Downy mildew resistance in spinach

Abstract

This invention relates to an allele named α-WOLF 30, which confers immunity to at least one type of downy mildew (…). Downy mildew spilled Resistance to at least the physiological races of *Peronospora*, wherein the protein encoded by the allele is a CC-NBS-LRR protein, which contains in its amino acid sequence: a) the motif “MAEIGYSVC” at its N-terminus; and b) the motif “KWMCLR”; and wherein the protein has an amino acid sequence having at least 89% sequence similarity to SEQ ID NO:11 or SEQ ID NO:15 in ascending order of priority. When present homozygous in spinach plants, the allele confers complete resistance to at least the perennial downy mildew physiological races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19, and Pe:20.

Description

[0001] This invention relates to a treatment for downy mildew (spreading downy mildew). Peronospora effusa The invention relates to resistance alleles and plants containing said alleles. The invention further relates to the offspring, seeds, and plant parts, such as leaves, of said resistant plants; and to propagation material suitable for producing said plants. The invention also relates to methods for identifying said alleles and resistant plants, and methods for selecting and producing said resistant plants.

[0002] Downy mildew (spreading downy mildew) is a major threat to spinach growers because it directly affects the harvested leaves. In spinach, downy mildew is caused by the oomycete spreading downy mildew (formerly known as powdery mildew spinach-specific type). Peronospora farinosa f. sp. spinaciae This infection is caused by [a specific pathogen, likely a fungal infection]. The infection renders the leaves unsuitable for sale and consumption, phenotypically manifesting as yellow lesions on older leaves and the observation of light gray fungal growth on the surface of the dorsal leaf. The infection can spread very rapidly and can occur in both greenhouse and soil cultivation. The optimal temperature for the formation and germination of *Peronospora spores* is 9–12°C, driven by high relative humidity. When spores are deposited on moist leaf surfaces, they readily germinate and infect the leaves. Fungal growth is optimal at 8–20°C and ≥80% relative humidity, and mycelial growth can be observed within 6–13 days after infection. *Peronospora spores* can survive in soil for up to 3 years or as mycelium in seeds or living plants.

[0003] To date, 20 pathogenic physiological races of spinach downy mildew (Pe, formerly known as Pfs) have been formally identified and characterized, and many new candidates have been observed in the field.The 20 officially recognized physiological races of *Spinach downy mildew* have been named Pe:1 to Pe:20 (Pe:1 to Pe:17 were formerly known as Pfs:1 to Pfs17; Irish et al., Phtypathol. Vol. 98 pg. 894-900, 2008; Plantum NL (Dutch association for breeding, tissue culture, production and trade of seed and young plants) press release, “Benoeming van Pfs: 14, een nieuwefysio van valse meeldauw in spinazie”, September 19, 2012; reported by Jim Correl (Univ. Arkansas) and Steven Koike (UC Cooperative Extension, Monterey County), “Race Pfs: 14 - Another new race of the spinach downy mildew pathogen”, September 18, 2012; Plantum NL press release, “Denomination of Pfs: 15, a new race of downy mildew in spinach”, September 2, 2014; Plantum NL press release, “Denomination of Pfs: 16, a new race of downy mildew in spinach”, March 15, 2016; Plantum NL press release, “Denomination of Pfs: 17, a new race of downy mildew in spinach”, April 16, 2018; Plantum NL press release, “Denomination of Pe: 18 and 19, two new races of downy mildew in spinach”, April 15, 2021; Plantum NL press release, “Denomination of Pe: 20, a new race of downy mildew in spinach”, May 13, 2024).

[0004] Officially recognized Pe physiological races are available from Naktuinbouw, Sotaweg 22, 2371 GDRoelofarendsveen, the Netherlands, or from the public via Professor Jim Correll (University of Arkansas, https: / / cppsi.ucdavis.edu / sites / g / files / dgvnsk8206 / files / inline-files / Spinach_downy_mildew_Differentials_ver%20June%202021.pdf).

[0005] In particular, recently identified downy mildew races can break resistance in many commercially used spinach varieties worldwide, posing a serious threat to the productivity of the spinach industry. Therefore, it is crucial to stay at the forefront of development in this field, as downy mildew continuously evolves the ability to disrupt resistance in commercial spinach varieties. For this reason, novel resistance genes against downy mildew are invaluable assets and constitute a significant research focus in breeding, particularly in spinach and lettuce breeding. One of the primary goals of spinach breeders is to rapidly develop spinach varieties resistant to as many downy mildew races as possible, including those recently identified, before these races become widespread and threaten the industry.

[0006] In commercial spinach varieties, resistance to downy mildew is typically mediated by so-called R-genes. R-gene-mediated resistance is based on the plant's ability to recognize invasive pathogens. In many cases, this recognition occurs after the pathogen has established a first-stage interaction and transferred so-called pathogenic (or non-virulent) factors into the plant cells. These pathogenic factors interact with host components to establish conditions favorable for pathogen invasion of the host and subsequent disease. A resistance response can be initiated when the plant is able to recognize events triggered by these pathogenic factors. In many different plant pathogen interaction systems (e.g., the interaction between spinach and different downy mildew strains), these events are initiated only after the plant has specifically recognized the invasive pathogen.

[0007] The co-evolution of plants and pathogens has led to an arms race in which resistance mediated by R-genes is sometimes overcome by the ability of pathogens to interact with and modify alternative host targets or the same targets (in different ways), thereby causing loss of recognition and successful establishment of infection, leading to disease. To rebuild resistance in plants, new R-genes must be introduced that can recognize the mode of action of alternative pathogenic factors.

