Compositions, methods, and systems for genome editing

CN122580422APending Publication Date: 2026-08-14INTELLIA THERAPEUTICS INC
View PDF 27 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-08
Publication Date
2026-08-14

Smart Images

  • Figure CN122580422A_ABST
    Figure CN122580422A_ABST
Patent Text Reader

Abstract

This disclosure relates to compositions, methods, and systems for genome editing. In some aspects, the compositions, methods, and systems provided herein may include a SpyCas9 nickase, a DNA-dependent DNA polymerase, and / or a template guide RNA for template-based genome editing applications.
Need to check novelty before this filing date? Find Prior Art

Claims

1. A system comprising a DNA-dependent DNA polymerase, a SpyCas9 nickase (nCas9), and a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: a) The first polynucleotide contains SpyCas9 guide RNA, which comprises from 5' to 3': i) Spacers complementary to the target region of the target strand of the DNA double-stranded target nucleic acid; and ii) Bracket; and b) The second polynucleotide is operatively linked to the first polynucleotide and comprises from 5' to 3': i) a template sequence having a length of at least 10 nucleotides and being complementary to at least a portion of the non-target strand of the target nucleic acid of the DNA duplex, wherein the template sequence comprises a 3' end and a 5' end; and wherein the template comprises DNA nucleotides; and ii) A DNA-dependent DNA polymerase recruitment sequence (DRS) of 6-20 nucleotides in length, optionally 10-14 nucleotides in length, having a 3' end and a 5' end; wherein the 5' end of the DRS is covalently attached to the 3' end of the template sequence, and wherein the DRS comprises a sequence complementary to at least 6 nucleotides of the DRS complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides; and iii) The DRS mentioned therein includes at least one of the following: 1) A sequence that is not completely complementary to the DRS complementary region of the non-target strand of the target nucleic acid of the DNA duplex; 2) Containing 1-5 nucleotides of uridine nucleotides modified at the 3' end, optionally 1-3 nucleotides of a 3' terminal tail; or 3) A 5' end (D1) DNA nucleotide and a penultimate 5' end (D2) RNA nucleotide, wherein the 3' end of the first polynucleotide is covalently linked to the 5' end of the second polynucleotide via a phosphate thioester or phosphodiester bond.

2. The system of claim 1, wherein the first polynucleotide is covalently linked to the second polynucleotide, optionally wherein the 3' end of the first polynucleotide is covalently linked to the 5' end of the second polynucleotide.

3. The system of any one of claims 1-2, wherein the first polynucleotide is linked to the second polynucleotide via a non-nucleotide linker, optionally a phosphodiester bond or a thiophosphate bond.

4. The system according to any one of claims 1-3, wherein the 3' terminal nucleotide of the template is a DNA nucleotide.

5. The system according to any one of claims 1-4, wherein (i) the 5' terminal nucleotide of the DRS is a DNA nucleotide; or (ii) the penultimate 5' terminal nucleotide of the DRS is an RNA nucleotide.

6. The system of any one of claims 1-5, wherein the 3' terminal nucleotide of the template and the 5' terminal nucleotide of the DRS are DNA nucleotides, and the penultimate 5' terminal nucleotide of the DRS is an RNA nucleotide.

7. The system according to any one of claims 1-4, wherein the 3' terminal nucleotide in the DRS is an RNA nucleotide and the remaining nucleotide in the DRS is a DNA nucleotide.

8. The system of any one of claims 1-7, wherein the template is composed of DNA nucleotides.

9. The system according to any one of claims 1-4, wherein the DRS is composed of RNA nucleotides.

10. The system of any one of claims 1-9, wherein (i) the sequence of the DRS complementary to the DRS complementary region of the non-target strand of the DNA duplex target nucleic acid comprises nucleotides D2-D9 of the DRS, optionally D2-D8 or D3-D9 of the DRS; or (ii) the sequence of the DRS complementary to the DRS complementary region of the non-target strand of the DNA duplex target nucleic acid comprises nucleotides D6-D13 of the DRS, optionally wherein nucleotides 1, 2, 3, 4, 5, 6, 7 or 8 of nucleotides D6-D13 are DNA nucleotides.

11. The system of claim 1, wherein the tgRNA further comprises an affinity tag, wherein the first polynucleotide or the second polynucleotide binds to a peptide or a peptide complex comprising the nCas9 and the DNA-dependent DNA polymerase via the affinity tag.

12. The system of claim 11, wherein the 1-7 consecutive 5' terminal nucleotides of the DRS are DNA nucleotides, optionally wherein: i) The 5' terminal nucleotide and the penultimate 5' terminal nucleotide of the DRS are DNA nucleotides; ii) At least three consecutive 5' terminal nucleotides of the DRS are DNA nucleotides; or iii) The three consecutive 5' terminal nucleotides of the DRS are DNA nucleotides.

13. The system of any one of claims 11-12, wherein the affinity tag is located at the 5' of the template sequence or the affinity tag is located at the 3' of the DRS.

14. The system of any one of claims 11-13, wherein the tgRNA comprises two affinity tags, optionally wherein (i) both affinity tags are located at the 5' of the template; or (ii) the first affinity tag is located at the 5' of the template sequence and the second affinity tag is located at the 3' of the DRS, wherein the DNA-dependent DNA polymerase is T5 DNA polymerase.

15. The system of any one of claims 11-14, wherein the affinity tag is an aptamer comprising one or more modified nucleotides, optionally wherein the aptamer is located at the 5' end of the template and has a 5' end, and further optionally wherein the aptamer comprises one or more modified nucleotides at its 5' end.

16. The system of claim 15, wherein the modified nucleotide is a 2'-O-methyl (2'-O-Me) modified nucleotide or a phosphate thioester (PS) bond modified nucleotide, or wherein the aptamer comprises a stem-loop, optionally wherein the aptamer comprises a 2'-O-Me modified nucleotide at each nucleotide in the stem of the stem-loop.

17. The system of any one of claims 15 or 16, wherein the aptamer is located at 5' of the template sequence, further wherein: i) The aptamer comprises a PS bond between each of the first three nucleotides at the 5' end; ii) The aptamer comprises a 2'-O-Me modified nucleotide at each of the first two nucleotides at the 5' end; iii) The aptamer comprises a 2'-O-Me modified nucleotide at each of the first two nucleotides at the 5' end and a PS bond between each of the first three nucleotides at the 5' end; or iv) The aptamer comprises a 2'-O-Me modified nucleotide at each nucleotide in the stem of the stem loop and a PS bond between each of the first three nucleotides at the 5' end.

18. The system of any one of claims 15-17, wherein the adapter is located at 3' of the DRS, further wherein: The affinity tag is contained in a PS bond between the last two nucleotides at the 3' end; or the aptamer is contained in a PS bond between a 2'-O-Me modified nucleotide at each nucleotide in the stem of the stem loop and the last two nucleotides at the 3' end.

19. The system of any one of claims 15-18, wherein the aptamer comprises a 2'-O-Me modified nucleotide at each nucleotide.

20. The system of any one of claims 1-19, wherein the DRS comprises a modified nucleotide.

21. The system of any one of claims 1-20, wherein the DRS comprises a modified nucleotide selected from: i) nucleotides modified with 2'-O-methyl (2'-O-Me); ii) nucleotides modified with 2'-fluorine (2'-F); iii) Amine-modified nucleotides; iv) Alkyl-modified nucleotides; v) LNA-modified nucleotides; vi) Methoxyethyl modified nucleotides; vii) Halogen-modified nucleotides; or viii) Phosphothiophosphate (PS)-linked modified nucleotides; Optionally, the modified nucleotide is a 2'-O-methyl (2'-O-Me) modified nucleotide or a phosphate thioester (PS) linked modified nucleotide.

22. The system of claim 20 or 21, wherein: i) The modification in the DRS includes a thiophosphate modification, and the DRS does not include a thiophosphate modification at positions D1-D9 in the DRS sequence; ii) The modification in the DRS includes a thiophosphate modification, and the DRS includes a thiophosphate modification at position D10 or 3' of the DRS sequence; iii) The modification in the DRS includes the 2'-O-Me modification, and the DRS does not include the 2'-O-Me modification at positions D1-D3 in the DRS sequence; iv) The modification in the DRS includes a 2'-O-Me modification, and the DRS includes a 2'-O-Me modification at position D4 or its 3' position in the DRS sequence; or v) The DRS includes a 2'-O-Me modification at nucleotides other than the 5' and 3' end nucleotides of the DRS.

23. The system of any one of claims 1-22, wherein the DNA-dependent DNA polymerase and nCas9 are provided in the form of one or more polypeptides.

24. The system of any one of claims 1-22, wherein the DNA-dependent DNA polymerase and nCas9 are provided in the form of one or more polynucleotides.

25. The system of any one of claims 1-24, wherein the DNA-dependent DNA polymerase comprises DNA polymerase K (polK), optionally human DNA polymerase K (polK), cynomolgus monkey polK or mouse polK, bacteriophage T5 DNA polymerase (T5 pol), DNA polymerase Θ, Escherichia coli DNA polymerase I or DNA polymerase N, optionally wherein the Escherichia coli-dependent DNA polymerase is Klenow (exo-), and optionally wherein the DNA-dependent DNA polymerase is polK or T5 DNA polymerase.

26. The system of claims 1-25, wherein the system comprises an nCas9-polymerase fusion polypeptide.

27. The system of claim 26, wherein the fusion polypeptide further comprises (i) a heteronuclear localization signal (NLS); or (ii) a connector or further comprises an additional connector.

28. The system of claim 26 or 27, wherein the polymerase is selected from: polymerase Θ, Escherichia coli polymerase I, optionally Escherichia coli polymerase I Klenow (exo-), polymerase N, or Phi29 polymerase, wherein: i) The polymerase Θ and the nCas9 are covalently linked in the polypeptide in a sequence selected from the N-terminus to the C-terminus: 1) nCas9-polymerase Θ-NLS; or 2) nCas9-linker-polymerase Θ-linker-NLS; or ii) The *E. coli* polymerase I and the nCas9 are covalently linked in the polypeptide in a sequence selected from the N-terminus to the C-terminus: 1) nCas9-Klenow (exo-)-NLS; 2) nCas9 - Connector - Klenow (exo-) - Connector - NLS; 3) NLS - nCas9- NLS - E. coli PolI; or 4) NLS - nCas9-linker - NLS -linker - E. coli PolI; or iii) The polymerase N and the nCas9 are covalently linked in the polypeptide in a sequence selected from the N-terminus to the C-terminus: 1) Polymerase N-NLS-nCas9-NLS; or 2) Polymerase N-linker-NLS-nCas9-linker-NLS; or iv) The Phi29 polymerase and the nCas9 are covalently linked in the polypeptide in a sequence selected from the N-terminus to the C-terminus: 1) NLS-nCas9-NLS-Phi29 polymerase; 2) ii. NLS-nCas9-linker-NLS-linker-Phi29 polymerase; 3) nCas9-Phi29 polymerase-NLS; or 4) nCas9-linker-Phi29 polymerase-linker-NLS.

29. The system of claim 27 or 28, wherein, The adapter contains the amino acid sequence of any one of SEQ ID NO: 1596-1665, 1735, 1738, 1815, 1825, 1827 and 1829-1830.

30. The system of any one of claims 26-29, wherein the fusion polypeptide comprises the same as SEQ ID NO: 1024, 1027, 1030, 1033, 1036, 1039, 1042, 1045, 1048, 1053, 1056, 1059, 1074, 1081, 1084, 1086, 1094, 1097, 1100, 1102, 1112, 1114, 1124, 1129, 1134, 1137, 1142, 1147, 1152, 1157, 1162, 1167, 1172, 1192, 1195, 1198, 1219, 12 24, 1229, 1234, 1236, 1239, 1254 and 1259, 1268 and 1273, 1276, 1300, 1303, 1307, 1373, 1376, 1388, 1447, 1450, 1453, 1923, 1926, 1929, 1932, 1935 and 1938, any one of which has an amino acid sequence with at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, or encodes SEQ ID NO: 1024, 1027, 1030, 1033, 1036, 1039, 1042, 1045, 1048, 1053, 1056, 1059, 1074, 1081, 1084, 1086, 1094, 1097, 1100, 1102, 1112, 1114, 1124, 1129, 1134, 1137, 1142, 1147, 1152, 1157, 1162, 1167, 11 Nucleic acid of any of the fusion protein sequences of 72, 1192, 1195, 1198, 1219, 1224, 1229, 1234, 1236, 1239, 1254, 1259, 1268 and 1273, 1276, 1300, 1303, 1307, 1373, 1376, 1388, 1477, 1450, 1453, 1923, 1926, 1929, 1932, 1935 and 1938.

31. The system according to any one of claims 1-30, wherein the DNA-dependent DNA polymerase is (i) a human DNA-dependent DNA polymerase; or (ii) a cynomolgus monkey or mouse DNA-dependent DNA polymerase.

32. The system of any one of claims 1-31, wherein the DNA-dependent DNA polymerase is not Phi29 DNA polymerase.

33. The system of any one of claims 1-32, wherein the DNA-dependent DNA polymerase does not contain at least 8 point mutations, and optionally wherein the DNA-dependent DNA polymerase does not contain at least 5 point mutations.

