differentiation of West Nile virus; a3) Prepare products for detecting whether a sample contains West Nile virus; a4) Detect whether the sample to be tested contains West Nile virus.

[0017] This invention also provides for the application of the aforementioned reagent kit in any of the following: a1) Prepare products for the identification or differentiation of West Nile virus; a2) Identification or differentiation of West Nile virus; a3) Prepare products for detecting whether a sample contains West Nile virus; a4) Detect whether the sample to be tested contains West Nile virus.

[0018] This invention also provides a method for identifying or assisting in the identification of whether a sample to be tested is infected with West Nile virus, comprising the following steps: Nucleic acid was extracted from the sample to be tested. Using the nucleic acid as a template, isothermal amplification was performed using the kit described above to obtain the amplification product. Subsequently, a colorimetric reaction was performed using the sgRNA, AaCas12b protein and fluorescent reporter probe described above. The fluorescence of the colorimetric reaction was used to determine whether the sample to be tested was infected with West Nile virus. The specific determination method is as follows: If the product of the colorimetric reaction shows an increase in fluorescence value in a portable fluorescence reader or a positive reaction under UV light, then the sample to be tested contains at least West Nile virus; if the product of the colorimetric reaction does not show an increase in fluorescence value in a portable fluorescence reader or a negative reaction under UV light, then the sample to be tested does not contain West Nile virus.

[0019] The present invention also provides a method for detecting West Nile virus, comprising using the composition described above to detect whether a sample to be tested contains West Nile virus nucleic acid.

[0020] This invention is the first to combine RT-RPA isothermal amplification technology with CRISPR Cas12b to develop a West Nile virus RT-RPA-CRISPR / Cas12b detection method. This method overcomes the false positive results caused by non-specific amplification or primer dimers in traditional RT-RPA. It utilizes RT-RPA isothermal amplification technology to amplify and enrich the target fragment, ensuring high sensitivity, while simultaneously using CRISPR / Cas12b to specifically recognize and cleave the target fragment, ensuring high specificity and no cross-reactivity with other common flaviviruses. Therefore, the detection method of this invention has high accuracy, with a detection limit as low as 10 copies / reaction (a total reaction volume of 30 μL, i.e., 10 copies / reaction is equivalent to 0.3 copies / μL) of viral RNA.

[0021] The West Nile virus RT-RPA-CRISPR / Cas12b detection method established in this invention has the following advantages compared with traditional PCR and qPCR methods: Firstly, the detection method of this invention does not rely on specialized thermal cycling equipment; the amplification and cleavage of the target gene can be completed using only a conventional constant-temperature water bath. Secondly, the detection results can be presented in real time using a conventional portable fluorescence reader, making the operation simple and time-saving; it only takes 1 hour from RT-RPA amplification to final result reading. Thirdly, the detection method of this invention can avoid false positive results caused by non-specific amplification or primer dimers, and has higher specificity and sensitivity than traditional PCR and qPCR methods.

[0022] The West Nile virus RT-RPA-CRISPR / Cas12b detection method established in this invention has the following advantages compared with existing CRISPR detection methods: Existing CRISPR detection methods are mainly two-step and separate-tube operations, while this invention establishes a one-step + single-tube West Nile virus RT-RPA-CRISPR / Cas12b detection method. From sample amplification to result visualization, the entire reaction process does not require opening the cap, avoiding false positive results caused by aerosol contamination. Secondly, the detection limit of existing West Nile virus CRISPR detection methods is as low as 10 copies / μL of viral RNA, while the West Nile virus RT-RPA-CRISPR / Cas12b detection method established in this invention can detect viral RNA as low as 0.3 copies / μL. Attached Figure Description

[0023] Figure 1The results show the sgRNA screening results. A represents the sgRNA screening fluorescence curve; B represents the sgRNA screening amplification product under UV light.

[0024] Figure 2 The results show the screening results for RT-RPA primers. A is a bar chart showing the fold increase in fluorescence intensity for RT-RPA primer screening; B is an image of the amplified products under UV light for RT-RPA primer screening.

