CAR-T cells containing CDKN1B gene knockout and their application methods

Abstract

This disclosure describes CAR-T cells containing CDKN1B loss-of-function mutations, and methods for treating BCMA-expressing cancers (e.g., multiple myeloma) using CAR-T cells containing BCMA with CDKN1B loss-of-function mutations.

Description

[0001] Related applications

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 602,032, filed November 22, 2023, entitled “CAR-T cells containing CDKN1B gene knockout and methods of using thereof,” filed November 7, 2024, pursuant to 35 USC § 119(e), the entire contents of which are incorporated herein by reference.

[0003] Reference to the electronic sequence list

[0004] The contents of the electronic serial number (M105370052WO00-SEQ-ARM.xml; size: 97,387 bytes; creation date: November 20, 2024) are incorporated herein by reference in their entirety. Background Technology

[0005] Chimeric antigen receptor (CAR)-T cell therapy has been shown to be effective in treating certain types of cancer (e.g., hematologic malignancies) in some patients. CAR-T cells are typically prepared by extracting T cells from cancer patients and modifying them to contain a CAR that binds to an antigen expressed by the tumor. Therefore, CAR-T cells can target tumor cells expressing that antigen. However, CAR-T cells can become depleted when administered to patients, thus reducing the therapeutic effect of CAR-T cell therapy. Invention Overview

[0007] This disclosure describes the surprising finding that loss-of-function mutations in the cyclin-dependent kinase inhibitor 1B (CDKN1B) gene in CAR-T cells increase in vivo persistence. Specifically, the inventors used CRISPR to test the in vivo effects of gene knockout in different B cell maturation protein (BCMA)-binding CAR-T cells (BCMA CAR-T cells). The genes selected for knockout were those known to be involved in CAR-T cell activity. Some gene knockouts increased the in vivo persistence of BCMA CAR-T cells, including CDKN1B. Furthermore, CDKN1B knockout significantly increased the in vivo efficacy of BCMA CAR-T cells against multiple myeloma.

[0008] In some aspects, this disclosure provides a chimeric antigen receptor (CAR)-T cell comprising a loss-of-function mutation in the cyclin-dependent kinase inhibitor 1B (CDKN1B) gene. In some embodiments, the loss-of-function mutation is an early stop codon, truncation, frameshift mutation, deletion, or insertion in the CDKN1B gene.

[0009] In some embodiments, the loss-of-function mutation is a deletion or insertion in the CDKN1B gene. In some embodiments, the loss-of-function mutation is a deletion or insertion in exon 1 of the CDKN1B gene. In some embodiments, the loss-of-function mutation is a deletion or insertion in SEQ ID NO:3 or 4 of exon 1 of the CDKN1B gene.

[0010] In some embodiments, CAR-T cells contain a polynucleotide encoding a clustered regularly spaced short palindromic repeat (CRISPR) guide RNA polynucleotide, which contains a homologous region complementary to the CDKN1B gene.

[0011] In some embodiments, the homologous region comprises a polynucleotide sequence of any one of SEQ ID NO:1-2 or 65-70. In some embodiments, the homologous region comprises a polynucleotide sequence of any one of SEQ ID NO:1-2. In some embodiments, the CAR-T cell further comprises a CRISPR protein. In some embodiments, the CRISPR protein is the Cas9 protein. In some embodiments, the CAR comprises: (i) an antigen-binding domain; (ii) a transmembrane domain; and (iii) an intracellular signal transduction domain.

[0012] In some embodiments, the antigen-binding domain binds to any one of BCMA, CD19, CD79b, TACI, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, and claudin6, or any pair of CD19 / CD79b, BCMA / TACI, or the TriPRIL antigen-binding domain. In some embodiments, the antigen-binding domain binds to BCMA. In some embodiments, the BCMA-binding antigen-binding domain comprises the amino acid sequence of SEQ ID NO:5.

[0013] In some embodiments, the transmembrane domain includes the α, β, or ζ chain of the T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278), 4-1BB (CD137), 4-1BBL, GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, and NKp80. (KLRFI), CD160, CD19, IL2Rβ, IL2Rγ, IL7Rα, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d , ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ly9(CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​PAG / Cbp, NKp44, NKp30, NKp46, NKG2D or NKG2C transmembrane domains.

[0014] In some embodiments, the transmembrane domain comprises a CD8 transmembrane domain. In some embodiments, the CD8 transmembrane domain comprises the amino acid sequence of SEQ ID NO:49. In some embodiments, the intracellular signaling domain comprises a CD3γ, CD3ε, CD3δ, or CD3ζ intracellular signaling domain. In some embodiments, the intracellular signaling domain comprises a CD3ζ intracellular signaling domain. In some embodiments, the CD3ζ intracellular signaling domain comprises the amino acid sequence of SEQ ID NO:54.

[0015] In some embodiments, the CAR further includes a co-stimulatory domain. In some embodiments, the co-stimulatory domain includes CD28, 4-1BB, CD27, TCR-ζ, FcR-γ, FcR-β, CD3-γ, CD3-θ, CD3-σ, CD3-η, CD3-ε, CD3-ζ, CD22, CD79a, CD79b, or CD66d co-stimulatory domains. In some embodiments, the co-stimulatory domain includes a 4-1BB co-stimulatory domain. In some embodiments, the CAR further includes a truncated CD34 (CD34t) protein. In some embodiments, the CD34t protein includes the amino acid sequence of SEQ ID NO:71. In some embodiments, the CAR includes a 2A peptide between the intracellular signal transduction domain and the CD34t protein.

[0016] In some embodiments, the CAR further comprises a signal peptide. In some embodiments, the signal peptide comprises a CD8 signal peptide or an IgK signal peptide. In some embodiments, the CD8 signal peptide comprises the amino acid sequence of SEQ ID NO:55.

[0017] In some embodiments, the CAR comprises, from the N-terminus to the C-terminus: (i) a CD8 signal peptide sequence; (ii) an antigen-binding domain that binds to BCMA; (iii) a CD8 transmembrane domain; (iv) a 4-1BB co-stimulatory domain; and (v) a CD3ζ intracellular signal transduction domain.

[0018] In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO:6 or 36. In some embodiments, the CAR comprises the amino acid sequence of any one of SEQ ID NO:6-47. In some embodiments, this disclosure provides a method of treating a subject with BCMA-expressing cancer, the method comprising administering CAR-T cells to the subject. In some embodiments, the BCMA-expressing cancer is B-cell cancer. In some embodiments, the BCMA-expressing cancer is multiple myeloma. In some embodiments, the subject is a human subject.

[0019] Brief description of the attached figures

[0020] The following figures form part of this specification and are included to further illustrate certain aspects of this disclosure, which can be better understood by referring to one or more of these figures in conjunction with the detailed description of the specific embodiments presented herein.

[0021] Figure 1 This is a schematic diagram showing the production of T cells expressing B cell maturation antigen (BCMA) chimeric antigen receptor (CAR) and the subsequent transfer of CAR-T cells to mice injected with MM.1s (B lymphoblastic cell line) tumor cells.

[0022] Figure 2A-2B This study concerns the persistence of control CAR-T cells cultured in interleukin-2 (IL-2) or IL-7 and IL-15, or CAR-T cells with different gene knockouts (e.g., CRISPR including insertion / deletion mutations) in genes related to T cell function. CAR-T cell persistence was measured in vitro (day -11 to day 0). Figure 2A ) or in vivo period (day 7 or day 21 after transplantation into mice; Figure 2B CAR-T cells were then evaluated. CAR-T cells with RAS p21 activator 2 (RASA2) knockout were identified as the best-performing knockouts in vitro, while CAR-T cells with cyclin-dependent kinase inhibitor 1B (CDKN1B) knockout and protein tyrosine phosphatase non-receptor type 2 (PTPN2) knockout were identified as the best-performing knockouts in vivo.

[0023] Figures 3A-3C This demonstrates the expansion of CAR-T cells engineered to have gene knockout in RASA2ko, PTPN2ko, CDKN1Bko, CD160 (CD160ko), and IL-2 receptor α (IL2Rako) (cultured in IL-7 and IL-15 or not). Figure 3A ) and phenotype ( Figure 3B-3C ). Figure 3B The percentage of cells exhibiting both CD4+ T helper phenotype and CD8+ cytotoxic T cell phenotype was shown, and Figure 3C The percentages of CD4+ and CD8+ cells corresponding to the initial, effector, effector memory, and central memory phenotypes are shown.

[0024] Figures 4A-4B The study demonstrated tumor amplification in mice treated with T cells containing BCMA-binding CAR and knockout of IL2RA, CD160, CDKN1B, PTPN2, or RASA2. Figure 4A ) and CAR-T cell expansion ( Figure 4B ) quantitative.

[0025] Figures 5A-5D Repeated stimulation of CAR-T cells is involved. Figure 5A This diagram illustrates an experiment where CAR-T cells and cancer cells were co-cultured at a 1:1 ratio for 72 hours (one stimulation). In the second ( Figure 5B ), the fourth ( Figure 5C ) and the sixth ( Figure 5D Analysis of in vitro cytotoxicity of CAR-T cells to cancer cells after stimulation.

[0026] Figures 6A-6D In vivo experiments were conducted, measuring the cytotoxicity of CAR-T cells to tumor cells (“flux”, y-axis). Figure 6A The mouse transplanted with 2x10 6 1 x 10 CAR-T cells were injected 3 weeks prior to the first injection. 6 An experimental schematic diagram of MM.1s tumor cells. Figures 6B-6C Tumor size is shown in mice treated with CAR-T cells that have knocked out the genes IL2RA (IL2RA ko (IL2)), RASA2 (RASA2 ko), CD160 (CD160ko), PTPN2 (PTPN2 ko), and CDKN1B (CDKN1B ko). Repeated experiments using CDKN1B ko CAR-T cells with T cells from a second donor are also shown. Figure 6D ).

[0027] Figures 7A-7C This demonstrates that circulating CAR-T cells express the exhaustion marker PD-1 on CAR-T cells. Figure 7A ), LAG3 ( Figure 7B ) and Tim-3 ( Figure 7C The percentage of ).

[0028] Figure 8 Cell cycle analysis of CAR-T cells in unstimulated or co-cultured with BCMA-expressing cancer cells (“K562-BCMA co-culture”) is shown.

[0029] Figures 9A-9B The transplantation of MM1.s cancer cells was shown in contrast to the use of control CAR-T cells. Figure 9A ) or CDKN1B ko CAR-T cells ( Figure 9B CD8+ T cells (mainly CAR-T cells) in the spine of mice treated with CAR-T therapy.

[0030] Figures 10A-10F This demonstrates that in vivo loss-of-function CRISPR screening is feasible, but it varies depending on the screening criteria. Figure 10A This is a schematic diagram of the targeted genes in the Mario library. Figure 10BThis is an example diagram of the screening workflow. T cells are activated and transduced sequentially with BCMA CAR and then guide library lentivirus one day later. Pre-electroplated samples are cryopreserved on day -11 for analysis, followed by Cas9 mRNA electroporation (day -7) and CD3 negative selection (day -5). Transduction efficiency is assessed on day -4, and injection input samples are cryopreserved on day 0. T cells containing Mario-CAR-T cells (2E6 double-positive cells) are injected into NSG mice carrying MM1.s. Mice are euthanized on day 7 (early in vivo) or day 21 (late in vivo), and total bone marrow is collected (femur, tibia, and spine). Figure 10C Gene hit volcano plots were displayed, showing the enrichment and depletion of knockout genes based on different analysis time periods: in vitro expansion versus baseline (day -11 to day 0), early in vivo versus in vitro expansion (day 0 to day 7), and early in vivo versus in vitro expansion (day 0 to day 21). n = 3 healthy donor T cells (ND216, ND99, ND106). Figure 10D The frequency histograms of sgRNA enrichment or depletion of RASA2, PTPN2, and CDKN1B are shown, grouped according to the corresponding time period; n=3 healthy donor T cells (ND216, ND99, ND106). Figure 10E This is a comparison of LFC (Legion Functional Cell) scores for gene knockout between IL-2 culture and IL7 / 15 culture screening, categorized by study time period; IL2, n=3 healthy donor T cells (ND216, ND99, ND106), IL7 / 15, 2 of the 3 donors (ND106, ND216). Figure 10F The abundance of sgRNA targeting various genes in Mario-CAR-T cells produced in IL-2 is shown throughout the screening workflow. ND: Normal donor. LFC: Log fold change.

[0031] Figure 11A-11G In vivo Pertub-seq characterization of BCMA CAR-T cells. Figure 11AThis is an example diagram of the perturb-seq workflow. Cells were prepared as described elsewhere in this document. The perturb-seq library was characterized by selected portions of the Mario library genes (intergenic control, CD160, CDKN1B, IL2RA, PTPN2, RASA2, RC3H1, SOSC1, TGBR2, and ZC3H12A). Modified CAR-T cells (2E6 double-positive cells) were transfected into NSG mice carrying MM.1S multiple myeloma. After 21 days, CAR-T cells were isolated from the bone marrow for droplet-based scRNA-seq and sgRNA capture. Human T cells were derived from a single healthy donor (ND106) and isolated from n=4 individual mice for scRNA-seq analysis. Figure 11B Uniform manifold approximation and projection (UMAP) of 18,680 cells are shown, along with 11 clusters identified in NGFR-enriched BCMA CAR-T cells. Figure 11C UMAP shows the expression of genes representing T cell phenotypic markers. Figure 11D UMAP shows the cell cycle score. Figure 11E UMAP shows T-cell phenotype gene tags. Figure 11F The cell density projection is shown by grouping by gene target. Figure 11G The illustration shows the character gene set enrichment analysis (GSEA) of pseudo-bulk pooled PTPN2 KO (left panel) or CDKN1B KO (right panel) CAR-T cells compared with unguided CAR-T cells.

[0032] Figure 12A-12D This study demonstrated that knockout of key T cell regulatory factors enhanced the in vitro expansion and cytotoxicity of BCMA CAR-T cells. Figure 12A The relative expansion of knockout CAR-T cells during IL-2 production is shown. Data represent one or two technical replicates of CAR-T cells generated from two normal donors (ND116, ND202), measured as fold expansion in vitro after CD3-negative selection (fold change of CAR+ cells in culture over time). Data are expressed as mean ± SEM. Statistical significance was measured by two-way ANOVA and Tukey's multiple comparison test. Figure 12B This is a schematic diagram of a repetitive stimulus measurement. Figure 12C-12D This shows a real-time cytotoxicity assay of CAR-T cells co-cultured with irradiated K562-BCMA target cells at a 1:1 effector-to-target (E:T) ratio (taken at different restimulation time points (2nd, 4th, and 6th)). Figure 12C ), and quantitative analysis of total tumor growth after 118 hours of co-culture ( Figure 12DTumor cell growth is shown as total area relative to day 0 (tumor inoculation). Data represent technical replicates of CAR-T cells derived from a single normal donor (ND116). Statistical significance was measured by one-way ANOVA and Tukey's multiple comparison test. Data are expressed as mean ± SEM. *p<0.05, **p<0.01, and ****p<0.0001, ns: no statistical significance.

[0033] Figures 13A-13H This demonstrates that CDKN1B KO enhances the function and persistence of CAR-T cells against myeloma. Figure 13A The tumor burden of MM.1S in mice treated with intergenic control KO, IL2RA KO, PTPN2 KO, RASA2 KO, or CDKN1B KO BCMA CAR-T cells is shown, measured by bioluminescence imaging (BLI). NSG mice were intravenously injected with 1E6 MM.1S, and CAR-T cells were transferred 21 days later. Each group consisted of n=5 mice from a single healthy donor (ND116). Data are presented as mean ± SEM. Statistical significance was measured by comparison with the intergenic KO CAR-T cell treatment groups at day 77 (CDKN1B KO, PTPN2 KO) or day 49 (IL2RA KO, RASA2 KO), using two-way ANOVA and Tukey's multiple comparison test. Figure 13B This is the CD8 immunohistochemical staining of spinal bone marrow on day 21 after CAR-T cell transfer (top image). CD8+ cells / mm from 5 independent regions of n=2 mice. 2 Quantitative (see figure below). Data are expressed as mean ± SEM, with individual data points. Statistical significance was measured using a two-tailed Student's t-test. Figure 13C The RPMI-8226 tumor burden (top) and overall survival (bottom) of mice treated with intergenic control KO or CDKN1B KO BCMACAR-T cells are shown. NSG mice were subcutaneously injected with 5E6 RPMI-8226, and CAR-T cells were transferred 14 days later. Each group consisted of n=5 mice from two healthy donors (ND116, ND202) (10 mice per group). The tumor-only group consisted of n=3 mice. Tumor volume (mm) was measured using calipers. 3 Data are expressed as mean ± SEM. Statistical significance for tumor burden was measured by comparison with the intergenic KO CAR-T cell treatment group at day 42 using two-way ANOVA and Tukey's multiple comparison test. Overall survival was measured by log-rank test (Mantel-Cox test) on Kaplan-Meier curves. Figure 13DThis is a bulk RNA-seq volcano plot of intergene control KO or CDKN1BKO BCMA CAR-T cells isolated from the bone marrow of NSG mice 21 days after transfer to mice with MM.1S myeloma. The intergene control group consisted of n=3 mice, and the CDKN1B KO group (ND116) consisted of n=5 mice. Genes selectively upregulated and downregulated in CDKN1B KO cells are shown. Figure 13E This is a heatmap showing the relative expression of genes in a selected set of marker genes. The genes included in the set are already labeled. Figure 13F The GSEA values ​​are from KO and CDKN1B KO CAR-T cells, which are the intergene control. All FDR values ​​are <0.0001. Figure 13G This is an RNA-seq-derived GSEA heatmap of gene sets from memory, effector, and exhausted CD8+ T cells, comparing gene-controlled KO and CDKN1B KO CAR-T cells. Figure 13H This study shows the 14-day survival of intergene control ko CAR-T cells and CDKN1B ko CAR-T cells, measured by DAPI live / dead staining, in the absence of IL-2 and antigen-expressing tumor cells. Statistical significance at each day between intergene control ko and CDKN1B ko CAR-T cells was determined using two-way ANOVA and Tukey's multiple comparison test. Data are expressed as mean ± SEM. **p<0.01, ***p<0.001, and ****p<0.0001, ns: no statistical significance.