34. The system of any one of claims 1-33, wherein the wild-type DNA-dependent DNA polymerase has a polymerization rate at 37°C that is at least twice as high, optionally at least five times as high, compared to 30°C.

35. The system of any one of claims 1-34, wherein the system comprises: i) DNA polymerase K (polK), said polK comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with amino acid residues 19-526 of SEQ ID NO: 1021; or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with amino acid residues 19-526 of SEQ ID NO: 1021, optionally wherein said polK includes or lacks an N-terminal methionine relative to SEQ ID NO: 1021 or 1206; or a nucleic acid encoding said polK, said nucleic acid comprising a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with amino acid residues 19-526 of SEQ ID NO: 1021, optionally wherein said nucleotide sequence includes or lacks an N-terminal methionine relative to SEQ ID NO: 1021 or 1206; or a nucleic acid encoding said polK comprising a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with amino acid residues 19-526 of SEQ ID NO: 1021, optionally wherein said nucleotide sequence includes or lacks an N-terminal methionine relative to SEQ ID NO: 1021 or 1206. 1020 or 1205 may or may not include start or stop codons; or ii) T5 polymerase (T5 pol), said T5 pol comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any of SEQ ID NO: 1116 or 1121, optionally wherein said T5 pol includes or lacks an N-terminal methionine relative to SEQ ID NO: 1116 or 1121; or a nucleic acid encoding said T5, said nucleic acid comprising a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1115 or 1120, optionally wherein said nucleotide sequence includes or lacks a start or stop codon relative to SEQ ID NO: 1115 or 1120.

36. The system of any one of claims 1-35, wherein the DNA-dependent DNA polymerase comprises a heterodimerization domain or further comprises an additional heterodimerization domain, optionally wherein the DNA-dependent DNA polymerase and nCas9 are covalently linked in the polypeptide in the following order from the N-terminus to the C-terminus: i) NLS-nCas9-linker-NLS-linker-DNA-dependent DNA polymerase-NLS-NLS-linker-heterodimerization domain; or ii) NLS-nCas9-linker-NLS-linker-DNA-dependent DNA polymerase-linker-NLS-linker-heterodimerization domain.

37. The system of claim 36, wherein the heterodimerization domain comprises a coiled-helical heterodimerization domain, optionally an EV, EI, KV or KI domain.

38. The system of any one of claims 36 or 37, wherein the heterodimerization domain comprises an EI or KI domain, and optionally wherein the heterodimerization domain comprises SEQ ID NO: 1589, SEQ ID NO: 1593 or SEQ ID NO: 1595.

39. The system according to any one of claims 1-25 and 31-38, wherein the system comprises: (a) a first polypeptide comprising the DNA-dependent DNA polymerase operably linked to the first cleavage inteptide, or a nucleic acid encoding the first polypeptide; and (ii) a second polypeptide comprising the nCas9 operably linked to a second cleavage inteptide complementary to the first cleavage inteptide, or a nucleic acid encoding the second polypeptide. b) a first polypeptide comprising a first portion of the DNA-dependent DNA polymerase operably linked to the first cleavage inteptide, or a nucleic acid encoding the first polypeptide; and (ii) a second polypeptide comprising a second portion of the DNA-dependent DNA polymerase and nCas9 operably linked to a second cleavage inteptide complementary to the first cleavage inteptide; or (c) a first polypeptide comprising a DNA-dependent DNA polymerase and a first portion of nCas9 operably linked to a first cleavage inteptide, or a nucleic acid encoding the first polypeptide; and (ii) a second polypeptide comprising a second portion of said nCas9 operably linked to a second cleavage inteptide complementary to the first cleavage inteptide, or a nucleic acid encoding the second polypeptide. Optionally, the first cleavage inteptide and the second cleavage inteptide are able to bind to each other to undergo inteptide-mediated protein splicing.

40. The system of claim 39, wherein the first fragmented inteptide is an N-fractured inteptide and the second fragmented inteptide is a C-fractured inteptide, or wherein the first fragmented inteptide is a C-fractured inteptide and the second fragmented inteptide is an N-fractured inteptide.

41. The system of any one of claims 39-40, wherein the first fragmented inteptide and the second fragmented inteptide are complementary inteptides selected from Cfa, M86, Npu, NpuSsp, gp41-1, gp41-8, NrdJ-1, IMPDH-1, SspDnaX, SspGyrB, Cth-Ter, NrdA-2, Mja-KlbA, RBS1, TE3S11 and Rma, optionally wherein the first fragmented inteptide and the second fragmented inteptide are Cfa-inteptides.

42. The system of claim 41, wherein the first cleavage inteptide is a CfaC cleavage inteptide and the second cleavage inteptide is a CfaN cleavage inteptide, optionally wherein (i) the CfaC cleavage intepteptide comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 1746 and the CfaN cleavage intepteptide comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 1744; or (ii) the CfaC cleavage intepteptide comprises the amino acid sequence of SEQ ID NO: 1746 and the CfaN cleavage intepteptide comprises the amino acid sequence of SEQ ID NO: 1744.

43. The system of any one of claims 39-42, wherein the DNA-dependent DNA polymerase or the first portion of the DNA-dependent DNA polymerase is operatively linked to the first cleavage inteptide via a first peptide linker, optionally wherein the first peptide linker comprises 30 amino acids, optionally wherein the first peptide linker comprises an amino acid sequence that is at least 90%, 95%, 98%, or 100% identical to SEQ ID NO: 1829.

44. The system of any one of claims 39-43, wherein the nCas9 or a second portion of the nCas9 is operatively connected to the second cleaved inteptide via a second peptide linker, optionally wherein the second peptide linker is SGGS (SEQ ID NO: 1738).

45. The system of any one of claims 39-44, wherein (i) the DNA-dependent DNA polymerase or the first portion of the DNA-dependent DNA polymerase is operatively linked to a heterologous nuclear localization signal (NLS); or (ii) the nCas9 or the second portion of the nCas9 is operatively linked to a heterologous nuclear localization signal (NLS); optionally wherein the heterologous NLS is selected from SV40 NLS, SV40-c-Myc, and nucleoplasmic proteins.

46. ​​The system of any one of claims 1-45, wherein the system further comprises at least one chromatin remodeling agent.

47. The system of claim 46, wherein the DNA-dependent DNA polymerase, nCas9, and chromatin remodeling agent are covalently linked sequentially from the N-terminus to the C-terminus in the polypeptide in an order selected from: i) Chromatin remodeling protein – nCas9 – DNA-dependent DNA polymerase; ii) nCas9 – chromatin remodeling protein – DNA-dependent DNA polymerase; or iii) nCas9 – DNA-dependent DNA polymerase – chromatin remodeling agent.

48. The system of claim 47, further comprising a nuclear localization signal (NLS), wherein optionally the DNA-dependent DNA polymerase, nCas9, and chromatin remodeling agent are covalently linked sequentially from the N-terminus to the C-terminus in the polypeptide in an order selected from: i) NLS – Chromatin Remodeling Agent – ​​nCas9 – DNA-dependent DNA Polymerase – NLS; ii) NLS – Chromatin Remodeling Agent – ​​nCas9 – NLS – DNA-dependent DNA Polymerase – NLS; iii) NLS – nCas9 – chromatin remodeling agent – ​​DNA-dependent DNA polymerase – NLS; or iv) NLS – nCas9 – chromatin remodeling protein – NLS-DNA-dependent DNA polymerase – NLS; nCas9 – DNA-dependent DNA polymerase – chromatin remodeling protein – NLS.

49. The system of any one of claims 46-48, further comprising one or more adapters between the NLS, nCas9, DNA-dependent DNA polymerase and the chromatin remodeling agent.

50. The system of any one of claims 46-49, wherein the at least one chromatin remodeling agent is selected from polypeptides comprising: HMGB1, HMGN1, HMGN2, HMGN3a, HMGN3b, HMGN4, HMGN5, histone H1.0, histone H1.2, CHD1, ISWI, DNA helicase, TOP1, herpesvirus 8 LANA, CMV IE1, or a domain thereof.

51. The system of any one of claims 1-50, wherein the at least one chromatin remodeling component comprises an HMGB1 polypeptide, optionally wherein the HMGB1 polypeptide comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1783.

52. The system of claim 51, wherein the HMGB1 polypeptide comprises an HMGB1 Box B domain and at least 7 adjacent amino acid residues at the C-terminus of the HMGB1 Box B domain, and wherein the HMGB1 polypeptide lacks all or part of the acidic tail domain.

53. The system of any one of claims 51-52, wherein the HMGB1 polypeptide comprises a hidden nuclear localization signal (NLS), optionally wherein the hidden NLS comprises the sequence of EKSKKKK (SEQ ID NO: 1787).

54. The system of any one of claims 51-53, wherein the HMGB1 polypeptide lacks an HMGB1 Box A domain or wherein the HMGB1 polypeptide comprises two HMGB1 Box B domains, optionally wherein the hidden NLS is located at the C-terminus of the C-terminal ends of the two HMGB1 Box B domains.

55. The system of any one of claims 51-54, wherein the HMGB1 polypeptide comprises, from the N-terminus to the C-terminus: 1) HMGB1 Box A structural domain – HMGB1 Box B structural domain – Hidden NLS; 2) HMGB1 Box B structural domain – HMGB1 Box B structural domain – concealed NLS; or 3) HMGB1 Box B structural domain – hidden NLS.

56. The system of any one of claims 51-55, wherein the HMGB1 polypeptide comprises: (i) at least 90% sequence identity with SEQ ID NO: 1783-1792 and 1803-1804; or (ii) the amino acid sequences of SEQ ID NO: 1783-1792 and 1803-1804.

57. The system of any one of claims 39-56, wherein the first polypeptide or the second polypeptide further comprises the HMGB1 polypeptide.

58. The system of claim 57, wherein the first polypeptide or the second polypeptide further comprises an HMGB1 polypeptide, further wherein: The first polypeptide comprises, from the N-terminus to the C-terminus, HMGB–nCas9–N-crack inteptide; and the second polypeptide comprises, from the N-terminus to the C-terminus, C-crack inteptide–DNA-dependent DNA polymerase.

59. The system of claim 57 or 58, wherein: i) The first polypeptide comprises, from the N-terminus to the C-terminus: NLS – HMGB – linker – nCas9 – linker – N-cleavage inpeptide; and ii) The second polypeptide comprises, from the N-terminus to the C-terminus: 1) C-fractured inteptide-linker-NLS-DNA-dependent DNA polymerase-linker-coiled heterodimerization domain; or 2) C-fracture inteptide-linker-NLS-DNA-dependent DNA polymerase-linker-NLS; Optionally, the second polypeptide comprises at least one template-based genome editing enhancer at the C-terminus.

60. A template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: i) The first polynucleotide contains SpyCas9 guide RNA, which comprises from 5' to 3': 1) Spacers complementary to the target region of the target strand of the DNA duplex target nucleic acid; and 2) Bracket; ii) The second polynucleotide is operatively linked to the first polynucleotide and comprises from 5' to 3': 1) A template sequence having a length of at least 10 nucleotides and being complementary to at least a portion of the non-target strand of the target nucleic acid of the DNA duplex, wherein the template sequence comprises a 3' end and a 5' end; and wherein the template comprises DNA nucleotides; and 2) A DNA-dependent DNA polymerase recruitment sequence (DRS) having a 3' end and a 5' end; wherein the 5' end of the DRS is covalently attached to the 3' end of the template sequence, and wherein the DRS comprises a sequence complementary to at least 6 nucleotides of the complementary region of the DRS of the non-target strand of the DNA duplex target nucleic acid, optionally wherein the length of the DRS is 6-20 nucleotides, more preferably 6-17, 8-17, 10-12, 10-14, 10-16, or 12-14 nucleotides.

61. The tgRNA of claim 60, wherein the DRS comprises at least one of the following: 1) A sequence that is not completely complementary to the DRS complementary region of the non-target strand of the target nucleic acid of the DNA duplex; 2) Containing 1-5 nucleotides of uridine nucleotides modified at the 3' end, optionally 1-3 nucleotides of a 3' terminal tail; or 3) A 5' end (D1) DNA nucleotide and a penultimate 5' end (D2) RNA nucleotide, wherein the 3' end of the first polynucleotide is covalently linked to the 5' end of the second polynucleotide via a phosphate thioester or phosphodiester bond.

62. The tgRNA of claim 60 or 61, wherein the spacer sequence is 20 nucleotides in length.

63. The tgRNA of any one of claims 60-62, wherein the spacer of the guide RNA comprises a modified nucleotide, optionally wherein the spacer of the guide RNA comprises a phosphate thioester (PS) modified, a 2'-O-methyl (2'-O-Me) modified, or a 2'-F modified nucleotide.

64. The tgRNA of any one of claims 60-63, wherein the spacer of the guide RNA comprises DNA nucleotides, optionally wherein the spacer of the guide RNA comprises DNA nucleotides at at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides, and further optionally wherein the spacer of the guide RNA comprises DNA nucleotides at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 nucleotides.

65. The tgRNA of any one of claims 60-64, wherein the spacer of the guide RNA comprises DNA nucleotides at one or more, two or more, three or more, or four or more of positions S1, S2, S3, S4, S5, S9, S10, S11, S12, S13, S17, S18 or S20, optionally wherein the spacer of the guide RNA comprises DNA nucleotides at one or more of positions S11, S12 and S18, optionally at each of positions S11, S12 and S18.