[0025] Figure 3 The results show the optimized primer concentrations for the RT-RPA-CRISPR / Cas12b one-step amplification system. A shows the fluorescence curves for optimized RT-RPA primer concentrations; B shows the amplification products under UV light for optimized RT-RPA primer concentrations.

[0026] Figure 4 The results show the optimization of Cas protein concentration in the one-step RT-RPA-CRISPR / Cas12b amplification system. A) Fluorescence curves for optimized Cas protein concentration; B) Images of UV-amplified products for optimized Cas protein concentration.

[0027] Figure 5 The results show the optimization of sgRNA concentration in the RT-RPA-CRISPR / Cas12b one-step amplification system. A shows the fluorescence curve after sgRNA concentration optimization; B shows the UV light amplification product image after sgRNA concentration optimization.

[0028] Figure 6 This image shows the results of optimizing the fluorescent reporter gene concentration in the RT-RPA-CRISPR / Cas12b one-step amplification system. A) Fluorescence curves showing the optimized fluorescent reporter gene concentration; B) Images of the UV-amplified products showing the optimized fluorescent reporter gene concentration.

[0029] Figure 7 The results show the optimized reaction time for the one-step RT-RPA-CRISPR / Cas12b method.

[0030] Figure 8 The results show the sensitivity test results of the one-step RT-RPA-CRISPR / Cas12b method. A) is a bar chart showing the fold increase in fluorescence intensity at each concentration gradient; B) is an image of the amplified products under UV light at each concentration gradient.

[0031] Figure 9 This is the sensitivity confirmation result for the one-step RT-RPA-CRISPR / Cas12b method. A, 5×10⁻⁶ 1 and 10 1 Bar chart showing the fold increase in fluorescence intensity across 10 replicates at two WNV nucleic acid concentrations; B, 5×10 1 and 10 1Images of amplified products under UV light at two WNV nucleic acid concentrations.

[0032] Figure 10 These are the specificity test results for the one-step RT-RPA-CRISPR / Cas12b method. A) is a bar chart showing the fold increase in fluorescence intensity of each viral nucleic acid; B) is an image of the amplification products of each viral nucleic acid under UV light. Detailed Implementation

[0033] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0035] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0036] The West Nile pseudovirus used in the following examples was purchased from General Biotechnology (Anhui) Co., Ltd., catalog number: TYSW60012281; the RT-RPA isothermal rapid amplification reagent was purchased from Beijing Xunshi Technology Co., Ltd., catalog number: XS-R-101; and the CRISPR / Cas12b reaction reagent was purchased from Beijing Xunshi Technology Co., Ltd., catalog number: XS-R-002-2.

[0037] Example 1: Establishment of a one-step rapid detection method for West Nile virus based on RT-RPA-CRISPR / Cas12b Step 1: sgRNA design Based on the highly conserved region of the West Nile virus genome (SEQ ID No:1), bioinformatics algorithms were used to design sgRNAs according to the PAM position, GC%, internal dimer structure, and specificity of CRISPR / Cas12b. A total of three optimal sgRNAs were designed, and their sequences are shown in Table 1.

[0038] SEQ ID No:1: 5'-AGTAGTTCGCCTGTGTGAGCTGACAAACTTAGTAGTGTTTGTGAGGATTAACAACAATTAACACAGTGCGAGCTGTTTCTTAGCACGAAGATCTCGATGTCTAAGAAACCAGGAGGGCCCGGTAAAAACCGGGCTGTCAATATGCTAAAACGCGGTATGCCCCGCG-3'.

[0039] Table 1. sgRNA sequence information

[0040] Note: The bold black bases in italics above represent the spacer region of sgRNA.