[0034] Figures 14A-14H The results of in vivo screening of human CAR-T cells were comparable across multiple healthy human donors. Figure 14A An exemplary construct design of a 4-1BB BCMA CAR (pCAR) containing a Mario sgRNA library (variable sgRNA) and a dual guide box (pGuide) is shown. Figure 14B This is a timeline of the MM.1S stress model with 21-day tumor transplantation and 2E6 CAR treatment. Tumor growth was tracked via BLI. Data are presented as mean ± SEM. There were n=3 mice per group (tumor only, Mario library (without CAR)) and n=5 mice per group (CAR-T, Mario-CAR-T), all from the same healthy donor (ND202). Statistical significance between groups at day 35 was measured by two-way ANOVA and Tukey multiple comparisons. Figure 14C The CD3 expression (ND216, ND99, ND106) after CD3 negative enrichment on day -5 is shown. Figure 14DThe images show representative Mario-CAR-T cell staining for ND216, with CD34 indicating CAR transduced cells and NGFR indicating sgRNA library transduced cells. Figure 14E This is a repeated autocorrelation analysis scatter plot. Calculate the Pearson correlation of the library distribution between a single animal and any other animal, between two average animals and any two other animals, and so on. Plot the average of all possible combinations. Figure 14F This is a quantitative method for repeated autocorrelation analysis. Pearson correlations are calculated between a single animal and any other animal, between two average animals and any two other animals, and so on. The averages of all possible combinations are plotted. Figure 14G It is a z-score abundance histogram of gene-targeted or intergene-control sgRNAs across screening time points and conditions. Figure 14H The Pearson correlation of donors across screening time points and conditions is shown. ns = no significance.

[0035] Figures 15A-15D In vivo screening involving the identification of genes that improve CAR-T cell abundance and transcriptional phenotype. Figure 15A The Log2 (fold change) ranking of genes during IL-7 / IL-15 production in vitro (end of production vs. baseline, left panel) and in early in vivo (day 7 vs. end of production, middle panel) or late in vivo (day 21 vs. end of production, right panel) is shown. Enriched and depleted genes are displayed, with circle size corresponding to -log10 (FDR). n = 2 healthy donor T cells (ND106, ND216). Figure 15B The abundance of sgRNAs targeting individual genes was shown throughout the screening workflow of Mario-CAR-T cells produced in IL-7 / IL-15. Figure 15C This is a heatmap showing the relative expression of the most significantly differentially expressed genes among BCMA CAR-T cell clusters. Figure 15D The proportion of each knockout cell type in each cluster is shown.

[0036] Figures 16A-16C This involves the generation and validation of knockout CAR-T cells. Figure 16A Examples of construct designs for a 4-1BB BCMA CAR (pCAR) containing a single gene sgRNA (variable sgRNA) and a dual guide box (pGuide) are: CDKN1B, IL2RA, PTPN2, and RASA2. Figure 16B This study demonstrates the quantification of insertions / deletions (indels) in sgRNA target regions using next-generation sequencing. Data represent target sgRNAs 1 and 2 for CDKN1B, PTPN2, and RASA2, respectively; expressed as mean ± SEM. Figure 16CThe image shows IL2RA expression as detected by flow cytometry, comparing IL2RA KO CAR-T cells (before and after electroporation / CD3-negative selection) with UTD and intergenic control KO cells (producing IL-2 and IL-7 / IL-15, respectively). UTD = untransduced T cells.

[0037] Figures 17A-17B This involves the in vitro cytotoxicity of CAR-T cells knocked out. Figures 17A-17B The results showed the interaction between MM.1S tumor cells and different effector-to-target (E:T) ratios (from 10:1 to 1:100). Figure 17A ) or RPMI-8226 ( Figure 17B Luciferase-based killing assay of co-cultured knockout CAR-T cells at 16 hours. The top panel shows a comparison of intergenic KO CAR-T cells with UTD. The middle and bottom panels show the relative killing of IL2RA KO (producing IL-2 or IL-7 / IL-15; middle panel) or CDKN1B KO, PTPN2 KO, and RASA2 KO (bottom panel) compared to intergenic KO CAR-T cells. Data represent technical replicates of CAR-T cells derived from two normal donors (ND116, ND202). Data are expressed as mean ± SEM. Significance was measured by two-way ANOVA and Tukey's multiple comparison test. UTD = untransduced T cells. ***p<0.001, ns = no significance.

[0038] Figures 18A-18C The results showed that CDKN1B ablation increased the in vivo efficacy of BCMA CAR-T cells. Figure 18A The tumor burden of MM.1S in mice treated with either intergenic control KO or CDKN1B KO BCMA CAR-T cells is shown, measured by bioluminescence imaging (BLI). NSG mice were intravenously injected with 1E6 MM.1S, and CAR-T cells were transferred 21 days later. Each group consisted of n=3 mice from a single healthy donor (ND202). Data are presented as mean ± SEM. Statistical significance was measured by comparison with the intergenic KO CAR-T cell treatment group at day 77 (CDKN1B KO, PTPN2 KO), using two-way ANOVA and Tukey's multiple comparison test. Figure 18BOverall survival of mice treated with either intergenic control KO or CDKN1B KO BCMA CAR-T cells is shown. The number of animals treated with tumor-only and intergenic control KO CAR-T cells was 13, and the number of animals treated with CDKN1B KO CAR-T cells was 16. Data combine multiple experiments using T cells from two healthy human donors (ND202, ND116). Statistical significance was measured by a log-rank test (Mantel-Cox test) on Kaplan-Meier curves. Figure 18C The cell cycle (G0 / G1, S, G2 / M) is compared between CDKN1B KO and gene control KO CAR-T cells. Cells were stimulated with irradiated K562-BCMA tumor cells on days 0 and 6, and flow cytometry measurements were performed on days 0 (before stimulation), 1, 7, and 14 (schematic diagram shown in the left panel). *p<0.05, and **p<0.01. Detailed Implementation

[0039] General definition

[0040] In some embodiments, the term "engineered" and its grammatical equivalents as used herein may refer to one or more artificially designed alterations to nucleic acids (e.g., nucleic acids within an organism's genome). In another embodiment, "engineered" may refer to alterations, additions, and / or deletions of genes. "Engineered cell" may refer to a cell having added, deleted, and / or altered genes.

[0041] The term “cell” or “engineered cell” and its grammatical equivalents used in this article may refer to cells of human or non-human animal origin.

[0042] As used herein, the term "operably linked" refers to the linking of a first polynucleotide molecule (such as a promoter) to a second transcribed polynucleotide molecule (such as a target gene), wherein the arrangement of the polynucleotide molecules such that the first polynucleotide molecule influences the function of the second polynucleotide molecule. The two polynucleotide molecules may or may not be part of a single, consecutive polynucleotide molecule, and may or may not be adjacent. For example, if a promoter regulates or mediates the transcription of a target gene in a cell, then the promoter is operably linked to the target gene.

[0043] In some respects, this disclosure describes chimeric antigen receptor (CAR)-T cells containing loss-of-function mutations in the cyclin-dependent kinase inhibitor 1B (CDKN1B) gene.

[0044] The term “polynucleotide” is used interchangeably with “nucleic acid molecule” herein and refers to a polymer of nucleosides. Generally, polynucleotides include nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) that are naturally present in DNA or RNA and linked by phosphodiester bonds. However, the term encompasses molecules containing nucleosides or nucleoside analogs with chemically or biologically modified bases, modified backbones, etc., whether or not they are found in naturally present nucleic acids, and such molecules may be preferred in certain applications. When this disclosure refers to polynucleotides, it should be understood that both DNA and RNA are provided, and in each case, both single-stranded and double-stranded forms are provided (as well as the complementary strand of each single-stranded molecule). As used herein, “polynucleotide sequence” can refer to the polynucleotide material itself and / or the sequence information (i.e., the letter sequence used as a base abbreviation) that biochemically characterizes a particular nucleic acid. In some embodiments, the nucleic acid molecule is a heterologous nucleic acid molecule. As used herein, the term “heterologous nucleic acid molecule” refers to a nucleic acid molecule that is not naturally present in a given cell.

[0045] The polynucleotide sequences presented in this article are shown in the 5' to 3' orientation unless otherwise stated.

[0046] As used herein, the term "peptide" refers to a polymer of amino acids. The terms "protein" and "peptide" are used interchangeably herein. A peptide can be a relatively short polypeptide, typically between about 2 and 60 amino acids in length. Peptides used herein generally contain amino acids, such as the 20 most common L-amino acids in proteins. However, other amino acids and / or amino acid analogs known in the art may be used. One or more amino acids in a polypeptide may be modified, for example by adding chemical entities such as carbohydrate groups, phosphate groups, fatty acid groups, linkers for coupling, functionalization, etc. A polypeptide having a non-peptide portion covalently or non-covalently associated with it should still be considered a "peptide". Exemplary modifications include glycosylation and palmitoylation. Peptides can be purified from natural sources, produced using recombinant DNA technology, or synthesized by chemical methods such as conventional solid-phase peptide synthesis. As used herein, the terms "peptide sequence" or "amino acid sequence" can refer to the polypeptide material itself and / or the sequence information (i.e., a letter sequence or a three-letter code used as an abbreviation for amino acid names). The polypeptide sequences presented herein are presented in an N-terminal to C-terminal orientation unless otherwise stated.

[0047] The term "gene" refers to a nucleic acid sequence (DNA) that is transcribed into RNA in vitro or in vivo when operatively linked with appropriate regulatory sequences. Genes may or may not include regions before and after the coding region, such as the 5' untranslated region (5'UTR) or "leader" sequence and the 3'UTR or "tail" sequence, as well as intercalation sequences (introns) between the individual coding segments (exons).

[0048] When used with a numerical value, the term “about” or “approximately” may refer to the value or the expression that states the value and cover a range of ±1%, ±2%, ±3%, ±4%, ±5%, ±6%, ±7%, ±8%, ±9%, ±10%, ±1-5%, ±2-7%, ±3-8%, ±4-9%, or ±5-10%.

[0049] The singular forms “a,” “an,” and “the” include plural referents unless the context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. Although methods and materials similar to or equivalent to those described herein may be used in practice or testing of this disclosure, suitable methods and materials are described below. “As” is used herein to indicate a non-limiting example. Therefore, “as” is synonymous with the term “for example.”

[0050] Other terms will be defined in the description of the various aspects and implementations of the technology described herein.

[0051] According to this disclosure, conventional molecular biology, microbiology, biochemistry, and recombinant DNA techniques in the art can be employed. Such techniques are well explained in the literature. Embodiments of this disclosure are further described in the following examples, which do not limit the scope of the methods and material compositions described in the claims.

[0052] In one aspect of this technology, the technology described herein relates to pharmaceutical compositions comprising activated CAR-T cells as described herein and optionally pharmaceutically acceptable carriers. The active ingredient of the pharmaceutical composition comprises at least the activated CAR-T cells as described herein. In some embodiments, the active ingredient of the pharmaceutical composition consists substantially of the activated CAR-T cells as described herein. Pharmaceutically acceptable carriers for cell-based therapeutic formulations include physiological saline and aqueous buffer solutions, Ringer's solution, and serum components such as serum albumin, HDL, and LDL. Terms such as "excipient," "carrier," "pharmaceuticalally acceptable carrier," and "pharmaceuticalally acceptable excipient" are used interchangeably herein.

[0053] In some respects, this disclosure describes chimeric antigen receptor (CAR)-T cells containing loss-of-function mutations in the cyclin-dependent kinase inhibitor 1B (CDKN1B) gene.

[0054] Chimeric antigen receptors (CARs)

[0055] As used herein, the terms "chimeric antigen receptor," "CAR," or "CARs" refer to engineered T-cell receptors that specifically transplant ligands or antigens onto immune cells. In some embodiments, the immune cells are T cells (e.g., naive T cells, central memory T cells, effector memory T cells, or combinations thereof). CARs are also known as artificial T-cell receptors, chimeric T-cell receptors, or chimeric immune receptors.

[0056] CARs place an antigen-binding domain that specifically binds to a target (e.g., a polypeptide expressed on the cell surface to be targeted to elicit a T-cell response) onto a construct comprising a transmembrane domain and an intracellular domain of a T-cell receptor molecule. In some embodiments, the antigen-binding domain includes an antigen domain of an antibody that specifically binds to an antigen expressed on the cell surface to elicit a T-cell response. In some embodiments, the antigen-binding domain includes a ligand that specifically binds to an antigen expressed on the cell surface to elicit a T-cell response.

[0057] As used in this article, "CAR-T cells" or "CAR-T" refers to T cells that express CAR. When expressed in T cells, CAR has the ability to redirect T cell specificity and responsiveness to selected targets in a non-MHC-restricted manner, utilizing the antigen-binding properties of monoclonal antibodies. Non-MHC-restricted antigen recognition allows CAR-expressing T cells to recognize antigens without antigen processing, thereby bypassing the main mechanisms of tumor escape.

[0058] As can be determined by those skilled in the art, the various functionally similar or equivalent components of these CARs may be interchanged or substituted with each other, as well as other similar or functionally equivalent components known in the art or listed herein.

[0059] Any cell surface region can be targeted by CARs. Typically, the target will be a cell surface peptide that is differentially or preferentially expressed on cells to which the target is desired to elicit a T cell response. In some implementations, the antigen-binding domain binds to any one of CD19, CD37, CD70, CD79b, TACI, BCMA, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, or claudin6; binds to any pair of CD19 / CD79b or BCMA / TACI; or the TriPRIL antigen-binding domain, such as in PCT / US2020 / 065733, PCT / US2020 / 036108, and PCT / US2018 / 013. As described in 215, PCT / US2018 / 013213, PCT / US2018 / 027783, PCT / US2018 / 013221, PCT / US2018 / 022974, PCT / US2019 / 042268, PCT / US2019 / 038518, PCT / US2019 / 066357, PCT / US2019 / 013103, PCT / US2019 / 017727, PCT / US2020 / 051018 and / or PCT / US2018 / 013095.

[0060] Antigen-binding domain

[0061] As used herein, the term "antigen-binding domain" refers to a polypeptide found outside the cell sufficient to facilitate binding to a target. The CARs described herein contain antigen-binding domains. Antigen-binding domains specifically bind to their binding partner, i.e., the target. As a non-limiting example, an antigen-binding domain may include the antigen domain of an antibody or a ligand that recognizes and binds to a homologous binding partner protein. In this context, a ligand is a molecule that specifically binds to a portion of a protein and / or receptor. Homologous binding partners of ligands that can be used in the methods and compositions described herein are typically found on the cell surface. Ligand: Homologous partner binding can lead to alterations in the receptor carrying the ligand or activation of physiological responses, such as activation of signaling pathways. In some embodiments, the ligand may be non-natural to the genome. In some embodiments, the ligand has conserved functions in at least two species.

[0062] Any cell surface region can be targeted by a CAR (e.g., the antigen-binding domain of a CAR). In some implementations, the target will be a cell surface peptide that is differentially or preferentially expressed on cells to which it is desired to target to elicit a T cell response. To target Tregs, antibodies can target proteins such as glycoprotein A repeat dominant protein (GARP), latent-related peptide (LAP), CD25, CTLA-4, ICOS, TNFR2, GITR, OX40, 4-1BB, and LAG-3.

[0063] In some embodiments, the CAR encodes an antigen-binding domain that binds to any one of CD19, CD79b, TACI, BCMA, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, and claudin6, or any pair of CD19 / CD79b, BCMA / TACI, or the TriPRIL antigen-binding domain.

[0064] In some embodiments, the CAR includes an antigen-binding domain that binds to BCMA. In some embodiments, the mesothelin CAR includes a polynucleotide encoding an antigen-binding domain that contains a mesothelin antibody (e.g., scFv). In some embodiments, the BCMA scFv includes SEQ ID NO:5, or a variant thereof with a mutation in its frame region.

[0065] Hinges and transmembrane domains

[0066] In some embodiments, the CAR peptide further comprises a transmembrane domain or hinge / transmembrane domain that links the antigen-binding domain to an intracellular signaling domain. In some embodiments, the binding domain of the CAR is followed by one or more "hinge domains" that function in positioning the antigen-binding domain away from the effector cell surface to enable proper cell / cell contact, antigen binding (via the antigen-binding domain), and activation. The CAR may include one or more hinge domains between the binding domain and the transmembrane domain (TM). The hinge domain may be derived from natural, synthetic, semi-synthetic, or recombinant sources. The hinge domain may include the amino acid sequence of a naturally occurring immunoglobulin hinge region or an altered amino acid sequence of an immunoglobulin hinge region. Exemplary hinge domains applicable in the CAR described herein include hinge regions derived from the extracellular regions of type I membrane proteins, such as CD8 (e.g., CD8α), CD4, CD28, 4-1BB, and CD7, which may be wild-type hinge regions from these molecules or may be altered hinge regions. In some embodiments, the CAR comprises a polynucleotide encoding a CD8α hinge / transmembrane domain. In some implementations, the CAR contains a polynucleotide encoding a 41BB intracellular domain.