66. The tgRNA of any one of claims 60-63, wherein the spacer of the guide RNA does not contain DNA nucleotides.

67. The tgRNA of any one of claims 60-64, wherein the spacer of the guide RNA comprises a modified nucleotide at one or more of the first five nucleotides at the 5' end, optionally at one or more of the first three nucleotides at the 5' end of the spacer.

68. The tgRNA of any one of claims 60-67, wherein the spacer of the guide RNA does not contain modifications at one or more of positions S6, S7, S8, S15, S16 and S19, or optionally at one or more of positions S4, S5, S6, S7, S8, S11, S12, S15, S16, S18 and S19.

69. The tgRNA of any one of claims 60-68, wherein the spacer of the guide RNA comprises a modification at one or more of positions S4, S5, S9, S10, S11, S12, S13, S14, S17, S18 and S20.

70. The tgRNA of any one of claims 60-69, wherein the spacer of the guide RNA comprises (i) three PS bonds between four consecutive 5' terminal nucleotides of the spacer; or (ii) a PS bond between positions S7 and S8.

71. The tgRNA of any one of claims 60-70, wherein the spacer of the guide RNA comprises a 2'-O-Me modified nucleotide or a 2'-F modified nucleotide in at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides.

72. The tgRNA of any one of claims 60-71, wherein the spacer of the guide RNA comprises (i) a 2'-O-Me modified nucleotide at each of the first three nucleotides (S1, S2, and S3) at the 5' end of the spacer; or (ii) a 2'-F modified nucleotide at one or more of positions S9, S10, S11, S13, S14, S17, and S18.

73. The tgRNA of claim 72, wherein the spacer of the guide RNA comprises a 2'-O-Me modified nucleotide at position S4 and a 2'-F modified nucleotide at each of positions S9, S10, S11, S13, S14, S17 and S18, and further optionally wherein the spacer of the guide RNA comprises a PS bond between positions S7 and S8.

74. The tgRNA of any one of claims 60-72, wherein the spacer of the guide RNA comprises a 2'-O-Me modified nucleotide at one or more of positions S4, S5, S9, S10, S11, S12, S13, S14, S17, S18, and S20, optionally wherein the spacer of the guide RNA comprises (i) a 2'-O-Me modified nucleotide at one or more of positions S4, S5, S9, S10, S13, S14, S17, and S20; or (ii) a 2'-O-Me modified nucleotide at each of positions S9, S10, S13, S14, S17, and S20.

75. The tgRNA of claim 74, wherein the spacer of the guide RNA comprises a 2'-O-Me modified nucleotide at each of positions S9, S10, S17 and S20 and a DNA nucleotide at each of positions S11, S12 and S18.

76. The tgRNA of any one of claims 60-72, wherein the spacer of the guide RNA comprises a 2'-O-Me modified nucleotide at each of positions S1, S2, S3, S4, a 2'-F modified nucleotide at each of positions S9, S10, S11, S13, S14, S17, and S18, and an unmodified nucleotide at each of positions S5, S6, S7, S8, S12, S15, S16, S19, and S20.

77. The system of any one of claims 60-72, wherein the spacer of the guide RNA comprises a 2'-O-Me modified nucleotide at each of S1, S2, S3, S9, S10, S13, S14, S16 and S20, and an unmodified nucleotide at each of S6, S7, S8, S15, S16 and S19, and optionally an unmodified nucleotide at one, two, three, four or all of S4, S5, S11, S12 and S18.

78. The system of any one of claims 60-72, wherein the spacer of the guide RNA comprises a 2'-O-Me modified nucleotide at each of S1, S2, S3, S9, S10, S13, S14, S17 and S20, a DNA nucleotide at each of S11, S12 and S18, and an unmodified nucleotide at each of S6, S7, S8, S15, S16 and S19, optionally an unmodified nucleotide at one or both of S4 and S5.

79. The tgRNA of claim 74, wherein: i) The spacer of the guide RNA comprises a 2'-O-Me modified nucleotide at each of S1, S2, S3, S9, S10, S13, S14, S17, and S20; and ii) The spacer of the guide RNA does not contain any of the modifications at each of S4, S5, S6, S7, S8, S11, S12, S15, S16, S18 and S19.

80. The tgRNA of claim 74, wherein: i) The spacer of the guide RNA contains a 2'-O-Me modified nucleotide at each of S1, S2, S3, S9, S10, S13, S14, S17 and S20; ii) The spacer of the guide RNA comprises DNA nucleotides at each of positions S11, S12, and S18; and iii) The spacer of the guide RNA does not contain any of the modifications at each of S4, S5, S6, S7, S8, S15, S16 and S19.

81. The tgRNA of any one of claims 60-80, wherein the scaffold of the guide RNA comprises the nucleotide sequence of SEQ ID NO: 27 or 40.

82. The tgRNA as described in claim 81, wherein: i) Nucleotides 5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAU-3' or 5'-GUUUUAGACGUAGAAAUACGAAGUUAAAAU-3' constitute repeat / anti-repeat (R / AR) regions, wherein nucleotides 1-6 (LS1-LS6) and 25-30 (LS7-LS12) of the R / AR constitute the lower stem (LS) region, nucleotides 7-8 (B1-B2) and 21-24 (B3-B6) of the R / AR constitute the protruding region; and nucleotides 9-20 (US1-US12) of the R / AR constitute the upper stem (US) region. ii) Nucleotides 5'-AAGGCUAGUCCGUUAUCA-3' constitute the linker region (N1-N18); iii) Nucleotides 5'-CGAAAG-3' constitute hairpin 1 (H1) region (from 5' to 3', H1-2, H1-5 to H1-8 and H1-11); iv) Nucleotides 5'-GCACCGAGUCGGUGC-3' constitute hairpin 2 (H2) region (H2-1 to H2-15); and v) The G nucleotide between the H1 and H2 regions constitutes nucleotide n; The scaffold comprises at least one region having a nucleotide selected from the following unmodified and modified nucleotides: 1) The lower stem region contains modified nucleotides at LS1, LS8, LS10 and LS12; and unmodified nucleotides at LS2, LS3, LS4 and LS5; 2) The protruding region contains nucleotides at B5 and B6 that are not modified by 2'-O-Me; 3) The upper stem region contains at least 10 sites selected from US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11 and US12, optionally all sites in US1 and US2, US3, US4, US5, US6, US7, US8, US9, US10, US11 and US12 containing modified nucleotides; 4) The linker region comprises modified nucleotides at N1, N2, N4, N7, N11, N12 and N17; and unmodified nucleotides at N6, N8, N9, N10, N13 and N14; 5) The hairpin 1 (H1) region comprises modified nucleotides at H1-2, H1-6, H1-7, H1-8 and H1-11; and an unmodified nucleotide at H1-5; 6) The hairpin 2 (H2) region, comprising modified nucleotides at H2-1, H2-2, H2-3, H2-4, H2-5, H2-6, H2-7, H2-12, H2-13, H2-14, and H2-15; and unmodified nucleotides at H2-8, H2-9, and H2-10; and 7) The n is a modified or unmodified nucleotide.

83. The tgRNA of claim 82, wherein the scaffold comprises at least one region having a nucleotide selected from unmodified and modified nucleotides: i) The lower stem region, which contains modified nucleotides at LS1, LS8, LS10 and LS12; and unmodified nucleotides at LS2, LS3, LS4, LS5 and LS6; ii) The protruding region contains nucleotides at B5 and B6 that are not modified by 2'-O-Me; iii) The upper stem region, comprising at least 10 positions selected from US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11 and US12, optionally all positions in US1 and US2, US3, US4, US5, US6, US7, US8, US9, US10, US11 and US12, containing modified nucleotides; iv) The linker region comprising modified nucleotides at N1, N2, N4, N7, N11, N12 and N17; and unmodified nucleotides at N6, N8, N9, N10, N13, N14 and N16; v) The hairpin 1 (H1) region comprises modified nucleotides at H1-2, H1-6, H1-7, H1-8 and H1-11; and an unmodified nucleotide at H1-5; vi) The hairpin 2 (H2) region, comprising modified nucleotides at H2-1, H2-2, H2-3, H2-4, H2-5, H2-6, H2-7, H2-11, H2-12, H2-13, H2-14, and H2-15; and unmodified nucleotides at H2-8, H2-9, and H2-10; and vii) The n is a modified or unmodified nucleotide.

84. The tgRNA of claim 81 or 82, wherein the scaffold comprises at least one region having a nucleotide selected from unmodified and modified nucleotides: i) The lower stem region, which contains modified nucleotides at LS1, LS8, LS10 and LS12; and unmodified nucleotides at LS2, LS3, LS4, LS5, LS6 and LS9; ii) The protruding region contains nucleotides at B5 and B6 that are not modified by 2'-O-Me; iii) The upper stem region, comprising at least 10 positions selected from US1, US2, US3, US4, US5, US6, US7, US8, US9, US10, US11 and US12, optionally all positions in US1 and US2, US3, US4, US5, US6, US7, US8, US9, US10, US11 and US12, containing modified nucleotides; iv) The linker region comprising modified nucleotides at N1, N2, N4, N7, N11, N12, N16 and N17; and unmodified nucleotides at N6, N8, N9, N10, N13, N14 and N16; v) The hairpin 1 (H1) region comprises modified nucleotides at H1-2, H1-6, H1-7, H1-8 and H1-11; and an unmodified nucleotide at H1-5; vi) The hairpin 2 (H2) region, comprising modified nucleotides at H2-1, H2-2, H2-3, H2-4, H2-5, H2-6, H2-7, H2-11, H2-12, H2-13, H2-14, and H2-15; and unmodified nucleotides at H2-8, H2-9, and H2-10; and vii) The n is a modified or unmodified nucleotide.

85. The tgRNA of any one of claims 81-84, wherein the lower stem region comprises modified nucleotides at LS1, LS8, LS10 and LS12; and unmodified nucleotides at LS2, LS3, LS4, LS5, LS6, LS7, LS9 and LS11.

86. The tgRNA of any one of claims 81-85, wherein the lower stem region comprises unmodified nucleotides at LS2, LS3, LS4 and LS5, optionally at LS2, LS3, LS4, LS5, LS6, LS7, LS9 and LS11, optionally wherein the lower stem region comprises unmodified nucleotides at LS7, LS9 and LS11.

87. The tgRNA of any one of claims 81-86, wherein the protruding region comprises (i) modified nucleotides at B2 and B3; or (ii) unmodified nucleotides at B5 and B6, optionally at B1, B4, B5 and B6.

88. The tgRNA according to any one of claims 81-87, wherein the modified nucleotide of the upper stem is a 2'-O-Me modified nucleotide.

89. The tgRNA of any one of claims 81-88, wherein the linker region comprises unmodified nucleotides at N6, N8, N9, N10, N13, N14 and N18, and optionally at N3, N5, N6, N8, N9, N10, N13, N14, N15 and N18.

90. The tgRNA of any one of claims 81-89, wherein the hairpin 1 region comprises (i) unmodified nucleotides at H1-5; or (ii) unmodified nucleotides at H2-8, H2-9, and H2-10.

91. The tgRNA according to any one of claims 81-90, wherein the tgRNA further comprises a 3' tail, and optionally wherein the gRNA comprises a 3' end modification.

92. The tgRNA of any one of claims 60-91, wherein the scaffold sequence comprises an internal adapter, optionally wherein the scaffold sequence comprises (i) an internal adapter in the upper stem region or replacing the upper stem region; (ii) an internal adapter in the linker region; or (iii) an internal adapter in the hairpin 1 region.

93. The tgRNA of any one of claims 60-92, wherein the scaffold of the SpyCas9 guide RNA comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotide sequence of any one of SEQ ID NO: 5, 27, 35, 210, 212, 223, 269, 370, 201-208, 373-374, 393-400, 429, and 430; optionally, i) a sequence of mGUUUUAGmAmGmC(L1)mGmCmAAGUUmAAmAAmUmAmAGmGCUmAGUCmCmGUUAUmCAmC(L1)mGGmGmCmAmCmGmAGUCmGmGmUmGmC (SEQ ID NO: 272) or a sequence having at least 90%, 95% or 98% identity with SEQ ID NO: 272; b) A sequence of GUUUUAGAmGmCmUmA(L1)mUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGCACCGAGUCGGmUmGmC (SEQ ID NO: 211) or a sequence having at least 90%, 95% or 98% identity with SEQ ID NO: 211; c) A sequence of GUUUUAGAmGmC(L1)mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGCACCGAGUCGGmUmGmC (SEQ ID NO: 232) or a sequence having at least 90%, 95%, or 98% identity with SEQ ID NO: 232; or d) The sequence of mGUUUUAGmAmGmCmUmA(L1)mUmAmGmCmAAGUUmAAmAAmUmAmAGmGCUmAGUCmCmGUUAUmCAmC(L1)mGGmGmCmAmCmGmAGUCmGmGmUmGmC (SEQ ID NO: 224) or a sequence having at least 90%, 95% or 98% identity with SEQ ID NO: 224, Where L1 represents the connector as S18, and L3 represents the connector as S6.

94. The tgRNA of any one of claims 60-93, wherein the spacer or scaffold of the guide RNA comprises modified nucleotides.