[0008] Despite their relatively low persistence, R-genes remain the primary form of defense against downy mildew in spinach. This is mainly because they are the only form of defense that imparts absolute resistance. To date, plant breeders have been very successful in generating downy mildew-resistant spinach varieties by utilizing resistance genes present in the wild germplasm of crop species. Although R-genes are widely used in spinach breeding, little was known about them until recently.

[0009] The officially recognized R-gene in spinach is actually two closely linked genes. α- and β-WOLF All the different alleles of the gene (WO2018 / 060474; Kock et al.). This is also the first time that R-genes, or better yet, R-alleles, have been characterized at the molecular level, i.e., their nucleotide and amino acid sequences have been determined. While this provides breeders with a tool to improve the efficiency of detecting and selecting R-alleles, adequately addressing emerging downy mildew physiological races remains crucial for developing commercially successful spinach varieties.

[0010] Therefore, the objective of this invention is to provide a novel resistance allele for the α-WOLF gene and to provide molecular biological tools for identifying this novel resistance allele. The variation observed between the identified alleles of the α- and β-WOLF genes is extensive and not straightforward. Therefore, it is impossible to predict in advance the resistance pattern conferred by the WOLF- allele.

[0011] In the research that led to this invention, a novel allelic variant of the α-WOLF gene described in WO2018059651 was discovered. α The -WOLF gene encodes a protein belonging to the CC-NBS-LRR (coil-and-loop – nucleotide binding site – leucine-rich repeat sequence) family.

[0012] In the context of this invention, the terms "allele" or "allele variant" are used to specify a version of a gene linked to a particular phenotype (i.e., a resistance trait profile). It has been found that spinach plants may carry one or two alleles. WOLF Genes. These two. WOLFEach gene contains multiple alleles, and each allele imparts a specific spectrum of resistance traits.

[0013] β WOLF The gene is located on scaffold 12735 (sequence: GenBank: KQ143339.1), at positions 213573-221884. In spinach plants that also carry or only carry the α-WOLF gene, the α-WOLF gene is located at approximately the same position as the β-WOLF gene on scaffold 12735 in the Viroflay genome assembly.

[0014] The genome assembly of the spinach variety Viroflay (which is susceptible to all known pathogenic physiological races of spreading downy mildew) is publicly available (spinach). Spinacia oleracea The cultivated cultivar SynViroflay was sequenced using a shotgun genome sequencing project; Bioproject: PRJNA41497; GenBank: AYZV00000000.2; BioSample: SAMN02182572. See also Dohm et al., 2014. Nature 505: 546-549). In the genome assembly of Viroflay, β- WOLF The gene is located on scaffold 12735 (sequence: GenBank: KQ143339.1), at positions 213573-221884. This region covers sequences containing the β-elements of Viroflay. WOLF The entire genome sequence of the gene, plus the sequence of 2000 base pairs upstream of the gene, plus the sequence downstream of the gene, up to the position described. WOLF The locus of an adjacent gene downstream of the gene. The spinach variety Viroflay has only a single locus. WOLF Gene, namely β- WOLF The gene, but most other spinach varieties possess a single α-type gene at the same location in the genome. WOLF Other spinach varieties possess two genes at roughly the same location in their genome. WOLF Genes. In such cases, the two... WOLF Genes are adjacent to each other. Most have two. WOLF In the genetically modified spinach strains, the aforementioned WOLF One of the genes belongs to the α-type, and the other... WOLF The gene belongs to the β-type. It was observed that... WOLF This allele variation at the locus is the cause of the differences in resistance to the pathogenic physiological races of spreading downy mildew.

[0015] In α- WOLFAlleles of genes and β- WOLF The differences between gene alleles lie in the presence of specific conserved amino acid motifs in the encoded protein sequences. As mentioned above, all WOLF proteins possess the following well-known domains from the N-terminus to the C-terminus: a coil-and-coil domain (RX-CC-like, cd14798), an NBS domain (also known as the "NB-ARC domain," pfam00931; van der Biezen & Jones, 1998), Curr. Biol .8: R226-R228), and a leucine-rich repeat sequence including an LRR domain (IPR032675). Additionally, all WOLF proteins contain the N-terminal motif “MAEIGYSVC” (SEQ ID NO: 1) in their amino acid sequence. Furthermore, all α-WOLF proteins contain the motif “KWMCLR” (SEQ ID NO: 2) in their amino acid sequence, while all β-WOLF proteins contain the motif “HVGCVVDR” (SEQ ID NO: 3) in their amino acid sequence.

[0016] This invention provides a novel allele of the α-WOLF gene that confers resistance to downy mildew, referred herein as the "allele of this invention" or the α-WOLF 30 allele, which encodes a protein that confers resistance to spreading downy mildew when expressed in spinach plants.

[0017] In the research leading to this invention, two different splicing variants of the alleles of this invention were observed. Splice variant 1 encodes a nucleotide sequence according to SEQ ID NO: 10. Splice variant 2 encodes a nucleotide sequence according to SEQ ID NO: 14. The protein encoded by SEQ ID NO: 10 encodes an amino acid sequence having the sequence according to SEQ ID NO: 11. The protein encoded by SEQ ID NO: 14 encodes an amino acid sequence having the sequence according to SEQ ID NO: 15. The LRR domain of both splice variants encodes a sequence according to SEQ ID NO: 12, which encodes an amino acid containing SEQ ID NO: 13.

[0018] The α-WOLF 30 allele encodes the CC-NBS-LRR protein, which, when expressed homozygous in spinach plants, confers resistance to downy mildew physiological races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19, and Pe:20, and wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence; and wherein the allele comprises:

[0019] a) A nucleotide sequence containing a coding sequence having at least 89.5%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence identity with SEQ ID NO: 10 or SEQ ID NO: 14 in ascending order of priority.

[0020] b) A nucleotide sequence encoding a protein having an amino acid sequence having at least 89%, 89.5%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity to SEQ ID NO: 11 or SEQ ID NO: 15 in an increasing order of preference.