[0067] In some embodiments, the hinge region is derived from the hinge region of an immunoglobulin-like protein (e.g., IgA, IgD, IgE, IgG, or IgM), CD28, or CD8. In some embodiments, the hinge domain includes the CD8a hinge region.

[0068] As used herein, a “transmembrane domain” (TM domain) refers to the portion of a CAR that fuses the extracellular binding portion (in some embodiments via a hinge domain) to the intracellular portion (e.g., a co-stimulatory domain and an intracellular signaling domain) and anchors the CAR to the plasma membrane of immune effector cells. The transmembrane domain is typically a hydrophobic region of the CAR that crosses the cell's plasma membrane. The TM domain can be a transmembrane region or fragment of a transmembrane protein (e.g., type I transmembrane protein or other transmembrane proteins), an artificial hydrophobic sequence, or a combination thereof. While specific examples and uses are provided herein, other transmembrane domains will be apparent to those skilled in the art and can be used in conjunction with alternative embodiments of the present technology. The selected transmembrane region or fragment thereof preferably does not interfere with the intended function of the CAR.

[0069] When used in connection with the transmembrane domains of proteins or peptides, "fraction of" refers to the portion of the transmembrane domain sufficient to anchor or attach the protein to the cell surface.

[0070] In some embodiments, the transmembrane domains or fragments thereof of the CAR described herein include transmembrane domains selected from: α, β or ζ chains of T cell receptors, CD2, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278), 4-1BB (CD137), 4-1BBL, GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRFI), CD160, CD19, IL2Rβ, IL2Rγ, IL7Rα, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d , ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Lyl08), SLAM Transmembrane domains of (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​PAG / Cbp, NKp44, NKp30, NKp46, NKG2D and / or NKG2C.

[0071] As used herein, “hinge / transmembrane domain” refers to a domain that contains both a hinge domain and a transmembrane domain. For example, a hinge / transmembrane domain may be derived from the hinge / transmembrane domain of CD8, CD28, CD7, or 4-1BB. In some embodiments, the hinge / transmembrane domain is a CD2 hinge / transmembrane domain. In some embodiments, the hinge / transmembrane domain of a CAR or a fragment thereof is derived from or includes the hinge / transmembrane domain of CD8 (e.g., SEQ ID NO:49), or a variant thereof. CD8 is an antigen preferentially found on the surface of cytotoxic T lymphocytes. CD8 mediates cell-cell interactions within the immune system and acts as a T cell co-receptor. CD8 consists of an α chain (CD8α or CD8a) and a β chain (CD813 or CD8b). The CD8a sequence is known for many species, such as human CD8a (NCBI Gene ID: 925), peptides (e.g., NCBI Ref Seq NP 001139345.1), and mRNA (e.g., NCBI Ref Seq NM_000002.12). CD8 can refer to human CD8, including its naturally occurring variants, molecules, and alleles. In some embodiments of any aspect, such as in veterinary applications, CD8 can refer to CD8 in animals such as dogs, cats, cattle, horses, and pigs.

[0072] For these species, those skilled in the art can easily identify human CD8 homologs and / or orthologs, for example, by using the NCBI ortholog search function or by searching for sequences similar to a reference CD8 sequence in the available sequence data for a given species.

[0073] In some embodiments, the CD8 hinge and transmembrane sequence correspond to the amino acid sequence of SEQ ID NO:49; or include sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity with the sequence of SEQ ID NO:49.

[0074] co-stimulatory domain

[0075] Each CAR described herein optionally includes an intracellular domain of one or more co-stimulatory molecules or co-stimulatory domains. As used herein, the term "co-stimulatory domain" refers to an intracellular signaling domain of a co-stimulatory molecule. A co-stimulatory molecule is a cell surface molecule other than an antigen receptor or Fe receptor that provides a second signal required for the effective activation and function of T lymphocytes upon binding to an antigen. A co-stimulatory domain may be, for example, a co-stimulatory domain of 4-1BB, CD27, CD28, or OX40. In one instance, an intracellular domain (ICD) of 4-1BB may be used (see, below and SEQ ID NO:53, or a variant thereof). Other illustrative examples of such co-stimulatory molecules include CARD11, CD2, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (OX40), CD137 (4-1BB), CD150 (SLAMF1), CD152 (CTLA4), CD223 (LAG3), CD270 (HVEM), CD273 (PD-L2), CD274 (PD-L1), CD278 (ICOS), DAP10, LAT, NKD2C SLP76, TRIM, and ZAP70. In some embodiments, the intracellular domain is the intracellular domain of 4-1BB. 4-1BB (CD137; TNFRS9) is an activation-induced co-stimulatory molecule and an important regulator of the immune response.

[0076] 4-1BB is a membrane receptor protein, also known as CD137, and is a member of the tumor necrosis factor (TNF) receptor superfamily. 4-1BB is expressed on activated T lymphocytes. The 4-1BB sequence is known for many species, such as human 4-1BB, also known as TNFRSF9 (NCBI Gene 25 ID: 3604) and its mRNA (NCBI reference sequence: NM_001561.5). 4-1BB can refer to human 4-1BB, including its naturally occurring variants, molecules, and alleles. In some embodiments of any aspect, such as in veterinary applications, 4-1BB can refer to 4-1BB in animals such as dogs, cats, cattle, horses, pigs, etc. For these species, those skilled in the art can readily identify homologs and / or orthologs of human 4-1BB, e.g., using the NCBI ortholog search function or searching for sequences similar to a reference 4-1BB sequence in the available sequence data for a given species. In some embodiments, CAR-T cells contain a 4-1BB co-stimulatory domain.

[0077] Intracellular signal transduction domains

[0078] The properties of the intracellular signal transduction domains of CARs can vary as are known in the art and disclosed herein, but the chimeric target / antigen binding domains make the receptor sensitive to signal transduction activation when the chimeric target / antigen binding domains bind to the target / antigen on the surface of the target cell.

[0079] Regarding intracellular signal transduction domains, so-called "first-generation" CARs include those that provide only CD3-ζ signaling after the antigen-binding domain binds to the antigen. So-called "second-generation" CARs include those that simultaneously provide a co-stimulatory domain (such as CD28 or CD137) and an activation domain (CD3ζ), and so-called "third-generation" CARs include those that provide multiple co-stimulatory domains (such as CD28 or CD137) and an activation domain (CD3ζ). In various implementations, CARs are selected to have high affinity or affinity for the target / antigen—for example, antibody-derived target or antigen-binding domains typically have higher affinity and / or affinity for the target antigen than naturally occurring T cell receptors. This characteristic, combined with the high specificity that can be selected for antibodies, allows CAR-T cells to target T cells with high specificity.

[0080] The CARs described herein include intracellular signal transduction domains. "Intracellular signal transduction domains" refer to the portions of the CAR polypeptide involved in transducing information about the effective binding of the CAR to target antigens into immune effector cells to elicit effector cell functions, such as activation, cytokine production, proliferation, and cytotoxic activity, including the release of cytotoxic factors into CAR-bound target cells, or other cellular responses triggered by antigen binding to the extracellular CAR domain. In various instances, the intracellular signal transduction domain is derived from CD3-ζ (e.g., see below). Other non-limiting examples of intracellular signal transduction domains containing immune receptor tyrosine-type activation motifs (ITAMs) particularly suitable for this technology include those derived from TCR-ζ, FcR-γ, FcR-β, CD3-γ, CD3-θ, CD3-σ, CD3-η, CD3-ε, CD3-ζ, CD22, CD79a, CD79b, and CD66d.

[0081] CD3 is a T cell co-receptor that promotes T lymphocyte activation when it binds to an appropriate co-stimulus (e.g., the binding of a co-stimulatory molecule). The CD3 complex consists of four distinct chains; mammalian CD3 consists of a CD3-γ chain, a CD3-δ chain, and two CD3-ε chains.

[0082] These chains bind to molecules called T-cell receptors (TCRs) and CD3-ζ, generating activation signals in T lymphocytes. The complete TCR complex includes the TCR, CD3-ζ, and the complete CD3 complex.

[0083] In some embodiments of any aspect, the CAR peptide described herein comprises an intracellular signaling domain containing an immune receptor tyrosine activation motif or ITAM derived from CD3-ζ, including variants of CD3-ζ such as ITAM-mutated CD3-ζ, CD3-η, or CD3-θ. In some embodiments of any aspect, the ITAM comprises the three motifs of the CD3-ζ ITAM (ITAM3). In some embodiments of any aspect, the three motifs of the CD3-ζ ITAM are not mutated and therefore comprise natural or wild-type sequences. In some embodiments, the CD3-ζ sequence comprises the CD3-ζ sequence shown in the sequences provided herein, such as the CD3-ζ sequence of SEQ ID NO:54, or a variant thereof.

[0084] For example, the CAR peptide described herein includes an intracellular signal transduction domain of CD3-ζ. In some embodiments, the CD3-ζ intracellular signal transduction domain corresponds to or includes the amino acid sequence of SEQ ID NO:54; or includes a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity with the sequence of SEQ ID NO:54.

[0085] In some embodiments, the intracellular domain is the intracellular domain of 4-1BB. In some embodiments, the 4-1BB intracellular domain corresponds to an amino acid sequence selected from SEQ ID NO:53; or includes a sequence selected from SEQ ID NO:53; or includes a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity with a sequence selected from SEQ ID NO:53.

[0086] The individual CARs and other construct components described herein can be used together and interchanged in the various constructs described herein, as can be determined by those skilled in the art. Each of these components may include or consist of any corresponding sequence or variant thereof listed herein.

[0087] In some implementations, the CAR contains a polynucleotide encoding the CD3ζ intracellular signal transduction domain.

[0088] More detailed descriptions of CAR and CAR-T cells can be found in Maus et al., Blood 123:2624-2635, 2014; Reardon et al., Neuro-Oncology 16:1441-1458, 2014; Hoyos et al., Haematologica 97:1622, 2012; Byrd et al., J. Clin. Oncol. 32:3039-3047, 2014; Maher et al., CancerRes 69:4559-4562, 2009; and Tamada et al., Clin. Cancer Res. 18:6436-6445, 2012; each of which is incorporated herein by reference in its entirety.

[0089] signal peptide

[0090] In some embodiments, the CAR polypeptide described herein includes a signal peptide. The signal peptide can be derived from any protein having an extracellular domain or being secreted. The CAR polypeptide described herein can include any signal peptide known in the art. In some embodiments, the CAR polypeptide includes a CD8 signal peptide, such as the CD8 signal peptide corresponding to the amino acid sequence of SEQ ID NO:55, or includes an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity with the sequence of SEQ ID NO:55.

[0091] In a further embodiment, the CAR peptide described herein may optionally exclude one of the signal peptides described herein, such as the CD8 signal peptide of SEQ ID NO:55 or the IgK signal peptide of SEQ ID NO:56.

[0092] Connecting substructures

[0093] In some embodiments, the CAR further includes a linker domain. As used herein, a "linker domain" refers to an oligopeptide or polypeptide region of about 2 to 100 amino acids in length that links together any domains / regions of the CAR described herein. In some embodiments, the linker may include or consist of flexible residues such as glycine and serine, allowing adjacent protein domains to move freely relative to each other. The linker sequence may be 2 to 100 amino acids, 5 to 50 amino acids, 10 to 15 amino acids, 15 to 20 amino acids, or 18 to 20 amino acids in length, and includes any suitable linker known in the art. For example, linker sequences may include, but are not limited to, glycine / serine linkers, such as SEQ ID NO:57-60 described in Whitlow et al., Protein Eng. 6(8):989-95, 1993, the contents of which are incorporated herein by reference in their entirety; the linker sequence of SEQ ID NO:61, such as that described in Andris-Widhopf et al., Cold Spring Harb. Protoc. 2011(9), 2011, the contents of which are incorporated herein by reference in their entirety; and linker sequences with additional functionality, such as epitope tags or coding sequences containing Cre-Lox recombination sites, such as that described in Sblattero et al., Nat. Biotechnol. 18(1):75-80, 2000, the contents of which are incorporated herein by reference in their entirety. Longer linkers may be used when it is desirable to ensure that two adjacent domains do not spatially interfere with each other.

[0094] Furthermore, connectors can be cuttable or non-cuttable. Examples of cuttable connectors include 2A connectors (e.g., P2A (SEQ ID NO:62) and T2A (SEQ ID NO:63)), 2A-like connectors, or their functional equivalents and combinations thereof.

[0095] In various instances, linkers having the sequences described herein or variations thereof are used. It should be understood that indicating a particular linker at a specific location in a construct does not mean that the linker can only be used at that location. Rather, different linker sequences (e.g., P2A and T2A) can be interchanged with each other (e.g., in the context of constructs disclosed herein), as can be determined by those skilled in the art. In some embodiments, the linker region is T2A derived from the Thoseea asigna virus. Non-limiting examples of linkers that can be used in this technology include T2A, P2A, E2A, BmCPV2A, and BmlFV2A. Such linkers can be used in the context of multiproteins, such as those described below. For example, they can be used to separate the CAR component of a multiprotein from the therapeutic component of the multiprotein (e.g., antibodies, such as scFv, single-domain antibodies (e.g., camelid antibodies), or bispecific antibodies (e.g., TEAM)) (see below). In some embodiments, the P2A linker sequence comprises the amino acid sequence of SEQ ID NO:62. In some implementations, the T2A linker sequence comprises the amino acid sequence of SEQ ID NO:63.

[0096] Reporter genes

[0097] In some embodiments, the CAR includes a reporter protein. In some embodiments, the reporter protein is selected from the group consisting of truncated CD34 (CD34t), truncated EGFR (tEGFR), truncated CD19 (tCD19), truncated CD20 (tCD20), and truncated Her2 (tHer2). In some embodiments, CD34t includes the amino acid sequence of SEQ ID NO:71.

[0098] Exemplary CAR

[0099] In some embodiments, the CAR includes an antigen-binding domain, a hinge / transmembrane domain, a co-stimulatory domain, and an intracellular signaling domain. In some embodiments, the CAR further includes a reporter protein. In some embodiments, the reporter protein is located at the C-terminus of the CAR, and a linker (e.g., a 2A peptide) is located at the n-terminus of the reporter protein.

[0100] In some embodiments, the CAR is selected from the group consisting of: (1) a CAR that binds to any one of CD19, CD79b, TACI, BCMA, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, and claudin6; (2) a CAR that binds to any pair of CD19 / CD79b and BCMA / TACI; or (3) a TriPRIL antigen-binding domain. In some embodiments, the CAR polypeptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or higher sequence identity with any sequence selected from SEQ ID NO: 6-47. In some embodiments, the CAR polypeptide consists of any amino acid sequence from SEQ ID NO: 6-47. In some embodiments, the CAR polypeptide comprises the amino acid sequence of any one of SEQ ID NO:6-47.

[0101] In some implementations, the CAR is a BCMA-binding CAR. In some implementations, the BCMA-binding CAR is an ABECMA (idecabtagene vicleucel) CAR. In some implementations, the BCMA-binding CAR is a CARVYKTI (ciltacabtagene autoleucel) CAR.

[0102] In some embodiments, the CAR comprises a polynucleotide encoding a CD8 signal peptide, a BCMA scFv, a CD8 hinge / transmembrane domain, a 41BB intracellular domain, and a CD3ζ signaling domain. In some embodiments, the CAR polypeptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or higher sequence identity with a sequence selected from SEQ ID NO: 6 or 36. In some embodiments, the CAR polypeptide comprises the amino acid sequence of SEQ ID NO: 6 or 36.

[0103] CDKN1B loss-of-function mutation

[0104] In some embodiments, the CAR-T cells described herein (e.g., BCMA-binding CAR-T cells) contain a loss-of-function mutation in the CDKN1B gene.

[0105] "CDKN1B loss-of-function mutation" or "loss-of-function mutation in the CDKN1B gene" refers to a mutation that reduces the function of the CDKN1B gene product (cyclin-dependent kinase inhibitor 1B (p27)). Kip1 The CDKN1B gene is mutated, affecting its function or expression. (p27) Kip1 It functions by interacting with different cyclin and cyclin-dependent kinase (CDK) complexes (e.g., by binding to and inhibiting cyclin and CDK complexes), which in turn can inhibit cell cycle progression. p27 Kip1 The regulation of G1 / S transition, G2 / M progression, and cytokinesis is known, for example, as described in Bencivenga et al., Cells 10.9 (2021): 2254. p27 Kip1 It is also known to play a role in other cellular processes, including cell migration, as described, for example, in Cells 10.9 (2021): 2254 by Bencivenga et al. CDKN1B gene function can be measured using p27. Kip1 The activity of cyclin-dependent kinase is inhibited by an assay. In vitro assays using radioactive ATP to measure cyclin-dependent kinase activity are known, for example, as described in Schönthal, Methods Mol Biol. 2004;281:105-24. The CDKN1B gene in the human genome contains approximately 5,000 base pairs, including intronic and exon regions. In some embodiments, the mutation is in the exon region of the CDKN1B gene. In some embodiments, the mutation is in a conserved exon region of the CDKN1B gene. In some embodiments, the mutation is an insertion. In some embodiments, the mutation is a deletion. In some embodiments, the mutation is a frameshift mutation. In some embodiments, the mutation is an insertion or deletion resulting in a frameshift mutation in the exon region of the CDKN1B gene. In some embodiments, the mutation is an insertion or deletion resulting in a frameshift mutation in a conserved exon region of the CDKN1B gene. In some embodiments, the loss-of-function mutation in CDKN1B is an insertion or deletion in exon 1 of the CDKN1B gene (e.g., exon 1 of the human CDKN1B gene). In some embodiments, the loss-of-function mutation in CDKN1B is an insertion or deletion in the polynucleotide sequence encoding exon 3 or 4 of the CDKN1B gene.