[0041] Step 2: Validation of sgRNA screening performance Step 1) RT-PCR amplification to obtain target fragments for sgRNA screening Before screening for suitable sgRNAs, pseudoviral nucleic acid containing a highly conserved region sequence of West Nile virus (SEQ ID No: 1) was used as a template. RT-PCR primers were designed within 100 bp upstream and downstream of the sgRNA (Table 1 in step 1 above). The primers were used to amplify the target fragment that could be recognized and cleaved by the Cas12b / sgRNA combination (the target fragment covers the spacer gene region of the three sgRNAs in Example 1). The amplified target fragment was used to recognize and cleave the Cas12b / sgRNA-1, Cas12b / sgRNA-2, and Cas12b / sgRNA-3 combinations, respectively, to screen for the optimal sgRNA.

[0042] The RT-PCR amplification primers were PCR-F / PCR-R, where PCR-F was 5'-AGTAGTTCGCCTGTGTGAGC-3' (SEQ ID No: 5); and PCR-R was 5'-CCGCGGGGCATACCG-3' (SEQ ID No: 6). The amplification system consisted of 44 μL of 1.1× Green MIX, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream primer, and 2 μL of WNV pseudovirus nucleic acid (General Biotechnology (Anhui) Co., Ltd., catalog number: TYSW60012281), for a total volume of 50 μL. The RT-PCR amplification program is shown in Table 2.

[0043] Table 2. RT-PCR Amplification Program

[0044] After RT-PCR amplification, the amplified target fragment is used as a template for subsequent sgRNA screening.

[0045] Step 2) sgRNA screening Prepare the CRISPR / Cas12b system according to the system in Table 3.

[0046] Table 3. Preparation of CRISPR / Cas12b system

[0047] Take 1 μL of the target fragment obtained in step 1) above and mix it with 49 μL of the above CRISPR / Cas12b system. Incubate at 45℃ for 30 min in a portable fluorescence reader, collecting FAM fluorescence signals every 2 minutes. Each sgRNA corresponds to 3 replicates of the CRISPR / Cas12b system. Based on the changes in the fluorescence signal curve, verify and screen the sgRNA performance, and simultaneously photograph the gel under UV light using a gel imaging system.

[0048] The results are as follows Figure 1 As shown in Figures A and B: During the reaction, CRISPR / Cas12b systems containing sgRNA-1, sgRNA-2, and sgRNA-3 all exhibited strong fluorescence. The CRISPR / Cas12b system corresponding to sgRNA-3 showed the earliest fluorescence peak, reached its peak value the fastest, and had the highest fluorescence intensity, making it the optimal choice. The negative control showed negative reactions under both a portable fluorescence reader and UV light, with no fluorescence curve and no amplification, confirming the results. Subsequent methods were established using sgRNA-3.

[0049] Step 3: RT-RPA primer design and screening validation Step 1) RT-RPA primer design Using the West Nile pseudovirus particle nucleic acid sequence (SEQ ID No: 1) as a template, RT-RPA primers with a length of 30-35 bases were designed as candidates within the range before and after the sgRNA-3 spacer sequence. To ensure stability and specificity, the GC content of the RT-RPA primers was controlled between 40% and 60%, and the RT-RPA amplified fragment was controlled between 100-150 bp. The primer amplification coverage and specificity were verified using NCBI primer-BLAST. Finally, based on the above principles, this invention designed three upstream and three downstream RT-RPA primers with good specificity and coverage for screening and verification. The primer sequences are shown in Table 4.

[0050] Table 4. RT-RPA Primer Information

[0051] Step 2) RT-RPA primer screening The optimal sgRNA-3 from step 2 above was used for RT-RPA primer screening. The specific screening process, system, and workflow are as follows: Step (a) Nucleic acid template dilution The West Nile pseudovirus particles were diluted to 10 with nuclease-free water. 4 Copy / T and 10 3 Copy / T (copy / T stands for copy / reaction; the total volume of each RT-RPA-CRISPR / Cas12b reaction in this test was 30 µL), at 10 4 Copy / T and 10 3 Nine different combinations of RT-RPA primers (WNV-RPA-F1 / WNV-RPA-R1, WNV-RPA-F1 / WNV-RPA-R2, WNV-RPA-F1 / WNV-RPA-R3, WNV-RPA-F2 / WNV-RPA-R1, WNV-RPA-F2 / WNV-RPA-R2, WNV-RPA-F2 / WNV-RPA-R3, WNV-RPA-F3 / WNV-RPA-R1, WNV-RPA-F3 / WNV-RPA-R2, WNV-RPA-F3 / WNV-RPA-R3) were screened at two different nucleic acid template concentrations (copy / T). Each primer pair had three replicates. The negative control was labeled as NTC. A one-step method plus a single-tube RT-RPA-CRISPR / Cas12b reaction was used.