95. The tgRNA of any one of claims 60-94, wherein the first polynucleotide comprises (i) a SpyCas9 guide RNA comprising, from 5' to 3', a guide sequence and any one of SEQ ID NO: 5, 27, 35, 210, 212, 223, 269, 370, 201-208, 373-374, and 393-400; (ii) a SpyCas9 guide RNA comprising, from 5' to 3', a guide sequence and a nucleotide sequence comprising at least 90%, 91%, 92%, 93%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of any one of SEQ ID NO: 5, 27, 35, 210, 212, 223, 269, 370, 201-208, 373-374, and 393-400; or (iii) a SpyCas9 guide RNA comprising, from 5' to 3', a guide sequence and ... The nucleotide sequence of at least 90%, 91%, 92%, 93%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of any one of 310, 312, 319-326, 347-349, 371, 384-392, 434, 438.

96. The tgRNA of any one of claims 60-95, wherein the first polynucleotide is covalently linked to the second polynucleotide, optionally wherein the 3' end of the first polynucleotide is covalently linked to the 5' end of the second polynucleotide.

97. The tgRNA of any one of claims 60-96, wherein the first polynucleotide is linked to the second polynucleotide via a non-nucleotide linker, optionally via a phosphodiester bond or a thiophosphate bond.

98. The tgRNA of any one of claims 60-97, wherein the template comprises mismatches with a genomic sequence, optionally 1-4 mismatches with the genomic sequence.

99. The tgRNA of any one of claims 60-98, wherein the mismatch that guides template-based editing in the genomic DNA is within nucleotides T1-T25 of the template, optionally within nucleotides T1-T15.

100. The tgRNA of any one of claims 60-99, wherein the template comprises DNA nucleotides.

101. The tgRNA according to any one of claims 60-100, wherein: (i) the 3' terminal nucleotide of the template is a DNA nucleotide; or (ii) the template consists of DNA nucleotides of nucleotide 4 (T4) from the 3' end of the template to the 5' end of the template.

102. The tgRNA according to any one of claims 60-101, wherein the template is composed of DNA nucleotides.

103. The tgRNA of any one of claims 60-101, wherein the template comprises RNA nucleotides.

104. The tgRNA according to any one of claims 60-101 and 103, wherein the template comprises both RNA nucleotides and DNA nucleotides, optionally wherein at least one nucleotide at position T1 or T2 of the template is an RNA nucleotide.

105. The tgRNA of any one of claims 60-101 and 103-104, wherein the 3' end of the template contains 0-1 RNA nucleotides, optionally 1 RNA nucleotide, or wherein the template contains 1-3 RNA nucleotides, optionally only 1 RNA nucleotide, at the 3' end of the template.

106. The tgRNA according to any one of claims 60-105, wherein (i) the DRS is 6-18 nucleotides in length, optionally 8-18 or 10-12 nucleotides in length; or (ii) the DRS is 10-16 or 12-14 nucleotides in length.

107. The tgRNA of any one of claims 60-106, wherein the DRS comprises (i) a sequence complementary to at least six nucleotides of the complementary region of the DRS of the non-target strand of the DNA duplex target nucleic acid, the sequence comprising nucleotides D2-D9 of the DRS, optionally D2-D8 or D3-D9 of the DRS; or (ii) a sequence complementary to the complementary region of the DRS of the non-target strand of the DNA duplex target nucleic acid, the sequence comprising nucleotides D6-D13 of the DRS, optionally wherein nucleotides 1, 2, 3, 4, 5, 6, 7 or 8 of nucleotides D6-D13 are DNA nucleotides.

108. The tgRNA of any one of claims 60-107, wherein the DRS comprises a sequence that is not completely complementary to the DRS complementary region of the non-target strand of the DNA duplex target nucleic acid.

109. The tgRNA of any one of claims 60-108, wherein the DRS comprises RNA nucleotides.

110. The tgRNA of any one of claims 60-109, wherein (i) the penultimate 5' terminal nucleotide (D2) of the DRS is an RNA nucleotide; (ii) each nucleotide in the DRS from the penultimate 5' nucleotide (D2) to the 3' terminal nucleotide is an RNA nucleotide; or (iii) each nucleotide in the DRS from the penultimate 5' nucleotide (D2) to the 3' terminal nucleotide is an RNA nucleotide.

111. The tgRNA according to any one of claims 60-110, wherein the DRS is composed of RNA nucleotides.

112. The tgRNA of any one of claims 60-110, wherein the DRS comprises a DNA nucleotide or wherein the DRS comprises both a DNA nucleotide and an RNA nucleotide.

113. The tgRNA according to any one of claims 60-110 and 112, wherein the DRS comprises a 3' end and a 5' end, and (i) the 5' terminal nucleotide (D1) of the DRS is a DNA nucleotide; (ii) 0-7 nucleotides (nucleotides D1-D7) at the 5' end of the DRS are DNA nucleotides; (iii) one or more of 1-7 nucleotides (nucleotides D1-D7) at the 5' end of the DRS are DNA nucleotides; or (iv) one or more of 1-3 nucleotides (nucleotides D1-D3) at the 5' end of the DRS, optionally the 5' terminal nucleotide (nucleotide D1) of the DRS is a DNA nucleotide.

114. The tgRNA of claim 113, wherein: i) One or more of the nucleotides 1-5 (nucleotides D1-D5) at the 5' end of the DRS are DNA nucleotides, and optionally the remaining nucleotides in the DRS are RNA nucleotides. ii) The 1-3 nucleotides (nucleotides D1-D3) at the 5' end of the DRS, optionally the last 5' nucleotide (nucleotide D1) in the DRS is a DNA nucleotide; iii) Nucleotides 1 and 3 (nucleotides D1 and D3) at the 5' end of the DRS are DNA nucleotides, and optionally the remaining nucleotides in the DRS are RNA nucleotides; iv) Nucleotides 1, 3, and 5 (nucleotides D1, D3, and D5) at the 5' end of the DRS are DNA nucleotides, optionally wherein the remaining nucleotides in the DRS are RNA nucleotides; or v) The 3' terminal nucleotide in the DRS is an RNA nucleotide and the remaining nucleotides in the DRS are DNA nucleotides.

115. The tgRNA of any one of claims 60-110 and 112-114, wherein the 3' terminal nucleotide of the template and the 5' terminal nucleotide of the DRS are DNA nucleotides, and the penultimate 5' terminal nucleotide of the DRS is an RNA nucleotide.

116. The tgRNA of any one of claims 60-110 and 112-113, wherein the 3' terminal nucleotide in the DRS is an RNA nucleotide and the remaining nucleotides in the DRS are DNA nucleotides or wherein the DRS is composed of DNA nucleotides.

117. The tgRNA of claim 116, wherein the spacer of the guide RNA comprises a 2'-O-Me modified nucleotide at one or more of positions S1, S2, S3, S4, S5, S9, S10, S11, S12, S13, S14, S17, S18 and S20.

118. The tgRNA of claim 116, wherein the spacer of the guide RNA does not contain modifications at one or more of positions S6, S7, S8, S15, S16 and S19.

119. The tgRNA according to any one of claims 116-118, wherein: i) The spacer of the guide RNA comprises a 2'-O-Me modified nucleotide at each of S1, S2, S3, S9, S10, S13, S14, S17, and S20; and ii) The spacer of the guide RNA does not contain any of the modifications at each of S4, S5, S6, S7, S8, S11, S12, S15, S16, S18 and S19.

120. The tgRNA of claim 114, wherein: i) The spacer of the guide RNA contains a 2'-O-Me modified nucleotide at each of S1, S2, S3, S9, S10, S13, S14, S17 and S20; ii) The spacer of the guide RNA comprises DNA nucleotides at each of positions S11, S12, and S18; and iii) The spacer of the guide RNA does not contain any of the modifications at each of S4, S5, S6, S7, S8, S15, S16 and S19.

121. The tgRNA of any one of claims 60-120, wherein the DRS includes a 3' tail at the 3' end of the DRS, wherein the tail is 1-5 nucleotides long, optionally 1-3 nucleotides long.

122. The tgRNA of claim 121, wherein the 3' tail of the DRS comprises RNA nucleotides.

123. The tgRNA of claim 121 or 122, wherein the 3' tail comprises a uridine nucleotide, optionally wherein the 3' terminal nucleotide is a modified uridine nucleotide.

124. The tgRNA of any one of claims 60-123, wherein the DRS comprises a modified nucleotide, optionally wherein the modified nucleotide is selected from: i) nucleotides modified with 2'-O-methyl (2'-O-Me); ii) nucleotides modified with 2'-fluorine (2'-F); iii) Amine-modified nucleotides; iv) Alkyl-modified nucleotides; v) LNA-modified nucleotides; vi) Methoxyethyl modified nucleotides; vii) Halogen-modified nucleotides; or viii) Phosphothiophosphate (PS)-linked modified nucleotides; Optionally, the modified nucleotide is a 2'-O-methyl (2'-O-Me) modified nucleotide or a phosphate thioester (PS) linked modified nucleotide.

125. The tgRNA of claim 124, wherein... i) The modification in the DRS includes a thiophosphate modification, and the DRS does not include a thiophosphate modification at positions D1-D9 in the DRS sequence; ii) The DRS includes a thiophosphate modification at position D10 or 3' of the DRS sequence; iii) The modification in the DRS includes the 2'-O-Me modification, and the DRS does not include the 2'-O-Me modification at positions D1-D3 in the DRS sequence; iv) The modification in the DRS includes a 2'-O-Me modification, and the DRS does not include a 2'-O-Me modification at the 5' terminal nucleotide and the 3' terminal nucleotide in the DRS; v) The modification in the DRS includes a 2'-O-Me modification at a nucleotide other than the 5' and 3' terminal nucleotides of the DRS; vi) The modification in the DRS includes a 2'-O-Me modification, and the DRS includes a 2'-O-Me modification at position D4 or at its 3' position in the DRS sequence; vii) The modification in the DRS includes a 2'-O-Me or 2'-F modification, and the DRS includes a 2'-O-Me or 2'-F modification at the 3' terminal nucleotide in the DRS; viii) The 1-3 terminal nucleotides at the 3' end of the DRS are chemically modified, optionally wherein the nucleotides at the 3' end of the DRS are chemically modified; ix) The 1-3 terminal nucleotides at the 3' end of the DRS contain phosphate thioester (PS) modifications, optionally at least one of the PS modifications being between the last two nucleotides at the 3' end; x) The 3' terminal nucleotide of the DRS contains a 2'-O-Me modification; xi) The DRS comprises a PS bond between 2, 3, 4, 5, or 6 consecutive 3' terminal nucleotides of the DRS; or xii) All RNA nucleotides in the DRS contain modified RNA nucleotides.

126. The tgRNA according to any one of claims 124-125, wherein: i) The DRS comprises a PS bond between 2, 3, 4, 5 or 6 consecutive 3' terminal nucleotides of the DRS; ii) The DRS comprises a PS bond between the 3' terminal nucleotide of the DRS and the penultimate 3' terminal nucleotide; iii) The DRS comprises three PS bonds between four consecutive 3' terminal nucleotides of the DRS; iv) The DRS comprises a PS bond between the 3' terminal nucleotide of the DRS and the two nucleotides other than the penultimate 3' terminal nucleotide; v) The DRS contains a thiophosphate modification, wherein the DRS does not contain a thiophosphate modification at positions D1-D9 in the DRS sequence; or vi) The DRS includes a thiophosphate modification at position D10 or 3' of the DRS sequence.

127. The tgRNA of any one of claims 60-95 and 98-126, wherein the first polynucleotide is not covalently linked to the second polynucleotide.

128. The tgRNA according to any one of claims 60-110 and 112-127, wherein i) The 1-7 consecutive 5' terminal nucleotides of the DRS are DNA nucleotides; ii) The 5' terminal nucleotide and the penultimate 5' terminal nucleotide of the DRS are DNA nucleotides; iii) At least three consecutive 5' terminal nucleotides of the DRS are DNA nucleotides; or iv) The three consecutive 5' terminal nucleotides of the DRS are DNA nucleotides.

129. The tgRNA of any one of claims 60-128, wherein the tgRNA further comprises an affinity tag, wherein the first polynucleotide or the second polynucleotide binds to a peptide or a peptide complex comprising nCas9 and a DNA-dependent DNA polymerase via the affinity tag.

130. The tgRNA according to any one of claims 60-110 and 112-129, wherein the 1-7 consecutive 5' terminal nucleotides of the DRS are DNA nucleotides, optionally wherein: i) The 5' terminal nucleotide and the penultimate 5' terminal nucleotide of the DRS are DNA nucleotides; ii) At least three consecutive 5' terminal nucleotides of the DRS are DNA nucleotides; or iii) The three consecutive 5' terminal nucleotides of the DRS are DNA nucleotides.

131. The tgRNA of any one of claims 129-130, wherein the affinity tag is located at the 5' of the template sequence or the affinity tag is located at the 3' of the DRS.

132. The tgRNA of any one of claims 129-131, wherein the tgRNA comprises two affinity tags, optionally wherein (i) both affinity tags are located at the 5' of the template; or (ii) the first affinity tag is located at the 5' of the template sequence and the second affinity tag is located at the 3' of the DRS, wherein the DNA-dependent DNA polymerase is T5 DNA polymerase.

133. The tgRNA of any one of claims 129-132, wherein the affinity tag is an aptamer comprising one or more modified nucleotides, optionally wherein the aptamer is located at the 5' end of the template and has a 5' end, and further optionally wherein the aptamer comprises one or more modified nucleotides at its 5' end.