[0106] In some embodiments, the mutation introduces an early stop codon into the mRNA transcript transcribed from the CDKN1B gene. In some embodiments, the mutation results in p27. Kip1Protein truncation. In some embodiments, the mutation results in truncation of the CDKN1B gene. In some embodiments, the mutation results in truncation of the CDKN1B gene transcript.

[0107] In some implementations, the CDKN1B loss-of-function mutation is a CRISPR gene-editing induced mutation. For example, a CDKN1B loss-of-function mutation can be induced using the Cas9 protein and a guide RNA complementary to CDKN1B, as described herein. It is known in the art that most CRISPR / Cas9-induced mutations are insertions or deletions, for example, as described by Allen F et al., Nature Biotechnology 37.1 (2019):64-72.

[0108] In some implementations, mutations in the CDKN1B gene cause p27 Kip1 The protein's function is reduced by at least 10% (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5%) compared to unmutated CDKN1B. In some embodiments, mutations in the CDKN1B gene cause p27 to... Kip1 The protein's function was reduced by 100% compared to the unmutated CDKN1B.

[0109] In some implementations, mutations in the CDKN1B gene affect the CDKN1B transcript and / or p27. Kip1 The expression of the protein (e.g., in T cells) is reduced by at least 10% (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 99.5%) compared to unmutated CDKN1B. In some embodiments, mutations in the CDKN1B gene reduce the expression of the CDKN1B transcript and / or p27. Kip1 The expression of proteins (e.g., in T cells) was reduced by 100% compared to unmutated CDKN1B.

[0110] In some embodiments, the CDKN1B gene is a mammalian CDKN1B gene. In some embodiments, the gene is a human CDKN1B gene (e.g., NCBI GCF_000001405.40). In some embodiments, the gene is a mouse CDKN1B gene. In some embodiments, the CDKN1B gene is an endogenous CDKN1B gene from CAR-T cells.

[0111] CRISPR

[0112] In some respects, this disclosure describes CAR-T cells comprising the CAR described herein and CRISPR guide RNA comprising a homologous region complementary to the CDKN1B gene.

[0113] As used herein, the terms “clustered regularly spaced short palindromic repeats” or “CRISPR” can refer to a gene editing system comprising a guide RNA component and a CRISPR-associated (Cas) protein component. The guide RNA polynucleotide may contain a homologous region complementary to the target gene and a stem-loop region capable of binding the Cas protein. The Cas protein may contain a guide RNA binding site and nuclease activity. The Cas protein and guide RNA (gRNA) can form a complex that binds to the target gene (based on the homologous region) and cleaves DNA (utilizing the nuclease activity of the Cas protein). In some embodiments, the Cas protein guide RNA complex binds to a sequence adjacent to and downstream of the pre-intermediate adjacent motif (PAM). Cleavage results in a DNA strand break, and repairing this break can introduce a mutation (e.g., single nucleotide polymorphism, insertion, or deletion). In some embodiments, the Cas protein is any suitable Cas protein used for mutation and / or alteration of target gene expression (the Cas protein may also be referred to herein as a CRISPR protein). In some embodiments, the Cas protein is selected from the group consisting of Cas9, Cas12, or Cas13 proteins. Those skilled in the art will understand that Cas proteins (such as Cas9) can have many different orthologs (such as SpyoCas9, spCas9, spyCas9, and geoCas9). In some embodiments, the Cas protein is SpyoCas9. Cas proteins and their orthologs are well known in the art, as discussed in Gasinas, Giedrius et al., Nature communications 11.1 (2020): 1-10 and Fancheng Y et al., Cell Biology and Toxicology 35.6 (2019): 489-492, each of which is incorporated herein by reference in its entirety. Methods for designing guide RNAs (e.g., selecting homologous sequences to target specific genes) are also well known in the art, as described in Liu, Guanqing L. et al., Computational and Structural Biotechnology Journal 18 (2020): 35-44, which is incorporated herein by reference in its entirety.In some implementations, the gRNA (encoded by gRNA polynucleotides) is designed using CRISPick (portals.broadinstitute.org / gppx / crispick / public), which behaves as described in Doench et al., Nature Biotechnology, 34(2), 184-191 (2016) and Sanson et al., Nature Communications, 9(1), 5416 (2018), both of which are incorporated herein by reference in their entirety.

[0114] As used herein, the term "guide RNA (gRNA) polynucleotide" refers to a DNA or RNA polynucleotide encoding a guide RNA (gRNA). A guide RNA polynucleotide comprises a sequence that binds to a clustered regularly spaced short palindromic repeat (CRISPR) protein or a CRISPR-associated protein and includes an additional sequence (i.e., a homologous region) complementary to the target polynucleotide. For example, a guide RNA polynucleotide may be a Cas9 protein guide RNA polynucleotide or a Cas12 protein guide RNA polynucleotide. Cas9 protein guide RNA is compatible with the Cas9 CRISPR protein and is well known in the art, for example, as described in Adli et al., Nature communications 9.1 (2018): 1-13, which is incorporated herein by reference in its entirety. Cas12 protein guide RNA polynucleotide is compatible with the Cas12 CRISPR protein and is well known in the art, as described in Zetsche et al., Cell 163.3 (2015): 759-771, which is incorporated herein by reference in its entirety. In some embodiments, the guide RNA polynucleotide is a base editor guide RNA polynucleotide. In some embodiments, the gRNA is a primeediting guide RNA polynucleotide. In some embodiments, the guide RNA polynucleotide encodes a homologous region (e.g., a spacer region) and a region that binds a CRISPR protein (e.g., a direct repeat sequence). In some embodiments, the guide RNA polynucleotide is a single guide RNA polynucleotide containing both a homologous region and a region that binds a CRISPR protein.

[0115] In some embodiments, the homologous region comprises a continuous sequence of about 10-30 or about 15-25 nucleotides. In some embodiments, the homologous region comprises about 20 nucleotides. In some embodiments, the homologous region is complementary to a target gene (e.g., a gene related to immune cell function). In some embodiments, gRNAs are designed using an algorithm (e.g., CRISPick). CRISPick is described in Kim et al., Nat Biotechnology 36, 239–241 (2018); Doench et al., Nature Biotechnology, 34(2), 184–191 (2016); and Sanson et al., Nature Communications, 9(1), 5416 (2018), each of which is incorporated herein by reference in its entirety.

[0116] In some implementations, gRNA polynucleotides exhibit minimal or no cross-reactivity. Cross-reactive gRNA polynucleotides are guide RNA polynucleotides containing homologous regions sufficiently complementary to more than one target polynucleotide (e.g., a gene sequence), allowing the gRNA to induce CRISPR mutations in more than one target polynucleotide. Algorithms can be designed to guide RNA polynucleotide design to reduce the likelihood of cross-reactivity (e.g., the on-target activity of gRNA can be scored using rule set 3 (RS3) containing sequence and target information, as well as Chen 2013 tracr (Chen, Baohui, et al. Cell 155.7 (2013): 1479-1491). Off-target activity of gRNA can also be scored using a Tier-agnostic 1 mismatch aggregated cutting frequency determination (CFD) score). Those skilled in the art will understand that gRNA polynucleotides designed using such algorithms may still exhibit some degree of cross-reactivity, but the risk of cross-reactivity is expected to be reduced or can be specified in the algorithm at a selected threshold. In some embodiments, cross-reactivity is a function of complementarity. In some embodiments, the non-cross-reactive gRNA polynucleotide does not have greater than 80% complementarity with more than one gene. In some embodiments, the non-cross-reactive gRNA polynucleotide does not have greater than 85% complementarity with more than one gene. In some embodiments, the non-cross-reactive gRNA polynucleotide does not have greater than 90% complementarity with more than one gene. In some embodiments, the non-cross-reactive gRNA polynucleotide does not have greater than 95% complementarity with more than one gene.

[0117] As used herein, the term "complementary" refers to the degree of Watson-Crick base pairing between two polynucleotides. For example, if 9 / 10 nucleotides of each polynucleotide form Watson-Crick base pairs, the two polynucleotides can be 90% complementary. In some embodiments, complementarity may mean that at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of the nucleotides in the first polynucleotide are Watson-Crick base paired with the second polynucleotide. In some embodiments, the homologous region of the gRNA is complementary to the gene sequence when it is capable of hybridizing with the gene sequence and at least a threshold percentage (e.g., at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of its nucleotides form Watson-Crick base pairs with the gene sequence. In some embodiments, the homologous region is complementary to the gene sequence when it is capable of hybridizing with the gene sequence and initiating CRISPR protein cleavage of the gene sequence and at least a threshold percentage (e.g., at least 70% (e.g., at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of its nucleotides form Watson-Crick base pairs with the gene sequence. Complementary to the gene sequence. In some embodiments, the homologous region is complementary to the target gene sequence (e.g., the CDKN1B gene sequence) when the nucleotides of the homologous region are 100% complementary to a consecutive portion of the target gene sequence (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of the target gene sequence, e.g., 20 consecutive nucleotides). In some embodiments, the homologous region is complementary to the sense strand of the target gene sequence. In some embodiments, the homologous region is complementary to the antisense strand of the target gene sequence. In some embodiments, it is complementary to the sequence (e.g., SEQ ID NO). The homologous region complementary to the gene encoded by SEQ ID NO:72 can refer to a homologous region complementary to the sense strand of the gene sequence (e.g., SEQ ID NO:72) or the antisense strand of the gene sequence (e.g., the reverse complementary sequence of SEQ ID NO:72). For example, the homologous region described herein can be complementary to the sense strand of CDKN1B (e.g., SEQ ID NO:71) or the reverse complementary sequence of SEQ ID NO:71 (i.e., the antisense strand).

[0118] In some embodiments, the homologous region is complementary to a region in the target gene sequence adjacent to the pre-intermediate neighbor motif (PAM). In some embodiments, the homologous region is complementary to a region in the target gene sequence located downstream of and adjacent to the pre-intermediate neighbor motif (PAM).

[0119] In some embodiments, this disclosure describes CAR-T cells comprising a first polynucleotide encoding the CAR described herein (e.g., a BCMA-binding CAR) and a second polynucleotide encoding a CRISPR guide RNA polynucleotide containing a homologous region complementary to CDKN1B.

[0120] In some embodiments, this disclosure describes CAR-T cells comprising a single polynucleotide encoding a CAR as described herein (e.g., a BCMA-binding CAR) and a CRISPR guide RNA polynucleotide containing a homologous region complementary to CDKN1B.

[0121] In some embodiments, this disclosure describes CAR-T cells comprising an ABECMA (idecabtagene vicleucel) CAR and encoding a CRISPR guide RNA polynucleotide containing a homologous region complementary to CDKN1B.

[0122] In some embodiments, this disclosure describes CAR-T cells comprising a CARVYKTI (ciltacabtagene autoleucel) CAR and encoding a CRISPR guide RNA polynucleotide containing a homologous region complementary to CDKN1B.

[0123] In some embodiments, this disclosure describes CAR-T cells comprising ABECMA (idecabtagene vicleucel) CAR and CDKN1B insertion or deletion mutations.

[0124] In some embodiments, this disclosure describes CAR-T cells comprising CARVYKTI (ciltacabtagene autoleucel) CAR and CDKN1B insertion or deletion mutations.

[0125] In some embodiments, this disclosure describes CAR-T cells comprising a BCMA-binding CAR encoding SEQ ID NO:6 or 36 and a single polynucleotide encoding a CRISPR guide RNA polynucleotide containing a homologous region of any one of SEQ ID NO:1-2 or 65-70.

[0126] In some embodiments, this disclosure describes CAR-T cells comprising a single polynucleotide encoding a BCMA-binding CAR that encodes SEQ ID NO:6 or 36 and a CRISPR guide RNA polynucleotide that encodes a homologous region comprising any one of SEQ ID NO:1-2.

[0127] In some embodiments, CAR-T cells further comprise a CRISPR protein (e.g., Cas9 protein). In some embodiments, CAR-T cells comprise a CDKN1B insertion or deletion mutation.

[0128] Table 1: Sequences

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148] Treatment

[0149] In some aspects, this disclosure describes a method of treating a subject with BCMA-expressing cancer, the method comprising administering to the subject CAR-T cells containing a BCMA-binding CAR and a loss-of-function mutation in the CDKN1B gene (e.g., as described herein). In some embodiments, this disclosure describes a method of treating a subject with multiple myeloma, the method comprising administering to the subject CAR-T cells containing a BCMA-binding CAR and a loss-of-function mutation in the CDKN1B gene (e.g., as described herein). In some embodiments, the CAR is a CARVYKTI (ciltacabtagene autoleucel) CAR. In some embodiments, the CAR is an ABECMA (idecabtagene vicleucel) CAR. In some embodiments, the CAR contains the sequence of any one of SEQ ID NO: 6 or 36. In some embodiments, the CAR contains the sequence of SEQ ID NO: 6. In some embodiments, the CAR-T cells contain a guide RNA polynucleotide complementary to CDKN1B. In some embodiments, the CAR-T cells contain a guide RNA polynucleotide containing a homologous region of any one of SEQ ID NO: 1-2 or 65-70. In some embodiments, CAR-T cells contain a guide RNA polynucleotide containing a homologous region of SEQ ID NO:1 or 2. In some embodiments, CAR-T cells contain a CRISPR protein (e.g., Cas9 protein).

[0150] cancer

[0151] As used herein, “cancer” can refer to the excessive proliferation of cells, characterized by a loss of normal cellular control—leading to unregulated growth, lack of differentiation, localized tissue invasion, and metastasis. BCMA-expressing cancers express BCMA. BCMA expression can be determined by detecting BCMA on the cell surface of cancer cells or by detecting the expression of BCMA mRNA. For example, anti-BCMA antibodies can be used to detect BCMA expression on the surface of cancer cells, as described in Ndacayisaba, Libere J. et al. International Journal of Molecular Sciences 23.21 (2022): 13427. In some embodiments, BCMA-expressing cancers are multiple myeloma.

[0152] effect

[0153] The efficacy of activated BCMA-binding CAR-T cells in, for example, treating BCMA-expressing cancers or inducing the responses described herein (e.g., reduction of cancer cells) can be determined by an experienced clinician. However, a treatment is considered “effective” if one or more signs or symptoms of the condition described herein change in a beneficial manner, other clinically accepted symptoms improve or even lessen, or the desired response is induced (e.g., at least 10% after treatment according to the methods described herein). Efficacy can be assessed, for example, by measuring biomarkers, indicators, symptoms, duration of the desired response, and / or the incidence of the condition treated according to the methods described herein, or any other suitable measurable parameter.

[0154] Treatment according to the methods described herein can reduce the level of disease markers or symptoms, for example, by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% or more.

[0155] The efficacy can also be measured by the absence of individual deterioration, such as by whether hospitalization or medical intervention (i.e., disease progression is halted) is required. Methods for measuring these indicators are known to those skilled in the art and / or described herein. Treatment includes any treatment of a disease in an individual or animal (some non-limiting examples include humans or animals) and includes: (1) suppressing the disease, such as preventing the worsening of symptoms (e.g., pain or inflammation); or (2) reducing the severity of the disease, such as causing symptom resolution. An “effective amount” for treating a disease means an amount sufficient to result in effective treatment (as defined herein) when administered to a subject in need. The efficacy of a pharmaceutical agent can be determined by assessing bodily indicators of the condition or expected response. Those skilled in the art are fully capable of monitoring the efficacy of administration and / or treatment by measuring any one or any combination of such parameters. The efficacy of a given method can be assessed in animal models of the condition described herein. When using experimental animal models, efficacy is demonstrated when a statistically significant change in a biomarker is observed.

[0156] Subjects

[0157] As used herein, “subject” refers to a human or an animal. Generally, an animal is a vertebrate, such as a primate, rodent, domesticated animal, or hunting animal. Primates include, for example, chimpanzees, cynomolgus monkeys, spider monkeys, and macaques (e.g., rhesus monkeys). Rodents include, for example, mice, rats, marmots, ferrets, rabbits, and hamsters. Domesticated and hunting animals include, for example, cattle, horses, pigs, deer, bison, buffalo, feline species (e.g., domestic cats), canine species (e.g., dogs), foxes, wolves, bird species (e.g., chickens, emus, ostriches), and fish (e.g., trout, catfish, and salmon). In some embodiments, the subject is a mammal, such as a primate, such as a human. The terms “individual,” “patient,” and “subject” are used interchangeably herein. Preferably, the subject is a mammal. Mammals can be humans, non-human primates, mice, rats, dogs, cats, horses, or cattle, but are not limited to these examples. Non-human mammals can be advantageously used as subjects representing animal models of diseases (e.g., cancer). The subjects can be male or female.

[0158] Subjects who are “in need” for treatment of a specific condition can be those who have the condition, have been diagnosed with the condition, or are at risk of developing the condition.

[0159] Pharmaceutical Composition

[0160] As used herein, the term "pharmaceutical composition" refers to a combination of an active agent (e.g., BCMA-binding CAR-T cells containing a loss-of-function mutation of CDKN1B) and a pharmaceutically acceptable carrier (e.g., a carrier commonly used in the pharmaceutical industry).

[0161] The phrase "pharmaceutically acceptable" herein refers to compounds, materials, compositions, and / or dosage forms that, within reasonable medical judgment, are suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, and whose benefits are commensurate with a reasonable risk-benefit ratio. In some embodiments of any aspect, a pharmaceutically acceptable carrier may be a carrier other than water. In some embodiments of any aspect, a pharmaceutically acceptable carrier may be a cream, lotion, gel, liposome, nanoparticle, and / or ointment. In some embodiments of any aspect, a pharmaceutically acceptable carrier may be an artificial or engineered carrier, such as a carrier in which the active ingredient is not found in nature.