[0021] c) A nucleotide sequence encoding an LRR domain, wherein the nucleotide sequence has at least 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence identity with SEQ ID NO: 12 in ascending order of priority, or

[0022] d) A nucleotide sequence encoding an LRR domain having an amino acid sequence having at least 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, and 100% sequence similarity to SEQ ID NO: 13 in an increasing order of priority.

[0023] Optionally, the α-WOLF 30 allele further includes an additional motif in its amino acid sequence, namely “DQEDEGEDN” (SEQ ID NO: 4).

[0024] The alleles of this invention are nucleic acids, specifically nucleic acid molecules, and more specifically isolated nucleic acid molecules.

[0025] The allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains a coding sequence having at least 89.5%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, and 100% sequence identity with SEQ ID NO: 10 or SEQ ID NO: 14 in ascending order of priority.

[0026] Preferably, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains a coding sequence that has at least 89.5% sequence identity with SEQ ID NO: 10 or SEQ ID NO: 14 in ascending order of priority.

[0027] In a preferred embodiment, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains the coding sequence according to SEQ ID NO: 10 or SEQ ID NO: 14.

[0028] The allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains a nucleotide sequence encoding the protein, the protein having an amino acid sequence having at least 89%, 89.5%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, and 100% sequence similarity to SEQ ID NO: 11 or SEQ ID NO: 15 in an increasing order of preference.

[0029] Preferably, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains a nucleotide sequence encoding a protein having an amino acid sequence having at least 89% sequence similarity to SEQ ID NO: 11 or SEQ ID NO: 15 in an increasing order of priority.

[0030] In a preferred embodiment, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains a nucleotide sequence encoding the protein having the amino acid sequence according to SEQ ID NO: 11 or SEQ ID NO: 15.

[0031] The allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains a nucleotide sequence encoding an LRR domain, the nucleotide sequence having at least 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, and 100% sequence identity with SEQ ID NO: 12 in ascending order of priority.

[0032] Preferably, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains a nucleotide sequence encoding an LRR domain, the nucleotide sequence having at least 94.5% sequence identity with SEQ ID NO: 12 in ascending order of priority.

[0033] In a preferred embodiment, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains a nucleotide sequence encoding an LRR domain, the nucleotide sequence having the nucleotide sequence according to SEQ ID NO:12.

[0034] The allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains a nucleotide sequence encoding an LRR domain having an amino acid sequence having at least 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, and 100% sequence similarity in an increasing order of priority to SEQ ID NO: 13.

[0035] Preferably, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains a nucleotide sequence encoding an LRR domain having an amino acid sequence having at least 93.5% sequence similarity to SEQ ID NO:13 in an increasing order of priority.

[0036] In a preferred embodiment, the allele of the present invention encodes a CC-NBS-LRR protein, wherein the protein contains the motifs “MAEIGYSVC” and “KWMCLR” at its N-terminus in its amino acid sequence, and wherein the allele contains a nucleotide sequence encoding an LRR domain having an amino acid sequence according to SEQ ID NO:13.

[0037] When present homozygous in spinach plants, the α-WOLF 30 allele confers complete resistance to at least the spreading downy mildew physiological races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19 and Pe:20.

[0038] When present in a heterozygous manner in spinach plants, the α-WOLF 30 allele confers complete resistance to at least the spreading downy mildew physiological races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17, Pe:19, and Pe:20.

[0039] This invention further relates to a protein encoded by the allele of this invention. This protein is also referred to herein as "the protein of this invention" and confers resistance to downy mildew in spinach plants, particularly to at least the spreading downy mildew physiological races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19, and Pe:20, when α-WOLF 30 encoding the protein of this invention is present homozygous in the genome of said spinach plants.

[0040] As used herein, sequence identity is the percentage of identical nucleotides or amino acids between two sequences after proper alignment. Those skilled in the art know how to align sequences, for example, using sequence alignment tools such as BLAST®, which can be used for both nucleotide and protein sequences. To obtain the most significant results, the best possible alignment that gives the highest sequence identity score should be obtained. The percentage of sequence identity is calculated by comparing the lengths of the shortest sequences in the evaluation. In the present context, the nucleotide sequence represents a gene that contains at least a start codon and a stop codon, or an amino acid sequence encoding a complete protein encoded by such a gene.

[0041] Sequence similarity for amino acid sequences was calculated using EMBOSS stretcher 6.6.0 (www.ebi.ac.uk / Tools / psa / emboss_stretcher), with an EBLOSUM62 matrix configured as follows: gap opening penalty: 12, and gap extension penalty: 2. For DNA, sequence similarity was calculated using a full DNA matrix configured as follows: gap opening penalty: 16, and gap extension penalty: 4.

[0042] This invention further relates to plants, preferably spinach ( Spinacia oleracea The plant of the species L., wherein the plant contains the allele of the present invention in its genome. A plant containing the allele of the present invention in its genome is referred to herein as "the plant of the present invention". In the context of the present invention, the plant of the species spinach is the spinach plant.

[0043] In a further embodiment, the plant of the present invention is an agronomically superior plant, preferably an agronomically superior spinach plant.

[0044] In the context of this invention, agronomically superior plants are plants with genotypes that, through human intervention, contain the accumulation of distinguishable and desired agronomic traits that allow producers to harvest commercially significant products. Preferably, the agronomically superior plants of this invention are inbred lines or hybrids.

[0045] As used herein, an inbred line is a plant in a plant population that is the result of three or more rounds of self-pollination or backcrossing; or the plant is a double haploid. An inbred line can be, for example, a parent line used to produce commercial hybrids.