134. The tgRNA of claim 133, wherein the modified nucleotide is a 2'-O-methyl (2'-O-Me) modified nucleotide or a phosphate thioester (PS) linked modified nucleotide.

135. The tgRNA of any one of claims 133-134, wherein the aptamer comprises a stem-loop, optionally wherein the aptamer comprises a 2'-O-Me modified nucleotide at each nucleotide in the stem of the stem-loop.

136. The tgRNA of any one of claims 133-135, wherein the aptamer is located at the 5' of the template sequence, further wherein: i) The aptamer comprises a PS bond between each of the first three nucleotides at the 5' end; ii) The aptamer is located at the 5' of the template sequence, further wherein the aptamer comprises a 2'-O-Me modified nucleotide at each of the first two nucleotides at the 5' end; iii) The aptamer comprises a 2'-O-Me modified nucleotide at each of the first two nucleotides at the 5' end and a PS bond between each of the first three nucleotides at the 5' end; or iv) The aptamer comprises a 2'-O-Me modified nucleotide at each nucleotide in the stem of the stem loop and a PS bond between each of the first three nucleotides at the 5' end.

137. The tgRNA according to any one of claims 133-136, wherein the aptamer is located at the 3' position of the DRS, further wherein: (i) the affinity tag is contained in a PS bond between the last two nucleotides at the 3' end; or (ii) the aptamer is contained in a PS bond between a 2'-O-Me modified nucleotide at each nucleotide in the stem of the stem loop and the last two nucleotides at the 3' end.

138. The tgRNA of any one of claims 133-137, wherein the aptamer comprises a nucleotide modified with 2'-O-Me at each nucleotide position.

139. A system comprising: a) A first polynucleotide encoding a first polypeptide, the first polypeptide comprising a DNA-dependent DNA polymerase or a portion thereof operably linked to a first cleavage inteptide; and b) A second polynucleotide encoding a second polypeptide comprising a SpyCas9 nickase (nCas9) or a portion thereof operably linked to a second nick intip complementary to the first nick intip, wherein the first nick intip and the second nick intip undergo a trans-splicing reaction resulting in the formation of a single fusion polypeptide comprising, from the N-terminus to the C-terminus: (i) the DNA-dependent DNA polymerase and the nCas9, or (ii) the nCas9 and the DNA-dependent DNA polymerase.

140. The system of claim 139, wherein the system comprises: (i) a first polynucleotide encoding the DNA-dependent DNA polymerase operably linked to the first cleavage inteptide; and (ii) a second polynucleotide encoding the nCas9 operably linked to the second cleavage inteptide complementary to the first cleavage inteptide. ii) A first polynucleotide encoding a first portion of the DNA-dependent DNA polymerase operatively linked to the first fragment containing peptide; (ii) encodes a second polynucleotide operably linked to the DNA-dependent DNA polymerase and the second portion of the nCas9, which is complementary to the second fragment inteptide of the first fragment inteptide; or iii) A first polynucleotide encoding the DNA-dependent DNA polymerase operatively linked to the first fragmented inteptide and the first portion of the nCas9; (ii) encodes a second polynucleotide operatively linked to a second portion of the nCas9 that is complementary to the first cleavage inteptide.

141. The system of claim 139 or 140, wherein: i) The DNA-dependent DNA polymerase is polK, comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with amino acid residues 19-526 of SEQ ID NO: 1021; or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1021, 1265, or 1206, optionally wherein polK includes or lacks an N-terminal methionine relative to SEQ ID NO: 1021, 1265, or 1206; or ii) The DNA-dependent DNA polymerase is T5 pol, which comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any of SEQ ID NO: 1116 or 1121, optionally wherein the T5 pol includes or lacks an N-terminal methionine relative to SEQ ID NO: 1116 or 1121.

142. The system of any one of claims 139-141, wherein the first cleavage inteptide is an N-cleavage inteptide and the second cleavage inteptide is a C-cleavage inteptide, or wherein the first cleavage inteptide is a C-cleavage inteptide and the second cleavage inteptide is an N-cleavage inteptide, optionally wherein the first cleavage inteptide and the second cleavage inteptide are Cfa-inteptides.

143. The system according to any one of claims 139-142, wherein: 1) The first polynucleotide comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of any one of SEQ ID NO: 1278, 1281, 1363, 1366, and 1378; 1391, 1395, 1399, 1403, 1407, 1411, 1415, 1419, 1423, 1427, 1431, 1435, 1439, 1443, 1907, 1913, 1940, and 1943, or an open reading frame (ORF) of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of any one of SEQ ID NO: The sequence is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of the following: 1277, 1280, 1362, 1365, 1377, 1906, 1912, 1939, 1942, 3006-3008, 3010, 3012, and 3017-3018; or 2) The second polynucleotide comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of any one of SEQ ID NO: 1284, 1287, 1290, 1293, 1296, 1369, 1381, 1384, 1389, 1393; 1397, 1401, 1405, 1409, 1413, 1417, 1421, 1425, 1429, 1433, 1437, 1441, 1901, 1904, 1910, 1916, 1918, 1946, 1949, 1952, 1955, 1958, or the same open reading frame (ORF) as ... The sequence is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of the following: 1283, 1286, 1289, 1292, 1295, 1368, 1380, 1383, 1900, 1903, 1909, 1915, 1919, 1945, 1948, 1951, 1954, 1957, 3001-3005, 3009, 3011, 3013-3016 and 3019-3022.

144. A system comprising: (a) a DNA-dependent DNA polymerase and a SpyCas9 nickase (nCas9); and (b) at least one chromatin remodeling agent operatively connected to the nCas9 and the DNA-dependent DNA polymerase.

145. The system of claim 144, wherein the system further comprises a nuclear localization signal, wherein the DNA-dependent DNA polymerase and the nCas9 are covalently linked sequentially from the N-terminus to the C-terminus in the polypeptide, wherein the order is: i) Nuclear localization signal – chromatin remodeling agent – ​​nCas9 – DNA-dependent DNA polymerase – nuclear localization signal; ii) Nuclear localization signal – nCas9 – chromatin remodeling agent – ​​DNA-dependent DNA polymerase – nuclear localization signal; or iii) Nuclear localization signal – nCas9 – DNA-dependent DNA polymerase – chromatin remodeling – nuclear localization signal.

146. The system of any one of claims 144-145, wherein the at least one chromatin remodeling factor comprises the HMGB1 polypeptide.

147. The system of claim 146, wherein the HMGB1 polypeptide comprises an HMGB1 polypeptide, wherein the HMGB1 polypeptide comprises an HMGB1 Box B domain and at least 7 adjacent amino acid residues at the C-terminus of the HMGB1 Box B domain, and wherein the HMGB1 polypeptide lacks all or part of the acidic tail domain.

148. The system of claim 146 or 147, wherein the HMGB1 polypeptide comprises a hidden nuclear localization signal (NLS), optionally wherein the hidden NLS comprises the sequence of EKSKKKK (SEQ ID NO: 1787).

149. The system of any one of claims 146-148, wherein the HMGB1 polypeptide lacks the HMGB1 Box A domain.

150. The system of any one of claims 146-149, wherein the HMGB1 polypeptide comprises two HMGB1 Box B domains, optionally wherein the hidden NLS is located at the C-terminus of the C-terminal ends of the two HMGB1 Box B domains.

151. The system of any one of claims 146-150, wherein the HMGB1 polypeptide comprises at least 90% sequence identity with SEQ ID NO: 1783-1792 or 1803-1804, or wherein the HMGB1 polypeptide comprises the amino acid sequence of SEQ ID NO: 1783-1792 or 1803-1804.

152. The system of any one of claims 139-151, further comprising a template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: a) The first polynucleotide of the tgRNA comprises SpyCas9 guide RNA, which includes, from 5' to 3': i) Spacers complementary to the target region of the target strand of the DNA double-stranded target nucleic acid; and ii) Bracket; and b) The second polynucleotide of the tgRNA is operatively linked to the first polynucleotide of the tgRNA and comprises from 5' to 3': i) A template sequence having a length of at least 10 nucleotides and being complementary to at least a portion of the non-target strand of the target nucleic acid of the DNA duplex, wherein the template sequence comprises a 3' end and a 5' end; and wherein the template comprises DNA nucleotides; ii) A DNA-dependent DNA polymerase recruitment sequence (DRS) having a length of 6-18 nucleotides, optionally 8-18 or 10-12 nucleotides, and having a 3' end and a 5' end; wherein the 5' end of the DRS is covalently attached to the 3' end of the template sequence, and wherein the DRS comprises a sequence complementary to at least 6 nucleotides of the DRS complementary region of the non-target strand of the DNA duplex target nucleic acid.

153. A system comprising DNA polymerase K (polK), SpyCas9 nickase (nCas9), and template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: a) The first polynucleotide contains SpyCas9 guide RNA, which comprises from 5' to 3': i) Spacers complementary to the target region of the target strand of the DNA double-stranded target nucleic acid; and ii) Bracket; and b) The second polynucleotide is operatively linked to the first polynucleotide and comprises from 5' to 3': i) A template sequence having a length of at least 10 nucleotides and being complementary to at least a portion of the non-target strand of the target nucleic acid of the DNA duplex, wherein the template sequence comprises a 3' end and a 5' end; and wherein the template comprises DNA nucleotides; ii) A DNA-dependent DNA polymerase recruitment sequence (DRS) having a length of 6-18 nucleotides, optionally 8-18 or 10-12 nucleotides, and having a 3' end and a 5' end; wherein the 5' end of the DRS is covalently attached to the 3' end of the template sequence, and wherein the DRS comprises a sequence complementary to at least 6 nucleotides of the DRS complementary region of the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides.

154. The system of claim 153, wherein the polK comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with amino acid residues 19-526 of SEQ ID NO: 1021; or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1021, optionally wherein the polK includes or lacks an N-terminal methionine relative to SEQ ID NO: 1021.

155. The system of claim 153 or 154, wherein the polK comprises amino acids 19-526, optionally amino acids 1-526, relative to SEQ ID NO: 1021.

156. The system of any one of claims 335-337, wherein the polK comprises a mutation at G411 or E412 relative to SEQ ID NO:1021, optionally wherein the polK comprises mutations at both G411 and E412.

157. The system of any one of claims 153-156, wherein the polK comprises the GE411-412RV mutation relative to SEQ ID NO:1021.

158. The system of any one of claims 153-157, wherein polK is encoded by: a) A nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the coding sequence of amino acid residues 19-526 in SEQ ID NO: 1021; a) A nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1020; b) A nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1201; c) A nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1203; d) A nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1205; e) A nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1264; or f) A nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1018.

159. The system of any one of claims 153-158, wherein the polK or the nCas9 is connected to a heterogeneous nucleus localization signal (NLS).

160. The system of any one of claims 153-159, wherein the polK is linked to the MS2 capsid protein (MCP) domain.

161. The system of any one of claims 153-160, wherein the polK is covalently connected to the nCas9.

162. The system of any one of claims 153-161, wherein the polK and the nCas9 are covalently linked in the polypeptide in a sequence selected from the N-terminus to the C-terminus: 1) NLS-nCas9-NLS-polK; 2) NLS-nCas9-connector-NLS-connector-polK; 3) polK-NLS-nCas9-NLS; 4) polK – connector – NLS – connector – nCas9 – connector – NLS; 5) NLS- nCas9- NLS- polK (GE411-412RV); 6) NLS-nCas9-connector-NLS-polK (GE411-412RV); 7) NLS- nCas9-NLS- polΚ (19-526); 8) NLS-nCas9-connector-NLS-connector-polK (19-526); 9) polΚ (19-526)-NLS – nCas9 – NLS; 10) polK (19-526)-connector- NLS –connector- nCas9-connector- NLS; 11) polΚ (GE411-412RV)-NLS – NLS – nCas9; 12) polK (GE411-412RV) - Connector - NLS - Connector - NLS - nCas9; 13) NLS- nCas9 –NLS -polΚ (19-526, GE411-412RV); 14) NLS-nCas9 – Connector-NLS-Connector-polK (19-526, GE411-412RV); 15) NLS- nCas9 – NLS – polΚ -NLS; 16) NLS-nCas9 – Connector – NLS – Connector – polK- Connector-NLS; 17) NLS-nCas9–NLS-polK(1-526, GE411-412RV)-NLS; or 18) NLS-nCas9 – Connector – NLS – Connector – polK (1-526, GE411-412RV) – Connector – NLS; 19) nCas9-polK (1-526); 20) polK (1-526, GE411-412RV)-nCas9-NLS-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled-helical heterodimerization domain, optionally an EI domain or a KI domain; or 21) polK (1-526, GE411-412RV) - connector - NLS - nCas9 - connector - NLS - heterodimerization domain, Optionally, the heterodimerization domain includes a coiled-helical heterodimerization domain, optionally an EI domain or a KI domain; Optionally, the order is NLS-nCas9–connector-NLS–connector-polK (1-526, GE411-412RV)–connector-NLS, and optionally also includes a heterodimerizing domain containing a coiled helical heterodimerizing domain, optionally an EI domain or a KI domain.