[0162] In one aspect of this technology, the technology described herein relates to pharmaceutical compositions comprising activated CAR-T cells as described herein and optionally pharmaceutically acceptable carriers. The active ingredient of the pharmaceutical composition comprises at least the activated CAR-T cells as described herein. In some embodiments, the active ingredient of the pharmaceutical composition consists substantially of the activated CAR-T cells as described herein. Pharmaceutically acceptable carriers for cell-based therapeutic formulations include physiological saline and aqueous buffer solutions, Ringer's solution, and serum components such as serum albumin, HDL, and LDL. Terms such as "excipient," "carrier," "pharmaceuticalally acceptable carrier," and "pharmaceuticalally acceptable excipient" are used interchangeably herein.

[0163] dose

[0164] In some embodiments, the CAR-T cells described herein are administered as a monotherapy, i.e., without simultaneously administering another treatment for the condition to the subject. Pharmaceutical compositions containing the T cells described herein are typically available in 10... 4 Up to 10 9 Administered at a dose of cells per kg body weight. If necessary, the T-cell composition may also be administered multiple times at these doses. Cells can be administered using infusion techniques commonly used in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. Med. 30319:1676, 1988).

[0165] In some cases, activated CAR-T cells need to be administered to the subject, followed by a subsequent blood draw (or apheresis) to activate the T cells as described herein, and then these activated and expanded T cells are reinfused into the patient. This process can be performed multiple times every few weeks. In some cases, T cells can be activated from blood drawn in amounts ranging from 35 10 cc to 400 cc. In other cases, T cells can be activated from blood drawn in amounts of 20 cc, 30 cc, 40 cc, 50 cc, 60 cc, 70 cc, 80 cc, 90 cc, or 100 cc.

[0166] application

[0167] In some embodiments, the methods described herein involve treating subjects with or diagnosed with BCMA-expressing cancers (e.g., multiple myeloma) with T cells containing BCMA combined with CAR and CDKN1B loss-of-function mutations as described herein. Subjects with BCMA-expressing cancers can be identified by a physician using current methods for diagnosing the condition. Tests that can aid in the diagnosis of, for example, BCMA-expressing cancers include, but are not limited to, blood screenings and bone marrow tests, and are known in the art for a given condition. A family history of BCMA-expressing cancers or exposure to risk factors for the condition can also help determine whether a subject is likely to have the condition or to make a diagnosis of the condition.

[0168] The compositions described herein can be administered to subjects who have or have been diagnosed with BCMA-expressing cancer. In some embodiments, the methods described herein include administering an effective amount of the activated BCMA-binding CAR-T cells described herein to a subject with BCMA-expressing cancer to alleviate symptoms of the condition. As used herein, “alleviate symptoms of the condition” means improvement of any condition or symptom associated with the condition. This reduction, measured by any standard technique, is at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99%, or more, compared to an equivalent untreated control. Various methods of administering the compositions described herein to subjects are known to those skilled in the art. In some embodiments, the compositions described herein are administered systemically or locally. In a preferred embodiment, the compositions described herein are administered intravenously. In another embodiment, the compositions described herein are administered at the tumor site.

[0169] As used herein, the term "effective amount" refers to the amount of activated BCMA-binding CAR-T cells required to alleviate at least one or more symptoms of BCMA-expressing cancers (such as multiple myeloma), and relates to a sufficient amount of cell preparations or compositions to provide the desired effect. Therefore, the term "therapeutic effective amount" refers to the amount of activated BCMA-binding CAR-T cells sufficient to provide a specific anti-disease effect when administered to a typical subject. As used herein, effective amount, in various contexts, also includes amounts sufficient to delay the development of disease symptoms, alter the course of the disease (e.g., but not limited to slowing disease progression), or reverse disease symptoms. Therefore, it is generally not possible to specify an exact "effective amount." However, for any given situation, an appropriate "effective amount" can be determined by those skilled in the art using only routine experimental methods.

[0170] Application method

[0171] Administration of BCMA-binding CAR-T cells containing a loss-of-function mutation in the CDKN1B gene can include, for example, intravenous (iv) injection or infusion. The compositions described herein can be administered to patients intra-arterial, intratumoral, intra-lymph node, intraperitoneal, intrathecal, or intramedullary administration. In some embodiments, the T-cell composition can be injected directly into the tumor, lymph node, or site of infection. In some embodiments, the compositions described herein are administered into body cavities or body fluids (e.g., ascites, pleural fluid, peritoneal fluid, or cerebrospinal fluid).

[0172] In one particular exemplary aspect, a subject may undergo leukocyte ablation, in which leukocytes are collected, enriched, or depleted in vitro to select and / or isolate cells of interest, such as T cells. These T cell isolates may be expanded and processed by contact with an artificial APC (aAPC), such as an aAPC expressing anti-CD28 and anti-CD3 CDR, allowing the introduction of one or more CAR constructs of the present technology to generate CAR-T cells. The T cells may also be contacted with CRISPR gRNA and CRISPR proteins containing a homologous region complementary to CDKN1B (e.g., Cas9 guide RNA and protein). Subjects in need may then undergo standard treatment with high-dose chemotherapy followed by peripheral blood stem cell transplantation. Following or concurrently with the transplantation, the subject may receive an infusion of expanded CAR-T cells. In some embodiments, the expanded cells are administered before or after the procedure. In some embodiments, the subject undergoes lymphocyte depletion prior to the administration of one or more CAR-T cells described herein. In such embodiments, lymphocyte depletion may include administration of one or more of melphalan, cytoxan, cyclophosphamide, and fludarabine. The dosage of the above treatments administered to patients will vary depending on the exact nature of the condition being treated and the recipient of treatment. Adjustments to the dosage for human administration may be made in accordance with recognized practices in the field.

[0173] In some implementations, a single treatment regimen is required. In other implementations, one or more subsequent doses or treatment regimens may be administered. For example, after three months of treatment every two weeks, treatment may be repeated monthly for six months, a year, or longer. In some implementations, no further treatment is administered after the initial treatment.

[0174] Example

[0175] Example 1. In vivo and in vitro efficacy of B-cell maturation antigen (BCMA)-guided chimeric antigen receptor (CAR).

[0176] background

[0177] Engineering T cells to express chimeric antigen receptors (CARs) targeting specific cancer antigens (CAR-T cells) has shown promise in some cancer treatments, but success is not always guaranteed. Even in cases where CAR-T cell therapy initially showed promise, tumor regeneration and patient relapse are frequently observed, for example, in patients with multiple myeloma due to the lack of persistence of CAR-T cells. Tumor resistance mechanisms, such as antigen escape, the complex tumor microenvironment (TME), and the endogenous expression of genes in CAR-T cells that inhibit their proliferation or cytotoxicity, all pose obstacles to the long-term survival and function of CAR-T cells in anticancer therapy.

[0178] The mechanisms regulating CAR-T cell proliferation, survival, and cytotoxicity are numerous and complex, and they vary depending on the context. This article presents CAR-T cells expressing a CAR targeting B-cell maturation antigen (BCMA), a protein expressed on the surface of multiple myeloma cells. BCMA is engineered to have loss-of-function mutations in genes regulating cell proliferation, survival, and / or cytotoxicity, such as cyclin-dependent kinase inhibitor 1B (CDKN1B), non-receptor protein tyrosine phosphatase 2 (PTPN2), RAS p21 protein activator 2 (RASA2), differentiation cluster 160 (CD160), and interleukin-2 receptor α (IL2RA). These different gene knockouts were screened in vivo to measure their effects on T cell proliferation. Further screening was conducted to determine the in vivo cancer-killing efficacy of gene knockouts that increased T cell proliferation in multiple myeloma cells. The results showed that CDKN1B knockout increased both in vivo persistence and cancer-killing efficacy in multiple myeloma cells.

[0179] method

[0180] CAR-T cell generation

[0181] T cells were activated on day -14 and transduced one day later with a BCMA CAR and guide RNA (gRNA) library containing guide RNAs targeting 135 genes believed to be related to T cell function (see PCT / US2023 / 067350). On day -7, Cas9 mRNA was introduced into T cells via electroporation. Two days later, CAR-T cells were purified by negative selection, and transduction efficiency was measured one day after selection. Control CAR-T cells and gene knockout CAR-T cells (“knockout CAR-T cells”) were used either in vitro or injected into mice to assess in vivo persistence and antitumor efficacy, and the remaining CAR-T cells were cryopreserved for pre- and post-injection comparisons. Figure 1 ).

[0182] In vitro assay

[0183] During in vitro (day -11 to day 0); Figure 1 In vitro assays were performed. CAR-T cell persistence was measured after culturing in IL-2 or IL-7 and IL-15 from day -14 to day 0. Figure 2A ), and analyzed the expansion and phenotype of CAR-T cells after purification. Figures 3A-3C Control and knockout CAR-T cells were co-cultured with cancer cells, and their tumor-killing efficiency and proliferation in the presence of cancer cells were evaluated. Figures 4A-4B ).

[0184] To assess the functionality of CAR-T cells after prolonged antigen exposure, CAR-T cells and cancer cells were co-cultured at a 1:1 ratio for 72 hours (one round of "stimulation"). Figure 5A At this point, CAR-T cells are counted and re-seeded, with a total of up to 6 rounds of stimulation. Phenotypic analysis and cytotoxicity assessment of CAR-T cells are performed after rounds 2, 4, and 6 of stimulation. Figures 5B-5D ).

[0185] In vivo assay

[0186] On day 0 of the CAR-T cell generation protocol as described above ( Figure 1 ), 2 x 10 6 CAR-T cells were injected and engrafted to 1 x 10⁻⁶ cells by day -21. 6 Immunodeficiency of MM.1s cells (a B lymphocyte lineage) NOD.Cg-Prkdc scidIl2rg tm1Wjl / SzJ (NSG) ® In mice. Femurs, tibias, and vertebrae were collected on day 7 or 14, and blood was collected on day 14 for analysis. In vivo tumor growth was measured using whole-body bioluminescence imaging. Figures 6B-6D ) CAR-T cell persistence was measured in CAR-T cells initially engineered in IL-2 or IL-7 and IL-15 isolated from mice on day 21. Figure 2B ).

[0187] result

[0188] In vitro assay

[0189] BCMA-specific CAR-T cells were generated by transducing T cells with BCMA CAR and guide construct libraries. These cells had genes knocked out that could affect CAR-T cell survival, proliferation, and / or cytotoxicity (“knockout CAR-T cells”). In vitro persistence analysis of the transduced CAR-T cells after culture in IL-2 or IL-7 and IL-15 revealed that RASA2 ko CAR-T cells (…) Figure 2A ) represents the best-performing knockout in vitro. In proliferation assays, RASA2 ko, PTPN2 ko, and CDKN1B ko CAR-T cells expanded better than control CAR-T cells. Figure 3A (above), while CD160 ko CAR-T cells and IL2RA ko CAR-T cells (cultured in IL-7 and IL-15) expanded similarly to control CAR-T cells. The expansion of IL2RA ko CAR-T cells cultured in IL-2 was significantly reduced ( Figure 3A (below).

[0190] Phenotypic analysis of knockout CAR-T cells showed similar percentages of CD4+ and CD8+ T cells, except for PTPN2 koCAR-T cells, which had a higher percentage of CD4+ T cells. Figure 3B Compared to control CAR-T cells, all knockout CAR-T cells had similar percentages of CD4+ and CD8+ T cell subsets (naïve, effector, effector memory, and central memory). Figure 3C ).

[0191] In culture, as measured by tumor growth volume, knockout CAR-T cells exhibit similar tumor-killing efficacy. Figure 4A Furthermore, as measured by CAR-T cell area, CDKN1B ko and PTPN2 ko CAR-T cells showed increased expansion compared to other CAR-T cell populations. Figure 4B ).

[0192] To evaluate the efficacy of knockout CAR-T cells after long-term antigen exposure in vitro, knockout CAR-T cells were co-cultured with MM.1s cancer cells at a 1:1 ratio for 72 hours for one round of stimulation. Figure 5A CAR-T cells were then collected and reseeded, with a total of up to 6 rounds of stimulation. Following the second, fourth, and sixth rounds of stimulation, as measured by tumor area reduction, CDKN1Bko, RASA2ko, and PTPN2ko CAR-T cells demonstrated superior in vitro cytotoxicity compared to all other knockout and control CAR-T cells. Figures 5B-5D This indicates that knocking out these genes in CAR-T cells leads to enhanced cytotoxicity against tumor cells.

[0193] In vivo assay

[0194] Analysis of transduced CAR-T cells cultured in IL-2 or IL-7 and IL-15 revealed that PTPN2 and CDKN1B were the best-performing gene knockouts in in vivo persistence screening. Figure 2B To evaluate the in vivo antitumor efficacy of CAR-T cell knockout, 2 x 10⁻⁶ cells were used. 6 Before knockout or control CAR-T cell therapy, mice were implanted with 1 x 10-1 CAR-T cells. 6 MM.1s cells 21 days ( Figure 6A IL2RA ko CAR-T cells did not confer tumor control, while RASA2 ko, PTPN2, and CD160 ko CAR-T cells exerted the same level of tumor control as control CAR-T cells. Figures 6B-6C CDKN1B ko CAR-T cells showed significantly better anti-tumor efficacy than control CAR-T cells and maintained high efficacy throughout the experiment. Figure 6C In a second experiment, this finding was repeated using CDKN1B ko CAR-T cells from a second donor. Figure 6D ).

[0195] Blood was collected from mice 14 days after infusion of knockout or control CAR-T cells to assess exhaustion phenotype. Flow cytometry analysis of exhaustion markers showed decreased expression of PD-1, LAG3, and Tim-3 on CDKN1B ko and PTPN2 ko CAR-T cells compared to other knockout or control CAR-T cells. Figures 7A-7C ).

[0196] CDKN1B encodes an enzyme inhibitor that controls cell cycle progression by slowing down cell division in the G1 phase. To determine whether the reduced persistence and exhaustion of CDKN1B-knockout CAR-T cells was due to its effect on the cell cycle, CDKN1B knockout and control CAR-T cells were cultured under control conditions or co-cultured with cancer cells expressing K562 BCMA. CDKN1B knockout in CAR-T cells had no effect on any stage of the cell cycle. Figure 8 This indicates that the absence of CDKN1B promotes the cytotoxicity and persistence of CAR-T cells through other mechanisms.

[0197] On day 21, the spinal cords of MM.1S-implanted mice treated with CDKN1Bko or control CAR-T cells were collected, and the presence of CD8+ (cytotoxic) T cells was histologically assessed. Compared with mice treated with control CAR-T cells (… Figure 9ACompared to [previous treatments], CAR-T cell infiltration was significantly increased in the spinal cord of mice treated with CDKN1B ko CAR-T cells. Figure 9B This indicates that CDKN1B koCAR-T cells can migrate to tumor metastasis sites.

[0198] Example 2. In vivo CRISPR screening to identify CDKN1B ablation enhances BCMA-CAR-T cell persistence

[0199] Chimeric antigen receptor (CAR) T cells are highly effective in hematologic malignancies. However, loss of CAR-T cells can lead to relapse in a significant number of patients. These limitations can be overcome by increasing CAR-T cell persistence through targeted gene editing. Here, in vivo loss-of-function (LOF) CRISPR screening was performed on BCMA-targeted CAR-T cells to investigate genes influencing CAR-T cell persistence, function, and efficacy in a multiple myeloma model. The expansion and persistence of CRISPR library-edited T cells were tracked in vitro and subsequently in vivo at early and late time points to monitor the performance of genetically modified CAR-T cells from preparation to survival in tumors. The screening revealed several context-dependent regulators of CAR-T cell expansion and persistence. Ablation of RASA2 and SOCS1 enhanced T cell expansion in vitro, while ablation of PTPN2, ZC3H12A, and RC3H1 promoted robust expansion of CAR-T cells at early time points in vivo. Notably, the cell cycle regulator cyclin-dependent kinase inhibitor 1B (CDKN1B) was identified as the most important factor limiting CAR-T cell persistence at late time points in vivo. CDKN1B ablation increased the proliferation and effector function of BCMA-CAR-T cells in response to antigens, significantly enhancing tumor clearance and overall survival. These effects were most pronounced in a preclinical model of multiple myeloma, suggesting that key regulators of CAR-T cell persistence can vary across cancer types. Therefore, the findings presented in this embodiment reveal the varying effects of gene perturbation on CAR-T cells over time in different selection environments, highlighting CDKN1B as a promising target for generating highly efficient CAR-T cells against multiple myeloma, and emphasizing the importance of in vivo screening as a tool for identifying genes that enhance CAR-T cell function and efficacy.

[0200] introduction

[0201] Chimeric antigen receptor (CAR) T cells have transformed the treatment landscape for hematologic malignancies, including B-cell leukemia, lymphoma, and multiple myeloma. However, currently approved CAR-T cells are not curative for patients with relapsed or refractory multiple myeloma, and most eventually experience disease progression while maintaining target antigen expression. Patients typically exhibit progressive loss of circulating CAR-T cells. Therefore, the results presented in this example can be used to enhance long-term CAR-T efficacy and durability.