[0052] Step (b) Configure the RT-RPA system The total volume of the RT-RPA reaction was 61.6 µL: 50 µL of RT-RPA reaction solution (15% PEG), 0.6 µL each of forward and reverse primers (100 µM), and 10.4 µL of ddH2O were mixed, one RT-RPA lyophilized microsphere was added, and the mixture was allowed to stand for 2 min and then vortexed to mix. Step (c) Configure the CRISPR / Cas12b system (total volume 10 µL) Total CRISPR / Cas12b reaction volume (10 µL): 0.75 µL of sgRNA (100 ng / μL) from Table 1, 0.4 µL of AaCas12b (2.5 μM), 1 μL of 10×AaCas12b Buffer, 0.1 μL of CRISPR ssDNA Reporter (12b-FAM), and water to bring the total volume to 10 µL.

[0053] Step (d) Take 19 µL of the RT-RPA system from step (b), 10 µL of the CRISPR / Cas12b system from step (c), and 1 µL of the serially diluted template nucleic acids from step (a), mix well, centrifuge, and react at 45℃ for 60 min. Collect fluorescence signals every minute. Data processing is as follows: The fluorescence intensity fold increase at 60 min is used for data analysis. The formula for calculating the fluorescence intensity fold increase is as follows: Fluorescence intensity fold increase = (Rn - R1) / R1, where Rn represents the fluorescence signal at minute n, and R1 represents the fluorescence signal of the negative control at minute 1. Therefore, the fluorescence intensity fold increase at 60 min corresponding to different RT-RPA primer combinations = (Rn - R1) / R1. 60min -R 阴性1min ) / R 阴性1min .

[0054] Depend on Figure 2 From A and B, we can see that compared to other RT-RPA primer pairs, the WNV-RPA-F1 / WNV-RPA-R2 primer pair performs better at high concentrations (10⁻⁶). 4 (copy / T) and low concentration samples (10) 3 Both exhibited high fluorescence intensity growth under the (copy / T) conditions, therefore WNV-RPA-F1 / WNV-RPA-R2 were selected for subsequent performance verification experiments.

[0055] Step 4: Optimization of the RT-RPA CRISPR / Cas12b reaction system After completing the RT-RPA primer screening, the one-step + one-tube RT-RPA CRISPR / Cas12b reaction system was further optimized. The optimizations included the following: 1) Optimization of RT-RPA primer concentration The upstream and downstream primer concentrations were 400, 500, 600, 700, and 800 nM, for a total of 5 concentration gradients, with 3 replicates for each gradient; the reaction was carried out at 45℃ for 30 min, and fluorescence signals were collected every minute; 2) Optimization of Cas12b protein addition amount The final concentrations of Cas12b protein were 17, 25, 33, and 41 nM, with a total of four concentration gradients, each with three replicates; the reaction was carried out at 45°C for 60 min, and fluorescence signals were collected every 2 minutes for optimization. 3) Optimization of sgRNA-3 addition amount The final concentrations of sgRNA-3 were 2.5, 5, 7.5, and 10 ng / µL, for a total of four concentration gradients, with three replicates for each gradient; the reaction was carried out at 45°C for 60 min, and fluorescence signals were collected every 2 minutes. 4) Optimization of the amount of fluorescent reporter gene ssDNA reporter added The final concentrations of the fluorescent reporter gene were 1 μM, 0.5 μM, 0.25 μM, and 0.125 μM, for a total of four concentration gradients, with three replicates for each gradient; the reaction was carried out at 45℃ for 60 min, and the fluorescence signal was collected every 2 minutes.