163. The system of any one of claims 153-162, wherein the polK or a portion thereof is operatively linked to a first cleavage inteptide and the nCas9 or a portion thereof is operatively linked to a second cleavage inteptide complementary to the first cleavage inteptide, wherein the first cleavage inteptide and the second cleavage inteptide undergo a trans-splicing reaction resulting in the formation of a single fusion polypeptide comprising (i) the polK and the nCas9 or (2) the polK and the nCas9 from the N-terminus to the C-terminus.

164. The system of any one of claims 163, wherein the polK is operatively connected to a heterogeneous nucleus localization signal (NLS), or wherein the nCas9 is operatively connected to a heterogeneous nucleus localization signal (NLS).

165. The system of any one of claims 153-164, wherein the polK and the nCas9 are operatively linked to at least one chromatin remodeling factor, and wherein the polK, the nCas9, and the chromatin remodeling factor are covalently linked in the polypeptide in a sequence selected from the N-terminus to the C-terminus: ii) Chromatin remodeling protein – nCas9 – polK; iii) nCas9 – chromatin remodeling chromatin – polK; or iv) nCas9 – polK – chromatin remodeling agent, Optionally, it may also include a nuclear localization signal (NLS).

166. The system of any one of claims 165, wherein the at least one chromatin remodeling factor comprises the HMGB1 polypeptide.

167. The system of claim 166, wherein the HMGB1 polypeptide comprises (i) at least 90% sequence identity with SEQ ID NO: 1783-1792 and 1803-1804 or (ii) the amino acid sequences of SEQ ID NO: 1783-1792 and 1803-1804.

168. The system of any one of claims 153-160, wherein the polK and the nCas9 are not covalently connected, and the polK provides a 3' extended recruitment domain, wherein, The polK and the 3' extended recruitment domain are covalently linked in the polypeptide in the following order from the N-terminus to the C-terminus: 1) 3' Extended Recruitment Structural Domain -polK-NLS; 2) 3' Extended recruitment structural domain - connector - polK - connector - NLS; 3) 3' Extended Recruitment Structural Domain - polK (GE411-412RV) - NLS; and 4) 3' Extended Recruiting Structural Domain - Connector - polK (GE411-412RV) - Connector - NLS.

169. The system of any one of claims 168, wherein the polypeptide comprises a heterodimerization domain or further comprises an additional heterodimerization domain.

170. The system of any one of claims 161-169, wherein (i) the polypeptide comprises a sequence selected from SEQ ID NO: 1024, 1027, 1030, 1036, 1039, 1042, 1045, 1048, 1053, 1056, 1059, 1074, 1200, 1202, 1229, 1234 or 1268 or 1300, 1373, 1388, 1447, 1453, 1923, 1926 or 1929; or (ii) the polypeptide is encoded by a nucleotide sequence, the nucleotide sequence being identical to SEQ ID NO: 1023, 1026, 1029, 1035, 1038, 1041, 1044, 1047, 1052, 1055, 1058, 1073, 1199, 1201, 1228, 1233 or 1267 and 1299, 1372, 1387, 1446, 1452, 1922, 1925 or 1928 have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.

171. The system of any one of claims 161-170, wherein (i) the polypeptide comprises a sequence selected from any one of SEQ ID NO: 1062 and 1067; or (ii) the polypeptide is encoded by a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: 1061 and 1066.

172. A system comprising T5 DNA polymerase (T5 pol), SpyCas9 nickase (nCas9), and template guide RNA (tgRNA), wherein the tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: 1) The first polynucleotide contains SpyCas9 guide RNA, which comprises from 5' to 3': a. A spacer complementary to the target region of the target strand of a DNA double-stranded target nucleic acid; and b. Scaffold; and 2) The second polynucleotide is operatively linked to the first polynucleotide and comprises from 5' to 3': a. A template sequence having a length of at least 10 nucleotides and being complementary to at least a portion of the non-target strand of the target nucleic acid of the DNA duplex, wherein the template sequence comprises a 3' end and a 5' end; and wherein the template comprises DNA nucleotides; and b. A DNA-dependent DNA polymerase recruitment sequence (DRS) having a length of 6-20 nucleotides, optionally 10-16 or 12-14 nucleotides, and having a 3' end and a 5' end; wherein the 5' end of the DRS is covalently attached to the 3' end of the template sequence, and wherein the DRS comprises a sequence complementary to at least 6 nucleotides of the DRS complementary region of the non-target strand of the DNA duplex target nucleic acid, the sequence comprising nucleotides 5-10 at the 5' of the PAM in the non-target strand of the DNA duplex target nucleic acid, wherein the DRS comprises RNA nucleotides.

173. The system of claim 172, wherein the T5 pol comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with either SEQ ID NO: 1116 or SEQ ID NO: 1121, optionally wherein the T5 pol includes or lacks an N-terminal methionine relative to SEQ ID NO: 1116 or 1121.

174. The system of claim 172 or 173, wherein the T5 pol contains a mutation at D164 or E166 relative to SEQ ID NO: 1116.

175. The system of any one of claims 172-174, wherein the T5 pol comprises D164A and E166A mutations relative to SEQ ID NO:1116.

176. The system of any one of claims 172-175, wherein the T5 pol comprises an amino acid sequence containing an N-terminal deletion of 30 amino acids relative to SEQ ID NO:1116.

177. The system of any one of claims 172-176, wherein the T5 pol is encoded by a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with either SEQ ID NO: 1115 or SEQ ID NO: 1120, optionally wherein the T5 pol includes or lacks a start or stop codon relative to SEQ ID NO: 1115 or 1120.

178. The system of any one of claims 172-177, wherein the template comprises 0-1 RNA nucleotide, optionally 1 RNA nucleotide, at the 3' end of the template.

179. The system of any one of claims 172-178, wherein the T5 pol or the nCas9 is connected to a heterogeneous nucleus localization signal (NLS).

180. The system of any one of claims 172-179, wherein the T5 pol is linked to the MS2 capsid protein (MCP domain).

181. The system of any one of claims 172-180, wherein the T5 pol is covalently connected to the nCas9.

182. The system of any one of claims 172-181, wherein the T5 pol and the nCas9 are covalently linked in the polypeptide in a sequence selected from the N-terminus to the C-terminus: 1) nCas9-T5Pol-NLS; 2) nCas9-connector – T5Pol –connector – NLS; 3) T5Pol–nCas9 - NLS; 4) T5Pol – Connector – nCas9 – Connector – NLS; 5) NLS – nCas9 – NLS- T5Pol – binding site – NLS- NLS; 6) NLS – nCas9 – Connector – NLS-Connector – T5Pol – Connector – MCP – Connector – NLS-Connector – NLS; 7) nCas9 – Connector – T5Pol – Connector – NLS; 8) nCas9 – T5Pol(N30del) – NLS; 9) nCas9 – Connector – T5Pol(N30del) – Connector – NLS; 10) nCas9 – T5Pol(DA593R) – NLS; 11) nCas9 – Connector – T5Pol(A593R) – Connector – NLS; 12) NLS- nCas9 – NLS- T5Pol- NLS –NLS; 13) NLS-nCas9 – Connector – NLS- Connector – T5Pol – Connector – NLS – Connector – NLS; 14) nCas9 –NLS –T5Pol; 15) nCas9 – Connector – NLS – Connector – T5Pol; 16) NLS- nCas9 – NLS- T5Pol –NLS – NLS; 17) NLS – nCas9 – Connector – NLS-Connector – T5Pol – Connector – NLS – NLS; 18) nCas9 –T5Pol(K425I) –NLS; 19) nCas9 – Connector--T5Pol(K425I)--Connector—NLS; 20) nCas9-T5Pol-NLS-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled-helical heterodimerization domain, optionally an EI domain or a KI domain; or 21) nCas9-connector-T5Pol-connector-NLS-connector-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled-helical heterodimerization domain, optionally an EI domain or a KI domain; and Optionally, the T5pol contains a mutation at D164 or E166 relative to SEQ ID NO: 1116, and optionally the T5pol contains both D164A and E166A mutations relative to SEQ ID NO: 1116.

183. The system of any one of claims 172-182, wherein the T5 pol and the nCas9 are covalently linked in the polypeptide in a specific order from the N-terminus to the C-terminus, wherein the order is NLS – nCas9 – adapter – NLS – adapter – T5Pol – adapter – NLS – NLS; optionally, wherein the T5 pol contains a mutation at D164 or E166 relative to SEQ ID NO: 1116, optionally wherein the T5 pol contains mutations at D164A and E166A relative to SEQ ID NO: 1116.

184. The system of any one of claims 172-183, wherein the T5Pol and the nCas9 are covalently linked sequentially from the N-terminus to the C-terminus in the polypeptide, wherein the order is NLS-nCas9-connector-NLS-connector-T5Pol-connector-NLS-NLS-connector, wherein the T5Pol contains a mutation at D164 or E166 relative to SEQ ID NO: 1116.

185. The system of any one of claims 172-179, wherein the T5 pol or a portion thereof is operatively linked to a first cleavage inteptide and the nCas9 or a portion thereof is operatively linked to a second cleavage inteptide complementary to the first cleavage inteptide, wherein the first cleavage inteptide and the second cleavage inteptide undergo a trans-splicing reaction resulting in the formation of a single fusion polypeptide comprising the polK and the nCas9 from the N-terminus to the C-terminus.

186. The system of claim 185, wherein the T5 pol is operatively connected to a heterogeneous nucleus localization signal (NLS), or wherein the nCas9 is operatively connected to a heterogeneous nucleus localization signal (NLS).

187. The system of any one of claims 172-186, wherein the T5 pol and the nCas9 are covalently linked, and wherein the T5 pol and the nCas9 are operatively linked to at least one chromatin remodeling factor, further wherein the T5 pol, the nCas9, and the chromatin remodeling factor are covalently linked in the polypeptide in a sequence selected from the N-terminus to the C-terminus: 1) Chromatin remodeling agent – ​​nCas9 – T5 pol; 2) nCas9 – chromatin remodeling agent – ​​T5 pol; or 3) nCas9 – T5 pol – chromatin remodeling.

188. The system of claim 187, wherein the at least one chromatin remodeling molecule comprises the HMGB1 polypeptide.

189. The system of claim 188, wherein the HMGB1 polypeptide comprises (i) at least 90% sequence identity with SEQ ID NO: 1783-1792 and 1803-1804 or (ii) the amino acid sequences of SEQ ID NO: 1783-1792 and 1803-1804.

190. The system of any one of claims 185-189, wherein the T5 pol and the nCas9 are not covalently connected, and the T5 pol provides a 3' extended recruitment domain, wherein, The T5 pol and the 3' extended recruitment domain are covalently linked in the peptide in the following order from the N-terminus to the C-terminus: i) 3' Extended Recruitment Domain – T5Pol(D164A, E166A) – NLS; or ii) 3' Extended recruitment structure domain – connector – T5Pol(D164A, E166A) – connector – NLS.

191. The system of claim 190, wherein each NLS is independently selected from SV40 NLS, nucleoplasmic protein NLS, or c-Myc NLS.

192. The system of any one of claims 179-184 and 187-191, wherein (i) the polypeptide comprises the same as SEQ ID NO: 1124, 1127, 1129, 1132, 1134, 1137, 1140, 1142, 1145, 1147, 1150, 1152, 1155, 1157, 1160, 1162, 1165, 1167, 1170, 1172, 1216, 1219, 1224, 1254 and 1259, 1276, 1303, 1307, 1376, 1450, 1932, 1935 and 1938, each having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with the sequence; or (ii) the polypeptide comprises a sequence with SEQ ID NO: The sequence 1124, 1129, 1134, 1137, 1142, 1147, 1152, 1157, 1162, 1167, 1172, 1219, 1224, 1254 and 1259, 1276, 1307, 1932, 1935 and 1938 has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.

193. The system of any one of claims 179-184 and 187-192, wherein (i) the polypeptide comprises a sequence selected from SEQ ID NO: 1124, 1127, 1129, 1132, 1134, 1137, 1140, 1142, 1145, 1147, 1150, 1152, 1155, 1157, 1160, 1162, 1165, 1167, 1170, 1172, 1216, 1219, 1224, 1254 and 1259, 1276, 1303, 1307, 1376, 1450, 1932, 1935 and 1938, or comprises a sequence selected from SEQ ID NO: (ii) A sequence of any one of 1124, 1129, 1134, 1137, 1142, 1147, 1152, 1157, 1162, 1167, 1172, 1219, 1224, 1254 and 1259, 1276, 1307, 1932, 1935 and 1938; (ii) Encoded by a nucleotide sequence, said nucleotide sequence being consistent with SEQ ID NO: 1123, 1126, 1128, 1131, 1133, 1136, 1139, 1141, 1144, 1146, 1149, 1151, 1154, 1156, 1159, 1161, 1164, 1166, 1169, 1171, 1215, 1218, 1223, 1253 and 1258, 1275, 1302, 1306, 1375, 1449, 1931, 1934 and 1937 have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity; or (iii) encoded by a nucleotide sequence that is identical to SEQ ID NO: 1123, 1128, 1133, 1136, 1141, 1146, 1151, 1156, 1161, 1166, 1171, 1218, 1223, 1253 and 1258, 1275, 1306, 1931, 1934 and 1937 have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.