[0046] As used herein, a hybrid plant is the result of a cross between two different plants with different genotypes. More specifically, a hybrid plant is the result of a cross between two different inbred lines of plants. Such a hybrid plant can be, for example, an F1 hybrid variety.

[0047] Spinach seeds containing the α-WOLF 30 allele are deposited in NCIMB with accession number NCIMB 44301.

[0048] Therefore, the present invention relates to plants grown from seeds deposited under NCIMB registration number NCIMB 44301.

[0049] Resistance of spinach plants to one or more physiological races of *Persianthus spp.* can be determined using a seedling test. In this paper, a seedling test is defined as a test in which spinach seeds are planted in trays containing growing medium and fertilized twice weekly after emergence. Plants are inoculated with a sporangium suspension at the first true leaf stage, the suspension having a concentration of approximately 2.5 × 10⁻⁶. 5 / ml of one of the pathogenic physiological races or isolates of *Persicaria* to be tested. Thirty plants / physiological races were tested. Inoculated plants were placed in a dew chamber at 18°C ​​and 100% relative humidity for 24 hours; then transferred to a growth chamber at 18°C ​​and a 12-hour photoperiod for 6 days. After 6 days, the plants were returned to the dew chamber for 24 hours to induce sporulation, and then disease response was scored.

[0050] As used herein, when the plant does not show symptoms in the seedling tests described herein, the plant is completely resistant to the spreading downy mildew physiological race.

[0051] As used in this article, plants exhibit moderate resistance to spreading downy mildew physiological races when they show only symptoms of chlorosis or when spore formation occurs only at the cotyledon apex.

[0052] As used herein, plants are susceptible to isolates of the spreading downy mildew physiological race when they exhibit symptoms of more than just chlorosis or when spore formation occurs in areas greater than just the cotyledon apex in the seedling tests described herein.

[0053] Plants carrying the α-WOLF 30 allele in a heterozygous form can further include the β-WOLF 0 allele on their complementary chromosome (as seen in, for example, the cultivar Viroflay), where the β-WOLF 0 allele does not confer any resistance to downy mildew. However, plants heterozygous for the α-WOLF 30 allele can further include either α- or β-... WOLF The alleles of the gene do indeed provide resistance to downy mildew. Preferably, such alleles will complement the α-WOLF 30 allele, thereby giving the spinach plant at least moderate resistance to one or more other physiological races to which the α-WOLF 30 allele does not provide resistance. Most preferably, α- or β- WOLF Other alleles of the gene supplement the α-WOLF 30 allele, thereby making the plant resistant to spreading downy mildew physiological races Pe:1 to Pe:19. In one embodiment, such plants are agronomically superior.

[0054] Alternatively, the resistance trait profile of plants carrying the α-WOLF 29 allele can be supplemented by resistance-conferring alleles from entirely different genes. Examples of such genes are, for instance, those described in US8,354,570. DMR1 As described in US9,121,029 DMR6 p10 as described in US10,226,016 and the genomic fragment on chromosome 4 as described in WO2020 / 239215.

[0055] Therefore, this invention relates to spinach plants carrying the α-WOLF 30 allele and further comprising another genetic determinant, which together result in resistance to the physiological races Pe:1 to Pe:19 of spreading downy mildew. The genetic determinant can be another resistance-conferring α / β-WOLF allele or a resistance-conferring allele from a completely different gene.

[0056] Another aspect of the invention relates to seeds capable of growing into plants of the invention, wherein said plants contain alleles of the invention. The invention also relates to the use of said seeds for producing plants of the invention by growing said seeds into plants.

[0057] The present invention also relates to a method for cultivating spinach plants having alleles of the present invention, the method comprising the step of germinating seeds having at least one copy of the alleles of the present invention in their genome.

[0058] The present invention further relates to a method for cultivating spinach plants exhibiting resistance to at least the physiological races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19 and Pe:20 of dispersive downy mildew, the method comprising the step of sowing seeds containing alleles of the present invention in a homozygous manner, a representative sample of which is deposited in NCIMB with accession number NCIMB 44301.

[0059] The present invention further relates to a method for cultivating spinach plants exhibiting resistance to at least the physiological races of dispersing downy mildew Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17, Pe:19 and Pe:20, said method comprising the step of sowing seeds containing alleles of the present invention in a heterozygous manner.

[0060] In one particular implementation, the seeds used for growth are those deposited in NCIMB with accession number NCIMB 44301.

[0061] Another aspect of the invention relates to leaves harvested from the spinach plant of the invention, in natural or processed form.

[0062] Spinach leaves are sold in packaged form, including but not limited to pre-packaged spinach leaves, or processed into salads containing said leaves. For example, such packaging is mentioned in U.S. Patent No. 5,523,136, which provides packaging films and packaging materials made from such packaging films, including such packaging containing leafy products, and methods for preparing and using such packaging films and packaging materials, suitable for use with the spinach leaves of the present invention. Therefore, the present invention includes the use of the leaves of the spinach plant of the present invention and the leaves derived from the spinach plant of the present invention, as well as methods for preparing and using said leaves.

[0063] The invention further relates to a container containing one or more of the plants of the present invention, or one or more spinach plants derived from the plants of the present invention, in a growth substrate for harvesting leaves from said plant in a home environment. Thus, when the plant is ready for harvest, consumers can select very fresh leaves for use in salads.

[0064] The present invention also relates to propagation material suitable for producing plants of the present invention, wherein the propagation material is suitable for sexual reproduction and is particularly selected from microspores, pollen, ovary, ovule, embryo sac and egg cell, or suitable for vegetative reproduction and is particularly selected from cuttings, roots, stems, cells and protoplasts, or suitable for tissue culture of regenerable cells or protoplasts and is particularly selected from leaves, pollen, embryo, cotyledon, hypocotyl, meristem, root, root tip, anther, flower, seed and stem, wherein the propagation material contains alleles of the present invention.