[0056] By comparing the reaction performance under different conditions, the optimal parameter combination for the one-step + one-tube RT-RPA CRISPR / Cas12b reaction system was determined.

[0057] The results are as follows: 1) By Figure 3 As shown in A and B, the fluorescence curve grows fastest when the final concentration of the RT-RPA primer is set at 400 nM, and the fluorescence intensity reaches its maximum at 30 minutes. Therefore, the optimal final concentration of the RT-RPA primer for the one-step + single-tube RT-RPA CRISPR / Cas12b reaction system is 400 nM.

[0058] 2) By Figure 4 As shown in A and B, the fluorescence curve grows fastest when the final concentration of Cas12b protein is set at 33 nM, and the fluorescence intensity reaches its maximum at 60 min. Therefore, the optimal final concentration of Cas12b protein for the one-step + one-tube RT-RPA CRISPR / Cas12b reaction system is 33 nM.

[0059] 3) By Figure 5 As shown in A and B, the fluorescence curve grows fastest and reaches its maximum intensity at 60 min when the final sgRNA concentration is set at 2.5 ng / µL. Therefore, the optimal final sgRNA concentration for the one-step + one-tube RT-RPA CRISPR / Cas12b reaction system is 2.5 ng / µL.

[0060] 4) By Figure 6 As shown in A and B, the fluorescence curve grows fastest when the final concentration of the fluorescent reporter gene is set at 1 μM, and the fluorescence intensity reaches its maximum at 60 min. Therefore, the optimal final concentration of the fluorescent reporter gene ssDNA is 1 μM for the one-step + one-tube RT-RPA CRISPR / Cas12b reaction system.

[0061] In summary, the optimized WNV one-step + single-tube RT-RPA CRISPR / Cas12b reaction system and process are as follows: 1) Prepare the RT-RPA reaction system (total volume 61.6 µL): Mix 50 µL RT-RPA reaction solution (15% PEG), 0.4 µL each of forward and reverse primers WNV-RPA-F1 / WNV-RPA-R2 (100 µM) (final concentration of 400 nM for one-step system), and 10.8 µL of nuclease-free water. Add one RT-RPA lyophilized microsphere, let stand for 2 min, and vortex to mix. 2) Prepare the CRISPR / Cas12b system (total volume 10 µL, Table 5).

[0062] Table 5. CRISPR / Cas12b System

[0063] 3) The mixture obtained by mixing and centrifuging 19 µL of the above RT-RPA reaction system, 10 µL of CRISPR / Cas12b system and 1 µL of nucleic acid template of the sample to be tested is the optimized one-step method + one-tube RT-RPA CRISPR / Cas12b reaction system.

[0064] Step 5: Optimization of RT-RPA CRISPR / Cas12b reaction time Based on the optimized reaction system in step 4 above, using 50 copies / T of West Nile pseudovirus RNA as a constant template amount, three reaction replicates were set up to optimize the one-step + one-tube RT-RPA CRISPR / Cas12b reaction time for West Nile virus. The reaction was carried out at 45℃ for 90 min, and fluorescence signals were collected every 10 minutes, i.e., at 10, 20, 30, 40, 50, 60, 70, 80, and 90 minutes. The difference in fluorescence intensity with reaction time was analyzed to screen for the optimal reaction time (p > 0.05 indicates no significant difference (ns), p < 0.05 indicates a significant difference. "*" represents p < 0.05; "**" represents p < 0.01; "***" represents p < 0.001).

[0065] Depend on Figure 7 It can be seen that the fluorescence intensity at 60 min is significantly different from that at 50 min, reaching "***", indicating that the fluorescence intensity changes significantly before 60 min. However, although the fluorescence intensity at 60 min is also enhanced compared to that at 70 min, there is no significant difference, remaining at "ns". Therefore, from the perspective of establishing a rapid detection method, to achieve both reaction efficiency and save detection time, a reaction time of 60 min for RT-RPA CRISPR / Cas12b is optimal.