194. The system of any one of claims 190-191, wherein (i) the polypeptide comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: 1175, 1177, 1180, and 1182, optionally having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1177 or 1182; or (ii) the polypeptide is encoded by a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: 1174, 1176, 1179, and 1181, optionally having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1175 ...7, and 1182; or (ii) the polypeptide is encoded by a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of 1176 or 1181 has a nucleotide sequence with at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity.

195. A fusion polypeptide comprising polK with a mutation of GE411-412RV relative to SEQ ID NO: 1021, a SpyCas9 nickase (nCas9), and a heterologous nuclear localization signal (NLS) or a nucleic acid encoding the fusion polypeptide.

196. The fusion polypeptide or nucleic acid of claim 195, wherein the polK comprises (1) an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with amino acid residues 19-526 of SEQ ID NO: 1021; or (2) an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with amino acid residues 19-526 of SEQ ID NO: 1021; or (3) the amino acid sequence of residues 19-526 of SEQ ID NO: 1021.

197. The fusion polypeptide or nucleic acid of any one of claims 195 or 196, wherein the polK is encoded by a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: 1020 or 1205.

198. The fusion polypeptide or nucleic acid according to any one of claims 195-197, wherein the polK and nCas9 are in the following order from the N-terminus to the C-terminus: (i) polK-nCas9; or (ii) nCas9-polK.

199. The fusion polypeptide or nucleic acid according to any one of claims 195-198, wherein the fusion polypeptide or nucleic acid further comprises a peptide linker or a heteronuclear localization signal (NLS), optionally wherein the polK and the nCas9 are covalently linked in a sequence selected from the following from the N-terminus to the C-terminus: 1) NLS-nCas9-NLS-polK; 2) NLS-nCas9-connector-NLS-connector-polK; 3) polK-NLS-nCas9-NLS; 4) polK – connector – NLS – connector – nCas9 – connector – NLS; 5) NLS- nCas9- NLS- polK (GE411-412RV); 6) NLS-nCas9-connector-NLS-polK (GE411-412RV); 7) NLS- nCas9-NLS- polΚ (19-526); 8) NLS-nCas9-connector-NLS-connector-polK (19-526); 9) polΚ (19-526)-NLS – nCas9 – NLS; 10) polK (19-526)-connector- NLS –connector- nCas9-connector- NLS; 11) polΚ (GE411-412RV)-NLS – NLS – nCas9; 12) polK (GE411-412RV) - Connector - NLS - Connector - NLS - nCas9; 13) NLS- nCas9 –NLS -polΚ (19-526, GE411-412RV); 14) NLS-nCas9 – Connector-NLS-Connector-polK (19-526, GE411-412RV); 15) NLS- nCas9 – NLS – polΚ -NLS; 16) NLS-nCas9 – Connector – NLS – Connector – polK- Connector-NLS; 17) NLS- nCas9–NLS – polΚ(1-526, GE411-412RV) – NLS; 18) NLS-nCas9 – Connector – NLS – Connector – polK (1-526, GE411-412RV) – Connector – NLS; 19) nCas9-polK (1-526); 20) polK(1-526, GE411-412RV)-nCas9-NLS-heterodimerization domain, wherein the heterodimerization domain optionally comprises a coiled-helical heterodimerization domain, optionally an EI domain or a KI domain. 21) polK(1-526, GE411-412RV)-connector-NLS-nCas9-connector-NLS-heterodimerization domain, wherein the heterodimerization domain optionally comprises a coiled helical heterodimerization domain, optionally an EI domain or a KI domain. Optionally, the order is NLS-nCas9–connector-NLS–connector-polK (1-526, GE411-412RV)–connector-NLS, and optionally also includes a heterodimerizing domain containing a coiled helical heterodimerizing domain, optionally an EI domain or a KI domain.

200. The fusion polypeptide of any one of claims 195-199, wherein polK and nCas9 are covalently linked sequentially from the N-terminus to the C-terminus of the polypeptide, wherein the order is: 1) SV40 NLS-nCas9-Connector-SV40 NLS-Connector-polK (1-526, GE411-412RV)-Connector-SV40NLS; 2) SV40 NLS-nCas9-Connector-SV40 NLS-Connector-polK (1-526, GE411-412RV)-Connector-SV40NLS-Connector-EI structural domain; or 3) SV40 NLS-nCas9-Connector-SV40 NLS-Connector-polK (1-526, GE411-412RV)-Connector-SV40NLS-Connector-KI structural domain.

201. The fusion polypeptide or nucleic acid according to any one of claims 195-200, wherein (i) the polypeptide comprises a sequence selected from SEQ ID NO: 1024, 1027, 1030, 1036, 1039, 1042, 1045, 1048, 1053, 1056, 1059, 1074, 1200, 1202, 1229, 1234 and 1268, 1300, 1373, 1388, 1447, 1453, 1923, 1926 and 1929; or (ii) the polypeptide is encoded by a nucleic acid comprising a nucleotide sequence, the nucleotide sequence being identical to ... NO:1023, 1026, 1029, 1035, 1038, 1041, 1044, 1047, 1052, 1055, 1058, 1073, 1199, 1201, 1228, 1233 and 1267 and 1299, 1372, 1387, 1446, 1452, 1922, 1925 and 1928 have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.

202. A fusion polypeptide comprising a T5 pol containing D164A and E166A mutations relative to SEQ ID NO: 1116, a SpyCas9 nickase (nCas9), a heterologous nuclear localization signal (NLS), and optionally a heterodimerization domain or a nucleic acid encoding the fusion polypeptide thereof.

203. The fusion polypeptide or nucleic acid of claim 202, wherein the T5 pol comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any of SEQ ID NO: 1116 or 1121, optionally further wherein the T5 pol comprises a heterodimerization domain.

204. The fusion polypeptide or nucleic acid of claim 202 or 203, wherein the T5 pol comprises an N-terminal deletion of 30 amino acids relative to SEQ ID NO: 1116.

205. The fusion polypeptide or nucleic acid according to any one of claims 202-204, wherein the T5 pol is encoded by a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: 1115 or 1120.

206. The fusion polypeptide or nucleic acid according to any one of claims 202-205, wherein the T5 pol and the nCas9 are in the following order from the N-terminus to the C-terminus: (i) nCas9-T5 pol or (ii) T5 pol-nCas9.

207. The fusion polypeptide or nucleic acid according to any one of claims 202-206, wherein the T5Pol and nCas9 are covalently linked in a sequence selected from the following from the N-terminus to the C-terminus: 1) nCas9-T5Pol-NLS 2) nCas9-connector – T5Pol –connector – NLS; 3) T5Pol –nCas9 - NLS; 4) T5Pol – Connector – nCas9 – Connector – NLS; 5) NLS – nCas9 – NLS- T5Pol – binding site – NLS- NLS; 6) NLS – nCas9 – Connector – NLS-Connector – T5Pol – Connector – MCP – Connector – NLS-Connector – NLS; 7) nCas9 – Connector – T5Pol – Connector – NLS; 8) nCas9 – T5Pol(N30del) – NLS; 9) nCas9 – Connector – T5Pol(N30del) – Connector – NLS; 10) nCas9 – T5Pol(A593R) – NLS; 11) nCas9 – Connector – T5Pol(DA593R) – Connector – NLS; 12) NLS- nCas9 – NLS- T5Pol – NLS –NLS; 13) NLS-nCas9 – Connector – NLS- Connector – T5Pol- Connector – NLS – Connector – NLS; 14) nCas9 –NLS –T5Pol; 15) nCas9 – Connector – NLS – Connector – T5Pol; 16) NLS- nCas9 – NLS- T5Pol –NLS – NLS; 17) NLS – nCas9 – Connector – NLS-Connector – T5Pol – Connector – NLS – NLS; 18) nCas9 –T5Pol(K425I) –NLS; 19) nCas9 – Connector – T5Pol(K425I) – Connector – NLS; 20) nCas9-T5Pol-NLS-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled-helical heterodimerization domain, optionally an EI domain or a KI domain; or 21) nCas9-connector-T5Pol-connector-NLS-connector-heterodimerization domain, optionally wherein the heterodimerization domain comprises a coiled-helical heterodimerization domain, optionally an EI domain or a KI domain. Optionally, the T5pol contains a mutation at D164 or E166 relative to SEQ ID NO: 1116, and optionally the T5pol contains both D164A and E166A mutations relative to SEQ ID NO: 1116.

208. The fusion polypeptide or nucleic acid according to any one of claims 202-207, wherein the T5 pol and the nCas9 are covalently linked in the polypeptide in a specific order from the N-terminus to the C-terminus, wherein the order is NLS – nCas9 – adapter – NLS – adapter – T5Pol – adapter – NLS – NLS; optionally, wherein the T5 pol contains a mutation at D164 or E166 relative to SEQ ID NO: 1116, optionally wherein the T5 pol contains mutations at D164A and E166A relative to SEQ ID NO: 1116.

209. The fusion polypeptide or nucleic acid according to any one of claims 202-208, wherein the polypeptide comprises a sequence selected from any one of SEQ ID NO: 1124, 1127, 1129, 1132, 1134, 1137, 1140, 1142, 1145, 1147, 1150, 1152, 1155, 1157, 1160, 1162, 1165, 1167, 1170, 1172, 1216, 1219, 1224, 1254 and 1259, 1276, 1303, 1307, 1376, 1450, 1932, 1935 and 1938, optionally selected from SEQ ID NO: A sequence of any one of 1124, 1129, 1134, 1137, 1142, 1147, 1152, 1157, 1162, 1167, 1172, 1219, 1224, 1254 and 1259, 1276, 1307, 1932, 1935 and 1938.

210. The fusion polypeptide or nucleic acid according to any one of claims 202-209, wherein the polypeptide is encoded by a nucleotide sequence, the nucleotide sequence being consistent with SEQ ID NO: 1123, 1126, 1128, 1131, 1133, 1136, 1139, 1141, 1144, 1146, 1149, 1151, 1154, 1156, 1159, 1161, 1164, 1166, 1169, 1171, 1215, 1218, 1223, 1253 and 1258, 1275, 1302, 1306, 1375, 1449, 1931, 1934 and 1937 have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity, optionally with SEQ ID NO: The nucleotide sequences 1123, 1128, 1133, 1136, 1141, 1146, 1151, 1156, 1161, 1166, 1171, 1218, 1223, 1253 and 1258, 1275, 1306, 1931, 1934 and 1937 have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.

211. A system comprising (i) a fusion polypeptide comprising a DNA-dependent DNA polymerase and a SpyCas9 nickase (nCas9), and a nucleic acid encoding the fusion polypeptide; (ii) a template guide RNA (tgRNA); and (iii) a template-based genome editing enhancer, wherein: 1) The fusion polypeptide comprising the DNA-dependent DNA polymerase and the nCas9 is any one of claims 45-65, 82-111 or 582-627; 2) The tgRNA comprises a first polynucleotide and a second polynucleotide, wherein: i) The first polynucleotide contains SpyCas9 guide RNA, which comprises from 5' to 3': 1) Spacers complementary to the target region of the target strand of the DNA duplex target nucleic acid; and 2) Stent; and ii) The second polynucleotide is operatively linked to the first polynucleotide and comprises from 5' to 3': 1) A template sequence having a length of at least 10 nucleotides and being complementary to at least a portion of the non-target strand of the target nucleic acid of the DNA duplex, wherein the template sequence comprises a 3' end and a 5' end; and wherein the template comprises DNA nucleotides; 2) A DNA-dependent DNA polymerase recruitment sequence (DRS) of 6-20 nucleotides in length, optionally 8-17 or 10-14 nucleotides in length, and having a 3' end and a 5' end; wherein the 5' end of the DRS is covalently attached to the 3' end of the template sequence, and wherein the DRS comprises a sequence of at least 6 consecutive nucleotides complementary to the DRS complementary region of the non-target strand of the DNA duplex target nucleic acid; and 3) The template-based genome editing enhancer.

212. The system of claim 211, wherein the enhancer of the template-based genome editing is a deoxynucleotide triphosphate hydrolase inhibitor, optionally wherein the deoxynucleotide triphosphate hydrolase inhibitor comprises Vpx, BGLF4, M97 or ORF36.

213. The system of claim 211 or 212, wherein the template-based genome editing enhancer is selected from: i) Vpx protein comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any of SEQ ID NO: 1464, 1469, and 1503-1505, optionally wherein the Vpx protein includes or lacks an N-terminal methionine relative to any of SEQ ID NO: 1464, 1469, and 1503-1505, or a nucleic acid encoding the amino acid sequence; ii) BGLF4 protein comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1517 or 1518, optionally wherein the BGLF4 protein includes or lacks an N-terminal methionine relative to SEQ ID NO: 1517 or 1518, or a nucleic acid encoding the amino acid sequence; or iii) M97 protein comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1500, optionally wherein the M97 protein includes or lacks an N-terminal methionine relative to SEQ ID NO: 1500, or a nucleic acid encoding the amino acid sequence; or iv) KSHV ORF36 protein comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 1576, optionally wherein the KSHV ORF36 protein includes or lacks an N-terminal methionine relative to SEQ ID NO: 1576, or a nucleic acid encoding the amino acid sequence.

214. The system of any one of claims 211-213, wherein the deoxynucleotide triphosphate hydrolase inhibitor is encoded by a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: 1462, 1463, 1468, 1470, 1499, 1501, 1502, 1521-1523, 1574-1575, 1585, and 3530.