[0065] This invention further relates to the cells of the plant of this invention. Such cells can be in isolated form, or are part of a whole plant or a portion thereof, and still form the cells of this invention because such cells contain the alleles of this invention. The cells of this invention can also be regenerative cells capable of generating new plants of this invention.

[0066] This invention further relates to plant tissues of the plant of this invention, which contain the alleles of this invention. The tissues can be undifferentiated or differentiated. Undifferentiated tissues are, for example, shoot tips, anthers, petals, or pollen, and can be used in micropropagation to obtain new plantlets that grow into new plants of this invention. The tissues can also grow from cells of this invention.

[0067] The present invention further relates to a method for producing plants containing alleles of the present invention by means of tissue culture or by means of vegetative propagation, said plants being resistant to spreading downy mildew.

[0068] The offspring of the plant, cell, tissue, or seed of the present invention (which contain the α-WOLF 30 allele) are also part of the present invention. Such offspring can themselves be plants, cells, tissues, or seeds. Specifically, the offspring can be offspring of the plant of the present invention (whose representative seed is deposited under NCIMB number 44301). As used herein, offspring include first and all further progeny from hybridization with the plant of the present invention, wherein hybridization includes hybridization with itself or with another plant, and wherein the progeny identified as offspring contains the alleles of the present invention. Progeny can be obtained through self-pollination and / or further hybridization of the deposit. Offspring also include material obtained through vegetative propagation or another form of proliferation.

[0069] This invention further relates to germplasm of the plants of this invention. The germplasm comprises all the genetic characteristics of the organism and, according to the invention, includes at least the resistance trait of this invention. The germplasm can be used in breeding programs to develop plants exhibiting resistance to spreading downy mildew. The use of germplasm containing alleles of this invention in breeding is also part of this invention. Seeds capable of growing into plants containing alleles of this invention and representing said germplasm are deposited in NCIMB with accession number NCIMB 44301.

[0070] The present invention also relates to the use of the α-WOLF 30 allele for producing spinach plants resistant to spreading downy mildew.

[0071] The present invention also relates to the use of the plant of the present invention as a crop, as a seed source or as a source of propagation material.

[0072] The present invention also relates to the use of the plants of the present invention in breeding to confer resistance to spreading downy mildew.

[0073] The present invention further relates to a method for seed production, the method comprising growing a spinach plant from seeds of the present invention that homozygously contain alleles of the present invention, allowing the plant to produce seeds, and harvesting the seeds. Seed production is suitably carried out by self-pollination or by hybridization with another plant, optionally also a plant of the present invention. Plants grown from seeds produced as described herein are resistant to at least the spreading downy mildew races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19, and Pe:20 when the alleles of the present invention are present in a homozygous manner; or are resistant to at least the spreading downy mildew races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17, Pe:19, and Pe:20 when the alleles of the present invention are present in a heterozygous manner.

[0074] The present invention also relates to a method for producing hybrid spinach seeds, the method comprising crossing a first parent plant with a second parent plant and harvesting the resulting hybrid spinach seeds, wherein the first parent plant and / or the second parent plant are plants of the present invention. Preferably, at least one of the parent plants contains, in a homozygous manner, an allele of the present invention.

[0075] In one particular embodiment, the first and / or second parental plants are inbred lines as defined herein.

[0076] The present invention also relates to hybrid seeds produced by the methods described herein and hybrid plants grown from said hybrid seeds, wherein said hybrid seeds and plants contain alleles of the present invention.

[0077] Transgenic techniques used for transferring nucleotide sequences between sex-incompatible plants can also be used to produce plants of the invention by transferring the alleles of the invention from one species to another. Suitable techniques include conventional plant transformation techniques known to those skilled in the art, such as transformation methods mediated by Agrobacterium. The plant of the deposit or its progeny is a suitable source of the modified gene.

[0078] The present invention further relates to a method for identifying spinach plants containing alleles of the present invention, wherein the method comprises:

[0079] a1) Detecting the alleles of the present invention in the plant genome by determining the sequence of the alleles, or

[0080] a2) Detect the sequence of the LRR domain of the allele of the present invention in the plant genome, or

[0081] a3) Detecting unique polymorphisms in the alleles of this invention, and

[0082] b) Optionally, plants containing the alleles of the present invention are tested for resistance to spreading downy mildew. The sequence of the LRR domain of the alleles of the present invention can be determined by using primer pairs to amplify the LRR domain, wherein the forward primer is a nucleic acid molecule having the sequence of SEQ ID NO: 5, and wherein the reverse primer is a nucleic acid molecule having the sequence of SEQ ID NO: 6.

[0083] The present invention further relates to a method for selecting spinach plants resistant to spreading downy mildew, the method comprising: identifying the presence of alleles of the present invention in the plant; optionally testing the plant for resistance to spreading downy mildew; and selecting plants containing said alleles as those resistant to at least the following physiological races of spreading downy mildew: Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15. For plants resistant to Pe:16, Pe:17, Pe:18, Pe:19 and Pe:20, when the alleles of the present invention are present in a homozygous state; or for plants resistant to at least the spreading downy mildew physiological races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17, Pe:19 and Pe:20, when the alleles of the present invention are present in a heterozygous state.

[0084] The introduction of the alleles of the present invention can also be carried out by introgression from plants containing said alleles, such as from plants whose representative seeds are preserved as NCIMB 44301, or from their progeny, or from any other plant of the present invention. Breeding methods such as hybridization and selection, backcrossing, recombination selection, or other breeding methods that result in the transfer of genetic sequences from resistant plants to susceptible plants can be used. Resistant plants can belong to the same species or to different and / or wild species. Difficulties in hybridization between species can be overcome by techniques known in the art, such as embryo rescue, or by applying cis-genesis instead. The progeny of the preserved specimen can be the sexual or asexual offspring of that preserved specimen, which can be self-pollinated and / or hybridized, and can belong to F1, F2, or further generations, as long as the progeny of said preserved specimen still contains the modified alleles of the present invention present in the seeds of that preserved specimen. Plants produced by such methods are also part of the present invention.