[0202] Many genes and signaling pathways are involved in the persistence and efficacy of CAR-T cells. One strategy for identifying gene modifications that enhance CAR-T cell persistence is mixed loss-of-function gene screening using CRISPR-Cas9-mediated genome editing. To date, these types of screenings have been primarily conducted in vitro, where the selection pressure applied to the pool of genetically modified cells consists of single or repeated antigen stimulation, identifying cells that continue to produce cytokines or proliferate. However, in vivo models may impose different selection pressures on CAR-T cell persistence and can better reflect the timelines and conditions occurring in patients.

[0203] Here, an in vivo mixed loss-of-function gene screening method was developed and applied to identify gene perturbations that can improve the expansion and therapeutic efficacy of BCMA-CAR-T cells against multiple myeloma, as well as enhance their function and increase their persistence.

[0204] result

[0205] Longitudinal CRISPR screening in BCMA-CAR-T cells revealed genes influencing in vitro and in vivo expansion and persistence.

[0206] A CRISPR-based CAR-T cell screening platform was developed to discover genes that modify and target the expansion and persistence of human BCMA-CAR-T cells in a mouse xenograft model of human myeloma (MM1.s). To achieve complete in vivo recovery of the screening library, a CRISPR single-guide (sg) RNA library (“Mario” library) targeting 135 genes with known or inferred functions in T cells was designed. Eight sgRNAs target each gene to maximize the statistical confidence of each gene hit. Figure 10A The study included 100 intergenic sgRNAs as controls, with a total library size of 1,080 sgRNAs. The Mario sgRNA delivery vector contained an NGFR reporter gene and a dual sgRNA cassette, with the sgRNA library cloned at position 1 downstream of the human U6 promoter, and the sgRNA targeting the TCRα constant region (TRAC) located at position 2 downstream of the human H1 promoter on the reverse strand. Figure 14AThe absence of TRAC allows for the enrichment of cells that have successfully undergone genome editing via bead-based CD3+ cell depletion (see Methods). The modular approach of using independent Mario sgRNA delivery vectors enables flexible assessment of CAR-negative (CAR-) or target-specific dependence using second lentiviral vectors encoding CARs. Figure 14A Here, an anti-BCMA CAR vector (containing a 4-1BB co-stimulatory domain) was synthesized based on the idecabtagene vicleucel13 and included a truncated CD34 reporter gene as a transduction marker. Figure 14A The timing and dosage of the MM1.s myeloma model were optimized, resulting in comparable antitumor activity in both unedited BCMA-CAR-T cells and edited anti-BCMA Mario CAR-T cells, with relapse initiation 21 days after CAR-T cell metastasis. Figure 14B ).

[0207] Cytokine conditions during the manufacture of ex vivo T cell products have a significant impact on T cell phenotype and proliferation. To understand how in vitro culture conditions can alter the expansion and persistence of different knockout T cells in vitro and in vivo, Mario-CAR-T cells were generated and cultured in either IL-2 or a combination of IL-7 and IL-15, both of which are commonly used in CAR-T cell manufacturing. Figure 10B Healthy human T cells from three normal donors were activated with anti-CD3 / CD28 beads, cultured in designated cytokines throughout the process, and transduced using Mario and CAR lentiviral vectors. Baseline samples of cells were collected 48 hours after lentiviral transduction as a measure of cell library representativeness before genome editing. After an additional 4 days of amplification in cytokines, T cells were electroporated with Cas9 mRNA, cultured for 48 hours to achieve genome editing and reduce surface CD3 after TRAC locus editing, and subsequently enriched by CD3-negative selection. Figure 10B and Figure 14C The efficiency of CRISPR editing in BCMA CAR+ T cells (hereinafter referred to as "Mario-CAR-T cells") was characterized by flow cytometry, and anti-BCMA CAR was found to be expressed in a population of CD3-negative T cells with up to approximately 59% CRISPR editing. Figure 14D CD3-negative enriched T cells were further expanded for 5 days in the presence of cytokines and then transfected into mice carrying BCMA-positive MM1.s myeloma tumors. Cell samples were collected from each donor during T cell infusion into mice to assess the effect of gene deletion on in vitro T cell expansion. Figure 10BTo assess the effects of gene perturbation on in vivo expansion and persistence of CAR-T cells, mice were sacrificed 7 days (“early in vivo”) or 21 days (“late in vivo”) after CAR-T injection, and cells were isolated and enriched from bone marrow using NGFR-positive selection. Figure 10B ).

[0208] Genomic DNA was isolated from collected in vitro and in vivo samples for PCR amplification and sequencing of integrated sgRNAs. Repeated screening was performed using Mario-CAR-T cells from multiple healthy human donors. All screenings showed excellent repeatability and sgRNA recovery, as the gene-targeting and control sgRNAs formed a normal distribution across all time points and donors, indicating that the sgRNA levels in in vivo screening were representative enough for rigorous hitcalling of enriched and depleted genes. Figure 14E-14G Furthermore, sgRNAs enriched and depleted between in vitro and in vivo donors showed a high correlation. Figure 14H ).

[0209] The enrichment and depletion of sgRNA in Mario-CAR-T cells generated by any amplification protocol over time were evaluated in multiple scenarios: 1) 11 days after in vitro culture and cytokine-mediated amplification compared to the original library in unedited cells (“In vitro amplification group vs. baseline”); 2) 7 days in vivo compared to the day of injection (“Early in vivo vs. in vitro amplification”); and 3) 21 days in vivo compared to the day of injection (“Late in vivo vs. in vitro amplification”). Figure 10C and Figure 15A Following in vitro cytokine amplification, a strong depletion of sgRNAs targeting known common essential genes such as DNMT1, PCBP2, and SMARCB1, as well as the key T cell transcriptional regulator IRF4, was observed. A significant enrichment of sgRNA targeting RASA2 was also observed (log fold change (LFC): 2.89; p < 0.0001). Enrichment of SOCS1, a negative regulator of JAK1, was also observed (Liau et al., 2018; Sporri et al., 2001), and uniquely in Mario-CAR-T cells generated via IL-2 amplification, a depletion of sgRNA targeting IL2RA was observed (LFC: -7.23; p < 0.0001), consistent with the in vitro IL-2-driven T cell proliferation requirements. In summary, these in vitro observations demonstrate that sgRNA library delivery and CRISPR editing are robust and can restore known biological properties.

[0210] To understand which gene modifications specifically enhance T cell persistence in vivo, the abundance of sgRNAs at early and late time points in vivo was compared with library representativeness in T cells at injection. Deletion of the common essential genes NDUFB10 and ELOB was observed, leading to strong depletion in both early and late in vivo conditions. Under early in vivo conditions, the most enriched sgRNA targeted PTPN2 (LFC: 2.41; p < 0.0001), a negative regulator of JAK / STAT and TCR signaling. Deletion of the RNA regulatory genes ZC3H12A (REGNASE-1) and RC3H1 (ROQUIN-1), known to play important roles in T cell responses, also resulted in enhanced early T cell proliferation in vivo. Figure 10C Since long-term expansion and persistence are major challenges in the efficacy of CAR-T therapy, we next evaluated the enrichment of late-stage sgRNAs in vivo, and observed that CDKN1B KO T cells were the most abundant compared to cells at injection time (LFC: 3.49; p<0.0001). Significant enrichment of sgRNAs targeting SOCS1 or PTPN2 was also observed at late-stage in vivo time points, suggesting that increased JAK / STAT activation has a long-term beneficial effect, as well as enrichment in cells lacking TGFBR.

[0211] To directly compare the effects of genes throughout the Mario-CAR-T lifecycle, the enrichment of sgRNAs targeting the genes with the highest ranking in the aforementioned comparisons was analyzed side-by-side. It was observed that although sgRNAs targeting RASA2 showed a strong effect on proliferation in vitro, they did not provide any benefit to Mario-CAR-T amplification in vivo. Figure 10D In contrast, sgRNA targeting PTPN2 was enriched at both time points in vivo, although it showed no discriminative effect in vitro, while sgRNA targeting CDKN1B showed moderate enrichment during in vitro amplification, but the enrichment was greatest in vivo after 21 days. Figure 10D Although the depletion of sgRNA varies somewhat depending on the cytokines used during in vitro expansion, particularly IL2RA and DNMT1, the overall depletion and enrichment of sgRNA are largely consistent across manufacturing methods. Figure 2A-2B and Figure 10E Next, by examining the z-score guidance abundance of each cytokine amplification protocol at each time point, the enrichment and depletion patterns of different guidance over time in vitro and in vivo were characterized more comprehensively. Figure 10F and Figure 15BThe loss of IRF4 or STAT3, key mediators of TCR activation in proliferation and differentiation, results in persistently low abundance in vivo during in vitro expansion. Cells lacking IL2RA exhibit reduced survival in vivo, regardless of their differential sensitivity to IL2RA deficiency during in vitro expansion with IL-2 or IL-7 / 15. Figure 10F and Figure 15B Although RASA2 deficiency led to enhanced in vitro proliferation and increased abundance in the pool at injection, these cells exhibited decreased abundance at both in vivo time points. Conversely, regardless of the cytokines used during in vitro expansion, cells lacking PTPN2 or CDKN1B showed a progressively increasing frequency both in vitro and in vivo. Figure 10F and Figure 15B In summary, the screening data revealed that many genes play different roles in regulating CAR-T amplification over time both in vitro and in vivo, and indicated that in vitro models are insufficient to identify genes important for in vivo persistence.

[0212] Perturb-seq identifies features associated with in vivo enhancement persistence.

[0213] To understand how various gene deletions affect the transcriptional status and frequency of T cells 21 days in vivo, genes with the most significant enrichment and depletion (CDKN1B, IL2RA, PTPN2, RASA2, RC3H1, SOCS1, TGFBR2, ZC3H12A, and CD160 as a negative control for gene targeting) were selected from the initial screening and evaluated using perturb-seq. Four sgRNAs targeting each gene and 16 intergene control sgRNAs were designed, for a total library size of 52 sgRNAs. Guide RNAs were cloned into the initial screening vector, which included paired, immobilized TRAC sgRNAs to achieve CD3-negative selection of CRISPR-edited T cells. After transduction with the vector containing the sgRNA library and CAR, engineered T cells were enriched by negative magnetic bead selection and transfected into mice previously engraved with MM1.S myeloma. Figure 11A Twenty-one days later, mice were sacrificed, and modified CAR-T cells were isolated from the bone marrow via NGFR-positive selection for droplet-based scRNA-seq (see Methods). Leiden clustering of 18,680 cells generated 11 cell clusters. Figure 11B Clustering is primarily driven by transcripts associated with lineage, cell cycle, and transcriptional states (including exhaustion, effector, and memory). Figure 11C-11E and Figure 15CTo link single-cell transcriptional status with loss of gene function, the analysis focused on a subset of 4,991 cells, where a single gene perturbation (a pair of essential gene-targeting and TRAC-targeting sgRNAs) was detected in each cell. The distribution of the detected perturbations in each cluster was examined compared to cells containing intergenic control sgRNAs and cells where no sgRNAs were detected (unguided). Figure 11F and Figure 15D Most unguided and intergenic knockout (KO) cells were observed to be present in early effector CD8+, late effector CD8+, and memory-like clusters. Cells lacking PTPN2, RC3H1, and ZC3H12A were enriched in proliferating S-phase effector CD8+ and MKI67+ CD8+ cells. Figure 11F CDKN1B KO T cells were specifically enriched in the MKI67+CD8+ cluster, while TGFBR2 KO cells were specifically enriched in the progenitor cell exhaustion cluster. Figure 11F SOCS1 and RC3H1 KO lead to the enrichment of proliferating CD4+ T cells. Figure 11F Therefore, gene deletions that promote persistence of CAR-T cells in vivo have different effects on the transcriptional profile of CAR-T cells in the tumor microenvironment.

[0214] Gene set enrichment analysis (GSEA) was performed on pseudo-batch mixed knockout cells to examine more deeply the knockout-specific gene signatures distributed across each cluster compared to undisturbed cells. Figure 11G PTPN2 KO cells showed enrichment of IL2 STAT5 signaling and IL6 JAK STAT3 gene signatures, consistent with PTPN2's role as a repressor of JAK-STAT signaling. Cells lacking CDKN1B, PTPN2, RC3H1, SOCS1, or ZC3H12A showed significant enrichment of hallmark G2M checkpoint, E2F target, and mitotic spindle gene sets, suggesting that loss of function of these genes is associated with increased cell proliferation.

[0215] CDKN1B KO CAR-T cells showed higher expansion and reduced exhaustion under in vitro co-culture conditions.

[0216] To better understand which gene perturbations will generate CAR-T cells with favorable in vitro expansion and in vivo persistence, the function of CAR-T cells after single gene deletion was characterized in greater depth. Four genes were selected based on their mixed screening trajectories and transcriptional profiles in vitro and in vivo. PTPN2 and CDKN1B were selected based on their in vivo phenotype, RASA2 was selected based on its strong effect on in vitro expansion, and IL2RA was selected based on its detrimental effect on in vitro expansion in IL-2.

[0217] To simplify T cell production into a single lentiviral vector, a dual guide cassette was cloned into a BCMA CAR vector, including sgRNA targeting selected candidate genes or intergene control sgRNA. Figure 16A The expansion rate of KO CAR-T cell products in culture was measured for each individual. Figure 3A and Figure 12A Compared to intergene control T cells, RASA2 and CDKN1B KO CARs expanded significantly more during in vitro culture, while IL2RA KO CARs expanded significantly less when cultured in IL2. Expansion of IL2RA KO T cells could be rescued by culturing in IL-7 / 15 instead of IL-2. This was confirmed by next-generation sequencing (NGS). Figure 16B The disruption of CDKN1B, PTPN2, and RASA2 genes was confirmed; and the disruption of IL2RA gene was confirmed by flow cytometry. Figure 16C ).

[0218] To investigate whether the KO gene in each individual affects the in vitro CAR-T cell killing ability, luciferase-based killing assays were performed using two luciferase-expressing human myeloma cell lines, MM1.s and RPMI 8226, at different effector-to-target (E:T) ratios; no significant differences were found. Figures 17A-17B In the 5-day cytotoxicity assay of RPMI-8226, there was no difference in cytotoxicity among KO CARs (effect-to-target ratio 1:1, Figure 17C). However, these assays only measured the response to acute antigen exposure. To better mimic the chronic antigen exposure experienced by CAR-T cells in vivo, repeated stimulation assays were performed in which CAR-T cells were stimulated every 72 hours with freshly irradiated K562 cells transduced to express BCMA at a 1:1 E:T ratio. Figure 12B Compared to intergenic KO and IL2RA KO CAR T cells that failed to control tumor cell proliferation after repeated exposure, ablation of CDKN1B, PTPN2, or RASA2 maintained cytotoxicity across multiple rounds of stimulation. Figures 4A-4B , Figures 5B-5D and Figure 12CIn summary, these data suggest that the absence of CDKN1B, PTPN2, or RASA2 enhances T cell cytotoxicity and prevents in vitro T cell dysfunction during repeated antigen exposure.

[0219] CDKN1B KO enhances the in vivo anti-tumor activity and persistence of CAR-T cells.

[0220] After evaluating the in vitro performance of knockout CAR-T cells, they were further characterized in vivo. Mice were treated with PTPN2, CDKN1B, RASA2, IL2RA, or intergenic control BCMA CAR-T cells after implantation into MM1.s multiple myeloma cells. All cells were cultured in IL-2 during preparation. CDKN1B KO-BCMA CAR-T cells resulted in significantly prolonged tumor control. Figures 6B-6D and Figure 13A Mice receiving PTPN2 KO T cells showed a transient improvement in tumor control, but subsequently relapsed, similar to mice given intergenic KO CAR-T cells. Despite enhanced in vitro cytotoxicity, RASA2-deficient CAR-T cells exhibited similar in vivo efficacy to intergenic KO CAR-T cells, with mice relapsing 28 days after CAR-T cell injection. IL2RA KOT cells showed marked lack of tumor control and reduced overall survival.

[0221] Based on the enrichment of CDKN1B KO cells in late-stage mixed screening in vivo and their significant improvement in tumor control, the in vivo function of CDKN1B KO CAR-T cells was further characterized. CDKN1B KO CAR-T cells were also generated from other human donors, which also showed improved in vivo tumor control against MM1.S. Figure 18A In summary, mice receiving CDKN1B KO CAR-T cells from either donor had improved overall survival compared to mice receiving intergenic control KO CAR-T cells. Figure 18B Total bone marrow (femur, tibia, spine) was collected on day 21 post-T cell transfer, and cells were stained with CD8 to quantify T cell abundance in the bone marrow. Mice treated with CDKN1B KO CAR-T cells had more CD8+ cells compared to mice treated with intergenic KO CAR-T cells. Figures 9A-9B and Figure 13B These data suggest that the absence of CDKN1B increases the in vivo expansion and / or persistence of CD8+ CAR-T cells.

[0222] Next, the therapeutic efficacy of CDKN1B KO CAR-T cells was validated using different multiple myeloma xenograft models. Mice were subcutaneously implanted with the RPMI-8226 myeloma cell line and treated with BCMA CAR-T cells 21 days later. CDKN1B KO CAR-T cells exhibited excellent anti-tumor activity and increased survival. Figure 13C ).