[0066] Example 2: Sensitivity test of the West Nile virus RT-RPA CRISPR / Cas12b detection method 1. Serial dilutions of West Nile pseudovirus particles were performed using nuclease-free water, with each dilution containing 10... 4 10 3 10 2 10 1 10 0 10 -1 Copy / T (copy / T stands for copy / reaction; the total volume of each RT-RPA-CRISPR / Cas12b reaction in this test was 30 µL) was used to perform the optimized one-step method + one-tube RT-RPA-CRISPR / Cas12b reaction in Example 1 at different West Nile pseudovirus particle template concentrations. The reaction was carried out at 45°C for 60 min, and fluorescence signals were collected every minute to test the sensitivity of the method. Each gradient was repeated three times for verification. Fluorescence data processing was the same as step 3 in Example 1.

[0067] The results are as follows Figure 8 As shown in Figures A and B: When the concentration of West Nile pseudovirus particles is 10... 1 Even at a concentration of 0.3 copies / μL, a high fluorescence intensity increase can still be detected. This indicates that the West Nile virus "one-step + one-tube" RT-RPA-CRISPR / Cas12b detection method developed in this invention achieves a sensitivity of up to 10. 1 Copy / T (i.e., 0.3 copies / μL).

[0068] 2. Based on the sensitivity validation of the West Nile virus target, conduct 10 more experiments near the target detection limit to confirm the target sensitivity. Select West Nile pseudovirus particles as the target. 1 Copy / T, 5×10 1 Sensitivity confirmation studies were conducted using the copy number / T concentration group. Data processing was performed in step 3 of Example 1.

[0069] The results are as follows Figure 9 As shown in Figures A and B: The sensitivity verification results of the one-step RT-RPA-CRISPR / Cas12b detection system for the WNV target show that the target has a detection limit of (10) 1 (copy / T) and near the detection limit (5×10) 1 The assay showed good stability in 10 replicates (copy / T), therefore, the detection limit for the WNV target in this invention is 10. 1 Copy / T, which is 0.3 copies / μL.

[0070] Example 3: Specificity test of the West Nile virus RT-RPA CRISPR / Cas12b detection method Based on the establishment and optimization of the WNV target detection system, the specificity of the RT-RPA CRISPR / Cas12b detection system was tested. WNV targets were used as positive controls (PTCs), and plasmids containing closely related viral gene fragments (Japanese encephalitis virus JEV, Chikungunya virus CHIKV, dengue virus type I DENV-1, dengue virus type II DENV-2, dengue virus type III DENV-3, dengue virus type IV DENV-4, yellow fever virus YFV, and Zika virus) were used as cross-validation samples. The negative control template was nuclease-free water (NTC), with each sample in triplicate.

[0071] The recombinant plasmids containing gene fragments of Japanese encephalitis virus (JEV), chikungunya virus (CHIKV), dengue virus type I (DENV-1), dengue virus type II (DENV-2), dengue virus type III (DENV-3), dengue virus type IV (DENV-4), yellow fever virus (YFV), and Zika virus (Zika) are pUC-JEV, pUC-CHIKV, pUC-DENV-1, pUC-DENV-2, pUC-DENV-3, pUC-DENV-4, pUC-YFV, and pUC-Zika, respectively.

[0072] The structure of the recombinant plasmid pUC-JEV is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:13 at the SmaI restriction site of the cloning vector pUC57 (Sangon Biotech (Shanghai) Co., Ltd., catalog number B522201) while keeping other sequences of the cloning vector pUC57 unchanged.

[0073] The recombinant plasmids pUC-CHIKV, pUC-DENV-1, pUC-DENV-2, pUC-DENV-3, pUC-DENV-4, pUC-YFV, and pUC-Zika differ from the recombinant plasmid pUC-JEV only in that the DNA fragment of SEQ ID No:1 in the recombinant plasmid pUC-JEV is replaced with SEQ ID No:14-SEQ ID No:20.