[0085] The present invention also relates to a method for producing plants exhibiting resistance to physiological races of spreading downy mildew, Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19, and Pe:20, said method comprising the following steps:

[0086] a) Crossing a first parent plant containing the alleles of the present invention with a second parent plant to obtain an F1 population;

[0087] b) Optionally, one or more rounds of self-pollination and / or hybridization with plants from the F1 population may be carried out to obtain further generations;

[0088] c) Select plants containing the alleles of the present invention from the F1 population or further generations of the population as resistant plants.

[0089] The present invention also relates to a method for producing plants resistant to the physiological races of spreading downy mildew Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19 and Pe:20, said method comprising:

[0090] a) Crossing a first parent plant containing the alleles of the present invention with a second parent plant not containing the alleles of the present invention;

[0091] b) Backcross the plant obtained in step a) with the second parent plant for at least three generations;

[0092] c) Select plants from a third or higher generation backcross population that contain at least the alleles of the present invention from the first parent plant of step a) as plants resistant to spreading downy mildew.

[0093] The present invention also relates to a method for producing plants exhibiting resistance to at least the physiological races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19, and Pe:20 and Pe:13, said method comprising the following steps:

[0094] a) Crossing a first parent plant containing the alleles of the present invention with a second parent plant to obtain an F1 population;

[0095] b) Optionally, one or more rounds of self-pollination and / or hybridization with plants from the F1 population may be carried out to obtain further generations;

[0096] c) Select plants containing the alleles of the present invention from the F1 population or further generations of the population as resistant plants.

[0097] The present invention also relates to a method for producing plants resistant to the physiological races of spreading downy mildew Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19 and Pe:20, said method comprising:

[0098] a) Crossing a first parent plant containing the alleles of the present invention with a second parent plant not containing the alleles of the present invention;

[0099] b) Backcross the plant obtained in step a) with the second parent plant for at least three generations;

[0100] c) Select plants from a third or higher generation backcross population that contain at least the alleles of the present invention from the first parent plant of step a) as plants resistant to spreading downy mildew.

[0101] The present invention further provides a method for introducing another desired trait into a plant resistant to spreading downy mildew, the method comprising:

[0102] a) Crossing a plant containing the alleles of the present invention with a second plant containing the other desired traits to produce F1 offspring;

[0103] b) Select plants in F1 that contain the resistance and the other desired traits;

[0104] c) Selected F1 offspring are crossed with one of the parents for at least three generations to produce backcross offspring;

[0105] d) Select backcross progeny that contain the said resistance and the other desired traits; and

[0106] e) Optionally, repeat steps c) and d) one or more times consecutively to produce selected fourth or higher generation backcross offspring that contain the said resistance and the other desired traits.

[0107] Optionally, a self-pollination step may be performed after any of the hybridization or backcrossing steps in the methods described above. Selection of plants containing the aforementioned downy mildew resistance and the other desired traits may alternatively be performed after any hybridization or self-pollination step in the method. The other desired traits may be selected from, but are not limited to, the following group: resistance to bacterial, fungal, or viral diseases; insect or pest resistance; improved germination; plant size; plant type; improved storage life; tolerance to water and heat stress; and male sterility. The present invention includes plants produced by this method.

[0108] Resistance information

[0109] Table 1

[0110] The resistance spectrum conferred by the α-WOLF 30 allele when present in spinach plants in a homozygous or heterozygous manner. "-" indicates complete resistance to a specific downy mildew race; "(-)" indicates moderate resistance to a specific downy mildew race; "+" indicates that the allele does not confer resistance and will cause plants carrying only the α-WOLF 30 allele to be completely susceptible to that specific downy mildew race; "nt" indicates that it was not tested against that isolate. For the use of " The physiological races pointed out did not test for alleles in a heterozygous state.

[0111]

[0112] Preservation Information

[0113] Seeds of plants containing the α-WOLF 30 allele of the present invention in their genome were deposited on December 1, 2023, at NCIMB Ltd, Wellheads Place, Dyce, Aberdeen AB21 7GB, UK, under accession number NCIMB 44301. This deposit was made in accordance with the terms of the Budapest Treaty. Following the publication of the patent grant, all restrictions on this deposit will be removed, and the deposit is intended to meet the requirements of 37 CFR § 1.801-1.809. Following the publication of the patent grant, the deposit will be irrevocably and without restriction or condition to the public. The deposit will remain in the depository for a period of 30 years, or 5 years after the last request, or until the expiration of the patent term, whichever is longer, and will be replaced if necessary during that period.

[0114] Sequence information

[0115] Table 2. Sequence information.

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124] The present invention will be further illustrated in the following embodiments, which are for illustrative purposes only. These embodiments are not intended to limit the invention in any way.

[0125] Example

[0126] Example 1

[0127] Testing of resistance to spreadable downy mildew in spinach plants

[0128] For example, Irish et al. (2008; PhytopatholAs described in . 98: 894-900, resistance to downy mildew infection was determined using the International Seed Federation's differential sets (https: / / worldseed.org / document / differential-sets-peronospora-effusa-pe-spinach / ). Spinach plants of this invention were sown together with spinach plants from different other genotypes (see Table 3) in trays containing Scotts Redi-Earth medium and fertilized twice weekly with Osmocote Peter's (13-13-13) fertilizer (Scotts) after seedling emergence. At the first true leaf stage, a suspension of sporangia of the pathogenic physiological race of downy mildew (2.5 × 10⁻⁶) was applied. 5 Plants were inoculated with a concentration of 100 ml. Four officially recognized pathogenic physiological races were tested in this manner.