[0223] To better understand how CDKN1B deficiency enhances T cell function, bulk RNA-seq was performed on cells isolated from the bone marrow 21 days after CAR-T cell transfer using the MM1.s myeloma model. Figure 13D-13E Differential gene expression analysis identified numerous upregulated cell cycle genes in the CDKN1B KO CAR, including MCM4, MCM2, TOP2A, and PCNA. Key regulators of NFKB and AP1 transcriptional activity, NFKBIA, JUN, and FOS, were expressed at lower levels in the CDKN1B KO CAR. Furthermore, transcription factors ZFP36, NR4A1, and NR4A2 were expressed at lower levels in the CDKN1B KO CAR. GSEA analysis of the signature gene sets showed high enrichment of these genes in CDKN1B KOT cells at the E2F target, G2M checkpoint, mitotic spindle, and MYC target V1, while they were more enriched in the intergene control CAR via NFKB-signaled TNFA signaling. Figure 13F Furthermore, GSEA analysis of differentially expressed genes in effector, memory, and exhausted CD8 T cells revealed that CDKN1B KO T cells exhibited a relative enrichment of effector gene signatures and a relative depletion of memory gene signatures. Figure 13G These data indicate that CDKN1B KO CARs enhance E2F transcriptional activity, leading to increased proliferation. This increased proliferation corresponds to a reduction in CAR-mediated AP1 and NFKB signaling, potentially protecting CDKN1B KO cells from chronic antigen exposure. Cell cycle progression was quantified in vitro using cell-permeable DNA dyes in the presence of BCMA+ tumor cells. Figure 18C Immediately after initial stimulation, almost all CDKN1B KO and intergenic control cells were in the G2 / M phase. At 7 and 14 days, the intergenic control cell population appeared in the G0 / G1 phase, while almost all CDKN1B KO cells remained in the bright G2 / M phase. To determine whether CDKN1B KO T cells exhibited increased apoptosis resistance or underwent malignant transformation, long-term cultures with or without IL2 and with or without antigen stimulation were performed. In the absence of both antigen and IL2, CDKN1B KO CAR-T cells showed higher viability after 1–2 days, but this difference disappeared after 7 days of culture, with over 95% of cells being non-viable. Figure 13H These data indicate that CDKN1B deficiency increases the proliferation and function of BCMA CAR-T cells without conferring any cytokine- or antigen-independent growth. In summary, this embodiment used a novel in vitro-in vivo CAR-T cell screening method to identify key regulators of CAR-T cell proliferation and persistence in vivo. This embodiment also demonstrated the enhanced antitumor effects of CDKN1B KO BCMA CAR-T cells in vivo using multiple human multiple myeloma models.

[0224] discuss

[0225] Current CAR-T cell therapies face both intrinsic and extrinsic tumor resistance mechanisms, severely reducing CAR durability and thus preventing long-term remission. Unlike ablation of only one gene at a time, using mixed loss-of-function gene screening to study the in vitro and in vivo effects of gene libraries on CAR function and durability demonstrates a novel approach to target discovery in cell immunotherapy.

[0226] Genetic perturbations that enhance in vivo expansion and function of CAR-T cells were identified in vivo. The combined in vitro-in vivo screening enabled the identification of targets that specifically alter T cell phenotypes under one condition but not under another. For example, RASA2 deletion resulted in a significant increase in in vitro expansion. However, RASA2 KO T cells scored poorly in in vivo screening and exhibited similar antitumor efficacy to the control CAR. Ablation of PTPN2 showed increased activity early on, consistent with its strong score up to day 7 in in vivo screening, but did not demonstrate increased persistence or enhanced antitumor activity in the tested multiple myeloma models.

[0227] Through in vivo screening, CDKN1B was revealed as a promising target for engineered, persistent in vivo CAR-T cells. Results showed that CDKN1B deletion enhanced CAR-T cell proliferation and promoted the expression of effector genes, leading to prolonged antitumor activity in a human multiple myeloma xenograft model. CDKN1B deletion resulted in upregulation of cell proliferation genes and downregulation of cell cycle inhibitors. Notably, this increased proliferation did not drive cell exhaustion or dysfunction. Compared to control BCMA CAR-T cells, BCMA-guided CAR-T cells with CDKN1B KO exhibited less exhaustion in vitro and had an increased proportion of CD8+ T cells. Increased antitumor activity was also observed in CDKN1B KO CARs even under chronic antigen exposure both in vitro and in vivo. In addition to increased cell cycle activity, CDKN1B KO CAR-T cells also reduced the expression of NFKB transcriptional targets, including other members of the AP1 transcription factor family. Because NFKB and AP1 are directly activated downstream of 4-1BB CARs, rapidly expanding CDKN1B KO CARs undergo less chronic antigen exposure, preventing them from becoming exhausted and dysfunctional. Recent reports have documented T-cell lymphoma following CAR-T cell therapy (one case targeting BCMA, one targeting CD19). Investigating whether CDKN1B knockout leads to T-cell transformation revealed similar growth patterns in CDKN1B KO and intergenic KO CAR-T cells in the absence of cytokines and antigens, with over 95% of cells being non-viable after 7 days. Furthermore, no CDKN1B gene alterations have been observed in published clinical cases to date.

[0228] In summary, the findings of this embodiment demonstrate that CDKN1B ablation increases the functional durability of CAR-T cell therapy in multiple myeloma, which can prolong the duration of long-term remission in patients. Furthermore, the data indicate a key difference between the selective pressures occurring during in vitro antigen stimulation and the chronic antigen exposure and physiological environment in an in vivo human cancer mouse model.

[0229] method

[0230] Research Design

[0231] This study aimed to identify gene deletions that enhance the persistence and function of BCMA-targeting CAR-T cell therapy in myeloma. In vitro and in vivo functional and killing assays were performed to validate targets identified in loss-of-function CRISPR screening. CD19 was also used as a target antigen for further validation in other hematologic malignancies models besides myeloma.

[0232] Anonymous human blood samples were used as the source of T cells, and the study was approved by the Institutional Review Board (IRB) of Massachusetts General Hospital (MGH) and declared a “non-human subject study.” Mice used in in vivo experiments were randomized prior to experiments involving CAR-T cells, and all animal work was performed in accordance with protocols approved by the Institutional Animal Care and Use Committee (IACUC).

[0233] mice and cell lines

[0234] All in vivo experiments were conducted in male and female mice according to protocols approved by the MGH Animal Care and Use Committee. The purchased Jackson Laboratory NOD-SCID-γ chain... − / − (NSG) mice were housed under pathogen-free conditions at the MGH Cancer Research Center. All mice were maintained under a 12:12-hour light-dark cycle, 30–70% humidity, and 21.1–24.5°C. All cell lines (myeloma: MM1.s, RPMI-8226, and U266; mantle cell lymphoma: JeKo-1; acute lymphoblastic leukemia: Nalm6) were obtained from the American Type Culture Collection and maintained according to the conditions outlined by the supplier; cell lines were regularly tested for mycoplasma contamination (all results were negative) and identified by STR profiles within a 3-year cycle. In all experiments, cell lines were transduced to express *C. tectorum* green (CBG) luciferase and enhanced GFP (eGFP), and then sorted on a BD FACSAria II, FACSAriaFusion, or FACSymphony S6 cell sorter to obtain 100% transduced populations.

[0235] Construction of CAR and dual-guide box

[0236] All CAR constructs contain a CD8 hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3ζ signaling domain. Transgenic design was performed using Geneious Prime (version 2022.0.2, 2021), followed by synthesis and cloning into second-generation lentiviral vectors under the control of the human EF-1a promoter. The BCMA (bb2121) CAR-T construct for dual transduction includes a truncated CD34 to assess transduction efficiency. A dual sgRNA cassette utilizing the human U6 and H1 promoters was adapted for T cell selection by adding a fixed TRAC sgRNA and a golden-gate clone-compatible BsmbI site for variable sgRNA introduction.

[0237] The confirmatory CAR-T cell constructs also contain a CD8 hinge and transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3ζ signaling domain, and carry a fluorescent reporter gene, mCherry, to assess transduction efficiency. Furthermore, they share the same dual guide cassette (TRAC sg and guide sg) system. Confirmatory CAR-T cells targeting CD19 were generated using a lentiviral vector encoding a standard CAR construct. This construct additionally carries modifications to the upstream CRISPR / Cas9 guide sequence for use in TRACKO or in combination with the guide that scores highest for CDKN1B in in vivo CRISPR screening.

[0238] Lentiviral and CAR-T cell production

[0239] Replication-deficient lentiviruses were generated by transfecting plasmids into HEK293T cells, which had been amplified in R10 medium (RPMI + Glutamax + HEPES (ThermoFisher Scientific, catalog number 72400047), supplemented with 10% FBS, penicillin, and streptomycin). Supernatants were collected at 24 and 48 hours post-transfection. The filtered virus was then processed by ThermoFisher Scientific Sorvall... TM The product is concentrated using a WX+ ultracentrifuge and then stored at 80°C.

[0240] Human T cells (Stem Cell Technologies, catalog number 15061) were purified from anonymized single samples of healthy human leukocytes purchased from the Massachusetts General Hospital Blood Bank under an institutional review board waiver protocol. T cells were isolated using the Stem Cell Technologies T-cell Rosette Sep Isolation Kit. To generate CAR-T cells, a large number of human T cells were activated on day -14 using CD3 / CD28 Dynabead (ThermoFisher Scientific, catalog number 40203D) cultured in R10 medium at a 1:3 T-cell:bead ratio. For certain conditions, IL-7 (Peprotech, catalog number 200-07) and IL-15 (Peprotech, catalog number 200-15) were used instead of IL-2 according to the following protocol: After Dynabead activation, IL-15 (10 ng / ml) and IL-7 (10 ng / ml) were added, followed by IL-15 twice weekly and IL-7 once weekly during CAR-T cell production. Cells were transduced with CAR lentivirus at a multiplicity of infection (MOI) of 5 on day -13, and the medium was doubled and IL-2 replaced every 2 days for expansion. For BCMA / guide library production, CAR-T cells were transduced sequentially, first with BCMA CAR, then with guide library lentivirus (MOI 5 for both). On day -8, Dynabeads were removed by magnetic separation. On day 2 (day -7), cells were washed 3 times with Opti-MEM. Then, up to 5E6 cells were resuspended in 100 μl of Opti-MEM and treated with 10 μg CleanCap. TM Cas9 mRNA (TriLink, catalog number L-7206) electroporation. On day -5, EasySep was used. TM CD3-negative selection was performed using the Human APC Positive Selection Kit II (StemCell Technologies, catalog number 17661) and the CD3 APC antibody (Biolegend, anti-human clone OKT3, catalog number 317318). CAR-T cell transduction efficiency was assessed on day -4 by tCD34 / APC (BCMACAR / guide library) or mCherry (validation) expression, and cells were stored in liquid nitrogen.

[0241] The production of the BCMA CAR / guide library for CRISPR screening runs used three healthy, normal donors (NDs) (ND216, ND99, and ND106). ND216 and ND106 were used for IL7 / 15 screening. Validation experiments for each gene knockout construct were tested in two additional healthy donor T cells (ND116 and ND202).

[0242] Individually modified BCMA-CAR-T cells were grown in a similar manner, with the following modifications: cells were debeaded on day 7 and washed three times in Opti-MEM. Up to 5E6 cells were then resuspended in 100 μl Opti-MEM and electroporated with 10 μg Cas9 mRNA. Cells were maintained in culture. Untransduced T cells from the corresponding donor were grown simultaneously as a control. The same formulation was used to produce CD19-CARs with intergenic KO and CDKN1B KO.

[0243] Screening and preparation of Mario libraries

[0244] The "Mario" library targets the following 135 genes: ADORA2A, AGO1, AGPS, ARID1A, ARID2, ARIH2, ATF6, BATF3, BCL6, BTLA, CABP4, CBLB, CD160, CD2, CD244, CD5, CD69, CDKN1B, CPT1B, CRELD1, CTBS, CTLA4, CXCR3, CYB5R4, DGKA, DGKZ, DLAT, DNMT1, DNMT3A, DNMT3B, DUSP4, EED, EL OB, ENTPD1, ​​EOMES, EPAS1, ERG, ETS1, EZH2, FIBP, FLI1, FLT1, FOXP3, FUBP1, GATA3, GGH, GLRX, GNA13, HAVCR2, HIF1A, ID2, IF NAR1, IFNAR2, IFNG, IFNGR1, IFNGR2, IKZF1, IKZF2, IL10RA, IL10RB, IL13, IL18R1, IL1A, IL2RA, IREB2, IRF2, IRF4, ITK, JUN B. KDM1A, KDR, KLRB1, KLRC1, KLRD1, LAG3, LCP2, LEF1, LTA, MEF2D, MOCS3, NDUFB10, NFATC1, NFATC2, NR4A1, NR4A2, NR4A3, N T5E, PBRM1, PCBP2, PDCD1, PDCL, PDHA1, PDHB, PEX13, PRDM1, PRDM15, PTPN2, RARA, RARB, RARG, RASA2, RC3H1, RCOR1, RNF145, The gene sequences included RPRD1B, RUNX1, RUNX3, SETDB1, SFRP1, SMAD2, SMARCA4, SMARCB1, SOCS1, STAT3, STAT6, TASOR, TBL1XR1, TCF7, TET2, TGFBR1, TGFBR2, TIGIT, TMEM222, TNFAIP3, TNFAIP8, TNFRSF18, TNFRSF9, TNIP1, TOX, UBASH3A, VAV1, VHL, VTI1A, ZC3H12A, and ZFP36L1. Eight guides were designed for each gene using the CRISPICK tool from the Broad Institute Genetic Perturbation Platforms. The library also included 100 sequences targeting intergenic loci as negative controls. The sgRNA sequence of CDKN1B is listed in Table 1.

[0245] CRISPR screening with loss of function in vivo

[0246] NGS mice were intravenously injected with MM1.s tumor cells for transplantation on day -21. CAR-T cells were prepared according to the "Lentinvirus and CAR-T Cell Production" section and intravenously injected on day 0. Mice were sacrificed on day 7 or day 21, and femurs, tibias, and vertebrae were collected. From these samples, EasySep was used... TM Human PE Positive Selection Kit II (StemCell Technologies, catalog number 17654) and PE NGFR antibody (Biolegend, catalog number 345106) are used to select and guide positive T cells.

[0247] Following NGFR-positive selection, genomic DNA was isolated using the Qiagen QIAmp DNA Mini Kit (catalog number 51304). sgRNA sequences were amplified from the genomic DNA by PCR and sequenced using the Illumina MiSeq Reagent Kitv2 50 cycles (catalog number MS-102-2001). Samples were processed according to previously published methods.

[0248] Analysis of in vivo loss-of-function CRISPR screening

[0249] The residuals for each guide RNA in the sample-control comparisons represent the difference between the observed sample log2rpm value and its expected value based on the fitted cubic spline model, reflecting the deviation of the model relationship between the control and the sample. These residuals are plotted in a sweissogram, where each guide is plotted as a distinct line across the distribution of all values ​​in a given comparison. In the volcano plot, the log fold change (LFC) value for each gene is calculated by averaging the residuals of the best-performing guide in each conditional comparison. A p-value is then calculated using a hypergeometric distribution to assess the significance of gene signal enrichment or depletion. Finally, the p-value is transformed by calculating a -log10 value.

[0250] Genes were categorized into patterns based on changes in gene expression (calculated as log2 fold change values ​​with z-scores) across their respective study timeframes (in vitro: day 0–7; and in vivo: day 7–21). Each value was then assigned a score, with a +1 score for a log2 fold change > 1 between the two conditions; a -1 score for a log2 fold change < -1; and a 0 score for a log2 fold change between 1 and -1. Relative gene expression was then plotted, starting from baseline 0 for all genes, and scores were then drawn between each condition.

[0251] Selection of candidate genes for validation

[0252] The specific guides used to generate knockout CAR-T cells are the two highest-scoring guides identified in LOF in vivo CRISPR:

[0253] CDKN1B introductory sequence 1 (GGAGAAGCACTGCAGAGACA (SEQ ID NO:1)) and introductory sequence 2 (GCAGTGCTTCTCCAAGTCCC (SEQ ID NO:2)), IL2RA introductory sequence 1 (TGTGTAGAGCCCTGTATCCC (SEQ ID NO:73)) and introductory sequence 2 (ACTGCAGGGAACCTCCACCA (SEQ ID NO:74)), PTPN2 introductory sequence 1 (GCGCTCTGGCACCTTCTCTC (SEQ ID NO:75)) and introductory sequence 2 (GCACTACAGTGGATCACCGC (SEQ ID NO:76)), RASA2 introductory sequence 1 (GGGTACGATAAACTTCTTCC (SEQ ID NO:77)) and introductory sequence 2 (ATGAATAGTACATACCTATA (SEQ ID NO:78)).

[0254] Knockout confirmed by next-generation sequencing

[0255] Genomic DNA was isolated from 1E6 CAR-T cells using the QIAamp DNA Mini Kit (Qiagen, catalog number 51304). Following PCR, next-generation sequencing (complete amplicon sequencing) was performed by the DNA Core at Massachusetts General Hospital.

[0256] Perturb-seq

[0257] The perturb-seq pool contained four guides for each gene targeting CD160, CDKN1B, IL2RA, PTPN2, RASA2, RC3H1, SOCS1, TGFBR2, ZC3H12A, and an intergene control. The sgRNA sequence for CDKN1B is listed in Table 1. Following NGFR-positive selection, droplet-based scRNA seq was performed using a 10x Chromium Next GEM Single Cell 5' Reagent Kit v2 (dual-indexed) with Feature Barcode technology. Sequencing was performed on an Illumina NovaSeq 6000 instrument.

[0258] Batch RNA sequencing

[0259] T cells were isolated from the spine and femur of animals treated with intergenic control KO and CDKN1B KO BCMA CAR-T cells 21 days after T cell transfer. CAR cells were sorted using a Sony SH800 cell sorter. + T cells. After sorting, RNA was isolated using the Qiagen RNeasy Micro Kit (catalog number 74004). Batch RNA sequencing libraries were prepared using the NEB Next Ultra II Directional RNALibrary Prep Kit for Illumina (New England Biolabs, catalog number E7765) and sequenced on an Illumina NextSeq 500 instrument.