[0074] The fluorescence data processing is the same as step 3 in Example 1.

[0075] The results are as follows Figure 10As shown in sections A and B, only the reaction system corresponding to the WNV target (PTC) showed a high fold increase in fluorescence intensity. No significant increase in fluorescence intensity was detected in the negative control (NTC), JEV, CHIKV, DENV-1, DENV-2, DENV-3, DENV-4, YFV, and Zika. Therefore, the WNV "one-step + one-tube" RT-RPA CRISPR / Cas12b detection method established in this invention exhibits good specificity.

[0076] Table 6. Information on biological samples used for specificity testing

[0077] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A composition for identifying or assisting in the identification of West Nile virus, comprising an upstream primer named WNV-RPA-F1, a downstream primer named WNV-RPA-R2, sgRNA specific to the virus, AaCas12b protein, 10×AaCas12b reaction buffer, and a fluorescent reporter probe; The WNV-RPA-F1 is a DNA nucleotide sequence that is SEQ ID No:7; The WNV-RPA-R2 is a DNA nucleotide sequence that is SEQ ID No:11; The sgRNA is an RNA whose nucleotide sequence is SEQ ID No:4; The fluorescent reporter probe is 5'-FAM-TTTTTTT-BHQ1-3'.

2. A kit for identifying or assisting in the identification of West Nile virus, comprising the composition of claim 1 and N; wherein N is an RT-RPA reaction solution containing 15% PEG and RT-RPA lyophilized microspheres.

3. The reagent kit according to claim 2, characterized in that: The kit is an isothermal amplification kit.

4. A method for preparing the composition of claim 1, comprising the steps of separately packaging the WNV-RPA-F1, the WNV-RPA-R2, the sgRNA, the AaCas12b protein, the fluorescent reporter probe and the AaCas12b reaction buffer as described in claim 1.

5. The method for preparing the kit according to claim 2, comprising the steps of separately packaging the WNV-RPA-F1, the WNV-RPA-R2, the sgRNA, the AaCas12b protein, the fluorescent reporter probe and the AaCas12b reaction buffer according to claim 1.

6. The use of the composition of claim 1 for any of the following non-disease diagnostic and therapeutic purposes: a1) Prepare products for the identification or differentiation of West Nile virus; a2) Identification or differentiation of West Nile virus; a3) Prepare products for detecting whether a sample contains West Nile virus; a4) Detect whether the sample to be tested contains West Nile virus.

7. The use of the kit according to claim 2 or 3 for any of the following non-disease diagnostic and therapeutic purposes: a1) Prepare products for the identification or differentiation of West Nile virus; a2) Identification or differentiation of West Nile virus; a3) Prepare products for detecting whether a sample contains West Nile virus; a4) Detect whether the sample to be tested contains West Nile virus.

8. A method for identifying or assisting in the identification of whether a sample to be tested is infected with West Nile virus for non-disease diagnostic and therapeutic purposes, comprising the following steps: Nucleic acid is extracted from the sample to be tested. Using the nucleic acid as a template, isothermal amplification is performed using the kit described in claim 2 or 3 to obtain the amplification product. Subsequently, a colorimetric reaction is performed using the sgRNA, AaCas12b protein and fluorescent reporter probe described in claim 1. The fluorescence of the colorimetric reaction is used to determine whether the sample to be tested is infected with West Nile virus. The specific determination method is as follows: If the product of the colorimetric reaction shows an increase in fluorescence value in a portable fluorescence reader or a positive reaction under UV light, then the sample to be tested contains at least West Nile virus; if the product of the colorimetric reaction does not show an increase in fluorescence value in a portable fluorescence reader or a negative reaction under UV light, then the sample to be tested does not contain West Nile virus.

9. A method for detecting West Nile virus for non-disease diagnosis and treatment purposes, comprising using the composition of claim 1 to detect whether a test sample contains West Nile virus nucleic acid.

Images