[0129] Inoculated plants were placed in a dew chamber at 18°C ​​and 100% relative humidity for 24 hours; then transferred to a growth chamber at 18°C ​​and a 12-hour photoperiod for 6 days. After 6 days, the plants were returned to the dew chamber for 24 hours to induce sporulation, and their disease response was scored.

[0130] For example, Irish et al. (2007; Plant Dis. As described in 91: 1392-1396, plants used for a particular test are scored as resistant, moderately resistant, or susceptible based on symptoms of chlorosis and signs of pathogen spore formation on cotyledons and true leaves. Plants that do not show signs of chlorosis and spore formation in that particular test are considered resistant. Re-inoculation with resistant plants is used to assess whether the plants initially scored as resistant escaped infection or whether they are truly resistant. Plants showing only symptoms of chlorosis or spore formation occurring only at the cotyledon tips are scored as moderately resistant. Plants showing more than these symptoms of downy mildew infection are scored as susceptible.

[0131] Table 1 shows the resistance of plants carrying the α-WOLF 30 allele to each of these pathogenic physiological races. Table 3 shows the identification kits for spinach downy mildew physiological races and the resistance of various spinach varieties (hybrids) to each of these pathogenic physiological races. Susceptibility was scored as “+” (indicating successful fungal infection with spore formation throughout the cotyledons), and resistance was described as “-” (no spore formation on the cotyledons). Weak resistance responses were indicated as “(-)”, which in practice means a slightly reduced level of infection (in the identification seedling test, symptoms of chlorosis only, or spore formation only at the cotyledon apex).

[0132] Table 3:

[0133]

[0134] Example 2

[0135] Amplification of the region encoding the LRR domain

[0136] Genomic DNA isolated from spinach plants containing the α-WOLF 30 allele (representative seed samples are deposited in NCIMB with accession number NCIMB 44301) was used in polymerase chain reaction (PCR) using forward primer ACAAGTGGATGTGTCTTAGG (SEQ ID NO: 5) and reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID NO: 6). The primer pair amplified α- WOLF The gene encodes the LRR domain and has been designed to selectively amplify it. WOLF The portion of the gene is amplified, but the portion of other genes encoding the CC-NBS-LRR protein is not amplified.

[0137] Used to amplify α- using primers with SEQ ID NO: 5 and SEQ ID NO: 6 WOLF The PCR conditions for the region of the gene encoding the LRR domain are as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):

[0138] - 3 minutes at 95°C (initial denaturation step).

[0139] - 40 amplification cycles, each consisting of the following: denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds.

[0140] - 72°C for 2 minutes (final extension step).

[0141] Genomic DNA isolated from spinach plants of the Viroflay variety containing the β-WOLF 0 allele was used in polymerase chain reaction (PCR) using forward primer TCACGTGGGTTGTGTTGT (SEQ ID NO: 7) and reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID NO: 6). The primer pair amplified β-WOLF 0 alleles. WOLF The gene encodes the LRR domain and has been designed to selectively amplify it. WOLF The portion of the gene is amplified, but the portion of other genes encoding the CC-NBS-LRR protein is not amplified.

[0142] Used to amplify β- using primers with SEQ ID NO: 6 and SEQ ID NO: 7 WOLF The PCR conditions for the region of the gene encoding the LRR domain are as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):

[0143] - 3 minutes at 95°C (initial denaturation step).

[0144] - 40 amplification cycles, each consisting of the following: denaturation at 95°C for 30 seconds, annealing at 58°C for 50 seconds, and extension at 72°C for 50 seconds.

[0145] - 72°C for 2 minutes (final extension step).

[0146] The PCR products were visualized on an agarose gel (not shown), and DNA was purified from the PCR reaction. The sequences of the PCR products were then determined using methods well-known in the art.

[0147] The DNA sequence of the LRR domain of the α-WOLF 30 allele, amplified by primers having SEQ ID NO: 5 and SEQ ID NO: 6, is provided in Table 2, under SEQ ID NO: 12.

[0148] The DNA sequence of the LRR domain of the β-WOLF 0 allele, amplified by primers having SEQ ID NO: 6 and SEQ ID NO: 7, is provided in Table 2, under SEQ ID NO: 8.

[0149] Finally, the obtained sequences were translated into the corresponding amino acid sequences of the LRR domain, which have SEQ ID NO:13 and SEQ ID NO:9, relating to the α-WOLF 30 allele and the β-WOLF 0 allele, respectively (see also Table 2).

[0150] If SMRT sequencing (Pacific Biosciences) is used to sequence PCR products, then the PCR primers and PCR conditions are different.

[0151] Add the following standard amplification sequence to the forward primers mentioned above: GCAGTCGAACATGTAGCTGACTCAGGTCAC.

[0152] Add the following standard amplification sequence to the reverse primer: TGGATCACTTGTGCAAGCATCACATCGTAG.

[0153] Example 3

[0154] The α-WOLF 30 allele was introduced into plants that did not carry the allele.

[0155] Spinach plants containing the α-WOLF 30 allele (representative seed samples of which are deposited in NCIMB with accession number NCIMB 44301) were crossed with plants of the cultivar Viroflay carrying the β-WOLF 0 allele to obtain the F1 generation. Subsequently, the F1 plants were self-pollinated to obtain the F2 population.

[0156] As described in Example 1, the plants in the F2 population were assessed for resistance to the physiological races Pe:1, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19, and Pe:20 of *Pertussis rubrum*. In this assay, approximately 75% of the plants were scored as completely resistant. This segregation pattern is consistent with a dominant inheritance pattern.