[0260] Flow cytometry

[0261] Typically, all cells are washed with PBS containing 2% FBS, incubated with antibody at 4°C in the dark for 25-30 minutes, and then washed twice more. For some experiments, DAPI (Thermo Fisher Scientific, catalog number PI62247) is added before BD Fortessa X20 analysis to distinguish between live and dead cells. For antibodies requiring secondary antibody staining, the procedure is similar: after primary antibody staining as described above, add secondary antibody (before adding DAPI), stain at 4°C in the dark for 20 minutes, and wash twice. For flow cytometry analysis, the antibody clones shown are used to stain the following antigens:

[0262] NGFR (mouse anti-human, Biolegend, PE clone ME20.4, catalog number 345106), NGFR (mouse anti-human, Biolegend, APC clone ME20.4, catalog number 345108), CD34 (mouse anti-human, Biolegend, BV650 clone 561, catalog number 343623), CD3 (mouse anti-human, Biolegend, APC clone OKT3, catalog number 317318), CD3 (mouse anti-human, Biolegend, BV421 clone UCHT1, catalog number 562426), CD5 (mouse anti-human, Biolegend, BV421 clone UCHT2, catalog number 562646), CD25 (mouse anti-human, Biolegend, APC clone BC96, catalog number 302610), Tim-3 (mouse anti-human, BDBiosciences, BV711) Clones 7D3 (catalog number 565567), LAG-3 (mouse anti-human, BD Biosciences, Alexa Fluor 647 clone T47-530, catalog number 565716), and CD3 (mouse anti-human, BD Biosciences, APC-H7 mouse anti-human clone SK7, catalog number 641397) were used. Furthermore, phenotypic staining was optimized using brilliant staining buffer (BD Biosciences, catalog number 566349).

[0263] For cell cycle analysis, use Vybrant according to the manufacturer's instructions. TM DyeCycle TM Green Stain (ThermoFisher Scientific, catalog number V35004).

[0264] Luciferase-based cytotoxicity assay

[0265] Cytotoxicity was assessed by co-culturing CAR-T cells with CBG-expressing tumor cells (MM1.s, RPMI-8226) at varying effector-to-target (E:T) ratios (ranging from 10:1 to 1:100) for approximately 16 hours. Luciferase activity was measured using a Biotek Synergy Neo2 microplate reader. Specific lysis percentage was calculated using the following formula: (Relative luminescent units (RLU) of target cells only - Total RLU containing CAR-T cells) / (RLU of target cells only) × 100%.

[0266] Real-time cytotoxicity assay

[0267] 48-well plates were coated with CD9 antibody (clone: ​​HI9a, Biolegend, catalog number 312102; 4 μl dissolved in 1 ml PBS) and incubated overnight at 4°C. On the day of the experiment, CD9 was removed by washing three times with PBS. RPMI 8226 tumor cells expressing CBG-GFP were seeded, and the plates were incubated at 37°C for 30 minutes. Next, CAR-T cells were seeded, and the plates were placed in an Incucyte instrument. All cells were cultured in R10 medium, and images were taken every 60 minutes using Incucyte software during the experiment.

[0268] Repetitive stimulation

[0269] CAR-T cells were co-cultured with tumor cells (irradiated BCMA-expressing K562 cells) at a 1:1 ratio (both 2.5E5). After 3 days, CAR-T cells were counted by flow cytometry and then stimulated again with fresh iK562-BCMA at the same 1:1 ratio (2.5E5). This was repeated a total of six times (6 restimulations). After two, four, and six restimulations, 1E5 CAR-T cells were harvested to analyze T cell subsets, phenotype, and exhaustion. After two, four, and six restimulations, CAR-T cells were co-cultured with RPMI-8226 tumor cells in a real-time cytotoxicity assay (as described above) to assess CAR function after repeated stimulation.

[0270] In vivo validation model

[0271] All mouse injections were performed by a single animal technician, and monitoring was blinded to the expected outcomes. Each mouse group consisted of at least three mice, with the exact number used in each experiment specified in the legend. Mice were randomized to group on day -1 (i.e., the day after tumor injection and the day before treatment). Multiple myeloma MM1S cells were administered intravenously at 1E6 cells per 100 μl PBS, followed by intravenous administration of 2E6 BCMA-CAR-T cells per 100 μl PBS 21 days after transplantation. The JeKo-1 lymphoma model used 1E6 tumor cells administered 7 days prior to treatment with 0.5E6 CD19-CAR-T cells, with each treatment administered via intravenous injection of 100 μl PBS. For the leukemia Nalm6 mouse model, tumor cells were washed twice in PBS and administered via tail vein at 1E6 cells per 100 μl PBS. Similar to the JeKo-1 model, 0.5E6 CD19-CAR-T cells in 100 μl PBS were intravenously injected after 7 days. Bioluminescent emission of mice was monitored every two weeks as previously described, and euthanasia was performed according to the experimental protocol or when the predetermined endpoint specified by IACUC was reached. Images were analyzed using Aura software.

[0272] Hybrid CRISPR Screening Analysis

[0273] Guide sequences were demultiplexed and quantified using PoolQ v.2.2.0. First, the barcode count data were processed and quality-checked. Samples with a 'normalized match' value <10 were excluded from the analysis to ensure data reliability. In the data, PCR repeat counts were summed, and the mouse biological repeats in the data were averaged under each condition. The count data were then normalized to per million reads (RPM) and transformed using a pseudo-count of 1 (log2). The guide distribution in the library was visualized as the density of log2 RPM values. Pearson correlations were calculated between the library distributions of one biological repeat and any other repeat, two average repeats and any two other repeats, and so on. The averages of all possible combinations were plotted. Z-score normalization was performed on the log2 RPM data for all sgRNAs using the control sgRNA distribution as a baseline. Natural cubic splines with four degrees of freedom were fitted to the zlog2 RPM data for each sample-control pair to calculate the residuals. The z-log fold change (zLFC) was calculated as the difference between the zlog2rpm values ​​of the sample and control, while zresid was calculated as the deviation from the spline fit. Density scatter plots were generated, where each point represents the zlog2rpm value of a given guide in the control (x-axis) and sample (y-axis), with the deviation from the spline fit line representing the residual used for downstream analysis. Density distribution plots were generated to visualize the distribution of guide residuals across different donors and conditions. To further assess donor consistency in each screening, the Pearson correlation of log2RPM values ​​was calculated. The correlation between log2rpm and zresid values ​​was also visualized using scatter plots. These analyses confirmed donor consistency. Therefore, further analysis was performed using average data from all donors. Parallel guide abundance plots visualized the log2rpm values ​​over time for each guide associated with the selected gene of interest to investigate the performance of each guide. zresid values ​​were plotted in a sweissogram, where each guide is represented as a distinct line across the distribution of all values ​​in a given comparison. In the volcano plot, the LFC value for each gene is calculated by averaging the zresid value of the best-performing guide in each conditional comparison. A p-value is then calculated using a hypergeometric distribution to assess the significance of gene signal enrichment or depletion, and the p-value is then transformed by -log10. To compare hits in each selection, the zLFC values ​​for each selection are plotted against each other in a scatter plot for a given comparison.

[0274] Perturb-seq analysis

[0275] Alignment and counting aggregation were performed using CellRanger (v.7.1.0). Gene expression and sgRNA reads were aligned using the default CellRanger count settings. Gene expression reads were aligned to the "refdata-gex-GRCh38-2020-A" human transcriptome. sgRNA reads were aligned to the library using the pattern TTCCAGCATAGCTCTTAAAC(BC) (SEQ ID NO:79) (BC = barcode). Before counting aggregation and read depth normalization, 23,424 cells were estimated to be recovered from four replicates of a day 21 sample from a donor. CellRanger aggr counting was then performed using the default CellRanger aggr settings. 83,685 cells were estimated in the remaining samples before any further cell filtering. Next, a series of quality control checks were performed using Scanpy (v.1.9.5). Cells with mitochondrial gene content greater than 10% were removed. Cells with read counts less than 2,000 and greater than 18,000 were removed to ensure the overall read depth for each cell was within a reasonable range. Cells with fewer than 1,150 genes were excluded due to poor gene capture. To remove any remaining duplexes, the Scrublet tool was used, with an expected duplex rate of 10% and 50 principal components. The resulting cell population after standard quality control filtering was 67,979 cells. If at least one sgRNA read was detected in a cell, that cell was assigned accordingly as containing the associated guide. This resulted in a guide distribution in cells where most cells contained 1 guide, and the maximum number of guides in any given cell was 5. Due to poor guide capture and the fact that most cells had only 1 CRISPR read count, the data were not filtered based on CRISPR read count.

[0276] Principal component analysis (PCA) and nearest neighbor graphs were computed on a set of 10,000 highly variable genes using log-transformed gene expression data for visualization on a UMAP plot. Harmony batch correction was then used to correct for technical batch effects in the PCA embeddings among the remaining samples.

[0277] Cells were divided into 11 clusters at a resolution of 0.4 using the Leiden algorithm. Leiden clusters were classified based on the built-in Scanpy function's "one-versus-rest" differential expression, expression of markers of interest, CD4+ vs. CD8+ expression, and cell cycle scores to determine T cell subset identity. Cell cycle scores were calculated using Scanpy and a previously published list of cell cycle genes. This analysis highlighted which guides were more likely to be associated with certain T cell subsets. Notably, cells containing RASA2, IL2RA, and CD160 guides were excluded from the chi-square test and further analysis due to low cell counts (<100).

[0278] For each cell subpopulation containing a guide, regardless of T cell identity, a pseudo-batch expression profile was created by summing the counts of cells containing a given guide. These data were then converted into a count table, where low counts (<10) were removed, TCR genes were filtered out, and genes not found in at least one sample were excluded. Subsequently, differential expression analysis was performed to identify differentially expressed genes between each guide-containing and non-guide-containing cell subpopulations. A sorted list of differentially expressed genes was created using log2 fold change values ​​calculated by DeSeq2 (pydeseq2v.0.4.8). These sorted lists were passed to GSEA for pre-sorting to search for enriched signature gene sets using gseapy (v.1.0.5).

[0279] Batch RNA-seq analysis

[0280] Reads were trimmed for aptamers and quality using Trimmomatic (v.0.36). Trimmed reads were quantified using Kallisto (v.0.44.0) via pseudo-alignment to GRCh38. Abundance estimates were then converted to gene counts using Tximport (v.1.8.0). Differentially expressed genes were qualitatively identified using DESeq2 (v.1.38.3), and GSEA pre-sorting was performed using gseapy (v.1.0.5) to identify enriched marker gene sets. Memory tags were defined as overlapping genes between GSE9650_EFFECTOR_VS_MEMORY_CD8_TCELL_DN and GSE9650_EXHAUSTED_VS_MEMORY_CD8_TCELL_DN from the Human MSigDB v.2023.2.Hs collection. Effector gene tags are defined as the overlap between GSE9650_EFFECTOR_VS_EXHAUSTED_CD8_TCELL_UP and GSE9650_EFFECTOR_VS_MEMORY_CD8_TCELL_UP. Exhaustion tags are defined as the overlap between GSE9650_EFFECTOR_VS_EXHAUSTED_CD8_TCELL_DN and GSE9650_EXHAUSTED_VS_MEMORY_CD8_TCELL_UP.

[0281] Statistical methods

[0282] Analysis was performed using GraphPad Prism 9 (version 9.0). Unless otherwise specified, data are presented as mean ± SEM and analyzed using two-tailed Student's t-tests or one-way or two-way ANOVA tests. Unless otherwise specified, all tests are two-tailed. p < 0.05 was considered significant, as shown below: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. For multiple groups, multiple comparison correction was used as shown in the legend.

Claims

1. A chimeric antigen receptor (CAR)-T cell comprising a loss-of-function mutation in the cyclin-dependent kinase inhibitor 1B (CDKN1B) gene.

2. The CAR-T cell according to claim 1, wherein the loss-of-function mutation is an early stop codon, truncation, frameshift mutation, deletion, or insertion in the CDKN1B gene.

3. The CAR-T cells of claim 1, wherein the loss-of-function mutation is a deletion or insertion in the CDKN1B gene.

4. The CAR-T cells according to claim 1, wherein the loss-of-function mutation is a deletion or insertion in exon 1 of the CDKN1B gene.

5. The CAR-T cells according to claim 1, wherein the loss-of-function mutation is a deletion or insertion in SEQ ID NO:3 or 4 of exon 1 of the CDKN1B gene.

6. The CAR-T cell according to any one of claims 1-5, further comprising a polynucleotide encoding a clustered regularly spaced short palindromic repeat (CRISPR) guide RNA polynucleotide, said guide RNA polynucleotide comprising a homologous region complementary to the CDKN1B gene.

7. A CAR-T cell comprising a polynucleotide encoding a CRISPR guide RNA polynucleotide, said guide RNA polynucleotide comprising a homologous region complementary to the CDKN1B gene.

8. The CAR-T cells according to claim 6 or 7, wherein the homologous region comprises a polynucleotide sequence of any one of SEQ ID NO: 1-2 or 65-70.

9. The CAR-T cells according to claim 6 or 7, wherein the homologous region comprises a polynucleotide sequence of any one of SEQ ID NO: 1-2.

10. The CAR-T cell according to any one of claims 6-9, further comprising CRISPR protein.

11. The CAR-T cell of claim 10, wherein the CRISPR protein is the Cas9 protein.

12. The CAR-T cells according to any one of claims 1-11, wherein the CAR comprises: (i) Antigen-binding domain; (ii) Transmembrane domains; and (iii) Intracellular signal transduction domains.

13. The CAR-T cell according to claim 12, wherein the antigen-binding domain binds to any one of BCMA, CD19, CD79b, TACI, MUC1, MUC16, B7H3, mesothelin, CD70, PSMA, PSCA, EGFRvIII, and claudin6, binds to any pair of CD19 / CD79b and BCMA / TACI, or is a TriPRIL antigen-binding domain.

14. The CAR-T cell of claim 13, wherein the antigen-binding domain binds to BCMA.

15. The CAR-T cell of claim 14, wherein the antigen-binding domain that binds BCMA comprises the amino acid sequence of SEQ ID NO:

5.

16. The CAR-T cell according to any one of claims 12-15, wherein the transmembrane domain comprises the α, β or ζ chain of the T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278), 4-1BB (CD137), 4-1BBL, GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRFI), CD160, CD19, IL2Rβ, IL2Rγ, IL7Rα, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d , ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBRPAG / Cbp, NKp44, NKp30, NKp46, NKG2D or NKG2C transmembrane domains.

17. The CAR-T cell of claim 16, wherein the transmembrane domain comprises the CD8 transmembrane domain.

18. The CAR-T cell of claim 17, wherein the CD8 transmembrane domain comprises the amino acid sequence of SEQ ID NO:

49.

19. The CAR-T cell according to any one of claims 12-18, wherein the intracellular signal transduction domain comprises a CD3γ, CD3ε, CD3δ or CD3ζ intracellular signal transduction domain.

20. The CAR-T cell according to any one of claims 12-18, wherein the intracellular signal transduction domain comprises the CD3ζ intracellular signal transduction domain.

21. The CAR-T cell of claim 20, wherein the CD3ζ intracellular signal transduction domain comprises the amino acid sequence of SEQ ID NO:

54.

22. The CAR-T cells according to any one of claims 12-21, wherein the CAR further comprises a co-stimulatory domain.

23. The CAR-T cells of claim 22, wherein the co-stimulatory domain comprises CD28, 4-1BB, CD27, TCR-ζ, FcR-γ, FcR-β, CD3-γ, CD3-θ, CD3-σ, CD3-η, CD3-ε, CD3-ζ, CD22, CD79a, CD79b, or CD66d co-stimulatory domains.

24. The CAR-T cells of claim 18, wherein the co-stimulatory domain comprises a 4-1BB co-stimulatory domain.

25. The CAR-T cells according to any one of claims 12-24, wherein the CAR further comprises a truncated CD34 (CD34t) protein.

26. The CAR-T cell of claim 25, wherein the CD34t protein comprises the amino acid sequence of SEQ ID NO:

71.

27. The CAR-T cell of claim 25 or 26, wherein the CAR comprises a 2A peptide between the intracellular signal transduction domain and the CD34t protein.

28. The CAR-T cells according to any one of claims 12-27, wherein the CAR further comprises a signal peptide.

29. The CAR-T cell of claim 28, wherein the signal peptide comprises CD8 signal peptide or IgK signal peptide.

30. The CAR-T cells of claim 29, wherein the CD8 signal peptide comprises the amino acid sequence of SEQ ID NO:

55.

31. The CAR-T cells according to any one of claims 1-30, wherein the CAR comprises, from the N-terminus to the C-terminus: (i) CD8 signal peptide sequence; (ii) Binding to the antigen-binding domain of BCMA; (iii) CD8 transmembrane domain; (iv) 4-1BB costimulatory domain; and (v) CD3ζ intracellular signal transduction domain.

32. The CAR-T cell of claim 12, wherein the CAR comprises the amino acid sequence of SEQ ID NO: 6 or 36.

33. The CAR-T cell of claim 12, wherein the CAR comprises the amino acid sequence of any one of SEQ ID NO: 6-47.

34. A method for treating BCMA-expressing cancer in a subject, the method comprising administering CAR-T cells according to any one of claims 14-33 to the subject.

35. The method of claim 34, wherein the BCMA-expressing cancer is a B-cell cancer.

36. The method of claim 34 or 35, wherein the BCMA-expressing cancer is multiple myeloma.

37. The method according to any one of claims 34-36, wherein the subject is a human subject.

Images