[0157] Genomic DNA was isolated from each plant in the same F2 population and used in two different polymerase chain reactions (PCRs). The first PCR reaction was performed using primers for amplifying the LRR domain of the α-WOLF allele, and the second PCR reaction was performed using primers for amplifying the LRR domain of the β-WOLF allele, both as described in Example 2.

[0158] Visualization of the PCR products on an agarose gel (not shown) demonstrated that approximately 75% of the plants contained the α-WOLF fragment, while the remaining approximately 25% contained only the β-WOLF fragment. Plants containing the α-WOLF fragment were fully associated with plants rated as resistant to physiological races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19, and Pe:20. Plants containing only the β-WOLF fragment were fully associated with plants rated as susceptible to all tested physiological races.

[0159] DNA was purified from the PCR reaction, and the sequences of the PCR products were then determined. The α-WOLF PCR product yielded the sequence corresponding to SEQ ID NO: 12 (i.e., the sequence of the LRR domain of the α-WOLF 30 allele). The β-WOLF PCR product yielded the sequence corresponding to SEQ ID NO: 8 (i.e., the sequence of the LRR domain of the β-WOLF 0 allele). PCT / RO / 134 Table

Claims

1. The allele of the α-WOLF gene, referred to herein as α-WOLF 30, encodes an allele that, when expressed homozygous in spinach plants, confers at least [a specific gene] on *Peronospora sp.* (spreading downy mildew). Peronospora effusa The resistance proteins of physiological races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:10, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18, Pe:19, and Pe:20, wherein said proteins contain the motifs "MAEIGYSVC" and "KWMCLR" at their N-termini in their amino acid sequences; and wherein said alleles contain: a) A nucleotide sequence containing a coding sequence having at least 89.5% sequence identity with SEQ ID NO: 10 or SEQ ID NO: 14; or b) A nucleotide sequence encoding a protein having an amino acid sequence having at least 89% sequence similarity to SEQ ID NO: 11 or SEQ ID NO: 15, or c) A nucleotide sequence encoding an LRR domain, wherein the nucleotide sequence has at least 94.5% sequence identity with SEQ ID NO: 12, or d) A nucleotide sequence encoding an LRR domain having an amino acid sequence having at least 93.5% sequence similarity to SEQ ID NO:

13.

2. The allele of claim 1, wherein the protein encoded by the allele further comprises the motif "DQEDEGEDN" in its amino acid sequence.

3. A protein encoded by an allele according to claim 1 or 2.

4. A spinach plant containing the alleles according to any one of claims 1 and 2, wherein a representative seed sample of the plant is deposited in NCIMB with accession number NCIMB 44301.

5. The spinach plant according to claim 4, wherein the plant is an agronomically superior plant, particularly a hybrid variety or inbred line.

6. Spinach seeds capable of growing into a spinach plant according to any one of claims 4 and 5.

7. Reproductive material suitable for producing spinach plants according to any one of claims 4 and 5, wherein the reproductive material is suitable for sexual reproduction and is particularly selected from microspores, pollen, ovary, ovule, embryo sac, and egg cell, or suitable for vegetative reproduction and is particularly selected from cuttings, roots, stem cells, and protoplasts, or suitable for tissue culture of regenerable cells or protoplasts, wherein the regenerable cells or protoplasts are particularly selected from leaves, pollen, embryo, cotyledons, hypocotyl, meristem, root, root tip, anther, flower, and stem, and wherein the reproductive material contains alleles according to claim 1 or 2.

8. A method for identifying spinach plants containing the alleles according to claim 1 or 2, wherein the method comprises: a1) Detecting the alleles according to claim 1 or 2 in the plant genome by determining the sequence of the alleles, or a2) Detect the sequence of the LRR domain of the allele according to claim 1 or 2 in the plant genome, or a3) Detecting unique polymorphisms in alleles according to claim 1 or 2, and b) Optionally, plants containing the alleles according to claim 1 or 2 are tested to demonstrate resistance to spreading downy mildew.

9. The method of claim 8, wherein the sequence of the LRR domain is determined by amplifying the LRR domain using a primer pair, wherein the forward primer is a nucleic acid molecule having the sequence of SEQ ID NO:

5.

10. The method of claim 8, wherein the sequence of the LRR domain is determined by using a primer pair to amplify the LRR domain, wherein the reverse primer is a nucleic acid molecule having the sequence of SEQ ID NO:

6.

11. A method for selecting spinach plants resistant to spreading downy mildew, the method comprising: Identify the presence of the alleles according to claim 1 or 2 in plants, and select plants containing said alleles as plants resistant to at least the physiological races of spreading downy mildew Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17, Pe:19 and Pe:

20.

12. A method for producing spinach plants resistant to spreading downy mildew, the method comprising the following steps: a) Crossing a first parent plant containing the alleles described in claim 1 or 2 with a second parent plant to obtain an F1 population; b) Optionally, one or more rounds of self-pollination and / or hybridization with plants from the F1 population may be carried out to obtain further generations of population; c) Select plants containing the alleles according to claim 1 or 2 from the first or further generation population as resistant plants.

13. A method for producing hybrid spinach seeds resistant to spreading downy mildew, the method comprising the steps of: crossing a first parent plant with a second parent plant, wherein one or both of the parents are homozygous for the alleles described in claim 1 or 2; and harvesting the hybrid seeds.

14. Hybrid seeds produced by the method according to claim 13.

15. A plant grown from the hybrid seeds according to claim 14.

16. A method for cultivating spinach plants resistant to at least the physiological races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17, Pe:19, and Pe:20 of *Peronospora*, said method comprising the step of planting seeds containing alleles according to claim 1 or 2, a representative sample of said seeds being deposited in NCIMB with accession number NCIMB 44301.

Images