215. The system of claim 211, wherein the template-based genome editing enhancer is a DNA repair protein or a nucleic acid encoding the amino acid sequence.

216. The system of claim 215, wherein the DNA repair protein is a single-stranded endonuclease that removes the 5' lobe at the 3' end of the nick, optionally lobe-specific endonuclease 1 (FEN1) or MLH1.

217. The system of any one of claims 215-216, wherein the DNA repair protein is selected from: i) FEN1 protein comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: 1467, 1475, 1480, 1490, 1495, 1510-1516, and 1550-1555, optionally wherein the FEN1 protein includes or lacks an N-terminal methionine relative to any one of SEQ ID NO: 1467, 1475, 1485, 1490, 1495, and 1510-1516, or a nucleic acid encoding the amino acid sequence; or ii) MLH1 protein comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any of SEQ ID NO: 1572 or 1573, optionally wherein the MLH1 protein includes or lacks an N-terminal methionine relative to any of SEQ ID NO: 1572 or 1573, or a nucleic acid encoding the amino acid sequence.

218. The system of any one of claims 211-217, wherein the system comprises at least two template-based genome editing enhancers.

219. The system of claim 218, wherein the at least two template-based genome editing enhancers comprise Vpx and FEN-1.

220. The system of claim 219, wherein the at least two enhancers of Vpx and FEN1 are encoded on the same polypeptide, optionally wherein the polypeptide encoding Vpx and FEN1 comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: 1578, 1580, 1582, and 1584; or wherein the polypeptide encoding Vpx and FEN1 is encoded by a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: 1577, 1579, 1581 and 1583, 3523, 3524, 3526, and 3527.

221. The system of any one of claims 1-59, 139-194 or 211-220, or the fusion protein or nucleic acid of any one of claims 195-210, wherein the heterologous NLS is independently selected from nucleoplasmic protein NLS, C-Myc NLS and SV40 NLS, and the adapter is independently selected from SEQ ID NO: 1596, 1597, 1600, 1601, 1605, 1661, 1735, 1738 and 1815.

222. The system of any one of claims 1-59, 139-194 or 211-220 or the fusion protein or nucleic acid of any one of claims 195-210, wherein the adapter comprises the amino acid sequence of any one of SEQ ID NO: 1596-1665, 1735, 1738, 1815, 1825, 1827 and 1829-1830.

223. The nucleic acid of any one of claims 195-210 and 221-222, wherein the nucleotide sequence encoding the polypeptide comprises the nCas9 or DNA-dependent DNA polymerase, or the fusion protein comprises: i) A hat selected from hat 0 or hat 1; ii) 5' UTR selected from SEQ ID NO: 1720-1723; iii) Kozak sequences selected from SEQ ID NO: 1724 and 1725; iv) 3' UTR selected from SEQ ID NO: 1684 and 1740; v) Selected from the poly-A tails of SEQ ID NO: 1741 and 1742; or vi) (i)-(v) combinations of two, three, four or five.

224. The system of any one of claims 1-59, 139-194, and 211-223, wherein the DNA-dependent DNA polymerase, nCas9, and enhancer are provided in the form of one or more polypeptides.

225. The system of any one of claims 1-59, 139-194, and 211-223, wherein the DNA-dependent DNA polymerase, nCas9, and enhancer are provided in the form of one or more nucleic acids.

226. A system comprising the nucleic acid of any one of claims 195-210 or a composition comprising the nucleic acid of any one of claims 195-210 and a template-based genome editing enhancer, said system or said composition optionally further comprising the template guide RNA of any one of claims 60-138.

227. The system or composition of claim 226, wherein the template-based genome editing enhancer comprises a nucleic acid encoding the template-based genome editing enhancer or an enhancer of the template-based genome editing polypeptide.

228. The system or composition of claim 226 or 227, wherein the template-based genome editing enhancer is a deoxynucleotide triphosphate hydrolase inhibitor.

229. The system of any one of claims 226-228, wherein the deoxynucleotide triphosphate hydrolase comprises a SAM domain and a protein 1 (SAMHD1) containing an HD domain.

230. The system or composition of claim 229, wherein the SAMHD1 inhibitor comprises a microRNA, shRNA, or siRNA that hybridizes with SAMHD1 mRNA.

231. The system or composition of claim 229, wherein the SAMHD1 inhibitor comprises Vpx, BGLF4, M97, or KSHV ORF36.

232. The system or composition of claim 227 or 228, wherein the template-based genome editing enhancer is a DNA repair protein or a nucleic acid encoding the amino acid sequence.

233. The system or composition of claim 232, wherein the DNA repair protein is a valve-specific endonuclease 1 (FEN1) or wherein the DNA repair protein is MLH1.

234. The system or composition of any one of claims 232-233, wherein the DNA repair protein comprises a heterodimerization domain or further comprises an additional heterodimerization domain.

235. The system or composition of any one of claims 232 or 234, wherein the DNA repair protein is selected from: i) FEN1 protein comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any of SEQ ID NO: 1467, 1475, 1485, 1490, 1495, and 1510-1516, optionally wherein the FEN1 protein includes or lacks an N-terminal methionine relative to any of SEQ ID NO: 1467, 1475, 1485, 1490, 1495, and 1510-1516, or a nucleic acid encoding the amino acid sequence; or ii) MLH1 protein comprising an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any of SEQ ID NO: 1572 or 1573, optionally wherein the MLH1 protein includes or lacks an N-terminal methionine relative to any of SEQ ID NO: 1572 or 1573, or a nucleic acid encoding the amino acid sequence.

236. The system or composition of any one of claims 226-235, wherein the system or composition comprises two nucleic acids encoding two template-based genome editing enhancers, optionally comprising (i) Vpx and FEN-1 or (ii) M97 and FEN-1.

237. The system or composition according to any one of claims 1-59, 139-194 and 221-236, wherein the system or composition further comprises nicking guide RNA (ngRNA).

238. The system or composition of claim 237, wherein the ngRNA comprises a spacer complementary to the non-target strand of the DNA duplex target nucleic acid.

239. The system or composition of claim 238, wherein the ngRNA comprises a spacer that hybridizes to a sequence on the non-target strand, such that (i) the cleavage site of the ngRNA is within 5' or 3' 200 nucleotides from the cleavage site of the template guide RNA; (ii) the cleavage site of the ngRNA is within 5' or 3' 20-200 nucleotides from the cleavage site of the template guide RNA; or (iii) the cleavage site of the ngRNA is located outside the genomic locus of the spacer sequence of the template guide RNA.

240. The system or composition of any one of claims 237-239, wherein the ngRNA comprises, from 5' to 3', a guide sequence and any one of SEQ ID NO: 5, 27, 35, 210, 223, 269, 370, 201-208, 373-374, and 393-400; (ii) a SpyCas9 guide RNA comprising, from 5' to 3', at least 90%, 91%, 92%, 93%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotide sequence of any one of SEQ ID NO: 5, 27, 35, 210, 223, 269, 370, 201-208, 373-374, 393-400, 429, and 430; or (iii) a SpyCas9 guide RNA comprising, from 5' to 3', a guide sequence and any one of SEQ ID NO: 5, 27, 35, 210, 223, 269, 370, 201-208, 373-374, 393-400, 429, and 430; The nucleotide sequence of at least 90%, 91%, 92%, 93%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of any one of 310, 319-326, 347-349, 371, 384-392, 434, 438.

241. The system, fusion protein, or composition according to any one of claims 1-59 and 139-240, (i) wherein the nCas9 comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: 972, 974, 976, 982, 984, 986, 988, 990, 992, 994, 996, 998, 1000, and 1014, optionally wherein the nCas9 comprises an amino acid sequence of any one of SEQ ID NO: 972, 974, 976, 982, 984, 986, 988, 990, 992, 994, 996, 998, 1000, and 1014, optionally wherein the nCas9 protein is relative to SEQ ID NO: 972, 974, 976, 982, 984, 986, 988, 990, 992, 994, 996, 998, 1000, and 1014 include or lack an N-terminal methionine; or (ii) wherein the nCas9 is encoded by a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any of SEQ ID NO: 971, 973, 975, 981, 983, 985, 987, 989, 991, 993, 995, 997, 999, and 1013, optionally wherein the nCas9 is encoded by SEQ ID NO: The nucleotide sequence of any one of SEQ ID NO: 971, 973, 975, 981, 983, 985, 987, 989, 991, 993, 995, 997, 999 and 1013 encodes, optionally wherein the nCas9 protein includes or lacks a start codon or a stop codon relative to any one of SEQ ID NO: 971, 973, 975, 981, 983, 985, 987, 989, 991, 993, 995, 997, 999 and 1013.

242. The system, fusion protein, or composition according to any one of claims 1-59 and 139-241, wherein the nCas9 comprises the H840A point mutation.

243. The system, fusion protein, or composition of any one of claims 226-242, wherein the nucleotide sequence encoding the nCas9, DNA-dependent DNA polymerase, nCas9 / DNA-dependent DNA polymerase fusion protein, template-based genome editing enhancer, or Sso7 DNA-binding cofactor comprises a 5' cap selected from cap 0, cap 1, and cap 2.

244. The system, fusion protein, or composition of any one of claims 226-243, wherein the polynucleotide further comprises a polyadenylation (poly-A) tail sequence or a polyadenylation signal sequence.

245. The system, fusion protein, or composition of any one of claims 243 or 244, wherein the poly-A sequence comprises the sequence of any one of SEQ ID NO: 1692-1693 and 1741-1742.

246. The system, fusion protein, or composition according to any one of claims 226-245, wherein at least 70%, 75%, 80%, 85%, 90%, or 95% of the uridine in the nucleic acid is replaced by a modified uridine, optionally wherein the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine, 5-methoxyuridine, or 5-iodouridine.

247. The system or composition of any one of claims 1-59, 139-194 and 211-246, wherein the system or composition further comprises a template guide RNA, if not present, wherein the template guide RNA is the template guide RNA of any one of claims 60-138.

248. The system or composition of claim 247, wherein the DRS that binds to the complementary region of the DRS in the non-target strand of the target nucleic acid of the DNA duplex forms a binding site for a DNA-dependent DNA polymerase, optionally wherein the DNA-dependent DNA polymerase is polK or T5 pol.

249. The system or composition of any one of claims 247-248, wherein (i) the DRS has 0, 1, 2, 3, or 4 mismatches with the corresponding genomic sequence; (ii) the 6 terminal nucleotides at the 5' end of the DRS have 0, 1, 2, or 3 mismatches with the corresponding genomic sequence; (iii) the first 3 nucleotides at the 3' end of the DRS have 0, 1, or 2 mismatches with the genomic sequence; (iv) the DRS is 100% complementary to the corresponding genomic sequence for no more than 6 consecutive nucleotides, optionally no more than 4 consecutive nucleotides, without mismatch breaks; or (v) the 10 terminal nucleotides at the 5' end of the DRS are 100% complementary to the corresponding genomic sequence.

250. The system or composition of any one of claims 247-249, wherein at least one mismatched RNA nucleotide in the DRS comprises a modified RNA nucleotide, and optionally all mismatched RNA nucleotides in the DRS comprise modified RNA nucleotides.

251. The system or composition according to any one of claims 247-250, wherein the template sequence is 10-10000 nucleotides in length, optionally 10-20, 10-100, or 10-500 nucleotides.

252. The system or composition of any one of claims 247-251, wherein the template sequence is 14-18 nucleotides in length, optionally 14 or 15 nucleotides in length.

253. The system or composition of any one of claims 247-252, wherein the template sequence further comprises at least two nucleotides at the 5' of the sequence to be edited by template-based genome editing, wherein at least eight nucleotides on the template are paired with the non-target strand bases of the DNA duplex target nucleic acid.

254. The system or composition of any one of claims 247-253, wherein the template sequence further comprises at least 5 nucleotides at the 5' of the sequence to be edited by template-based genome editing, wherein at least 10 nucleotides on the template are paired with the non-target strand bases of the DNA duplex target nucleic acid.

255. The system or composition of any one of claims 247-254, wherein the template sequence comprises a sequence of at least five consecutive nucleotides that pair with the non-target strand bases of the DNA duplex target nucleic acid.

256. The system or composition of any one of claims 247-255, wherein the template sequence comprises a mismatch with the genomic sequence at at least one of positions 1-6, optionally at at least one of positions 5-6 (positions T1-T6, optionally positions T5-T6) at the template junction 5' of the DRS.

257. The system or composition of claim 256, wherein the template sequence contains a mismatch with the genomic sequence at at least one of positions 1-6, optionally introducing a silent mutation at at least one of positions 5-6 at the template junction of the DRS with the DRS.

258. The system or composition of claim 256, wherein the template sequence comprises a mismatch with the genome sequence at at least one of positions T1-T6, optionally at at least one of positions T5-T6 at the 5' of the template junction with the DRS, wherein the template introduces a change in the amino acid sequence encoded by the genome sequence.

259. The system or composition of any one of claims 247-258, wherein the template sequence comprises an insertion sequence relative to the corresponding genomic sequence.

260. The system or composition of claim 259, wherein the template sequence comprises an insert sequence of up to 500, 1000, 3500 or 5000 nucleotides in length, optionally up to 10,000 nucleotides in length.

261. The system or composition of claim 259 or 260, wherein the length of the templated insertion is 1-10, 1-20, 1-50, 1-75, or 1-100 nucleotides.

262. The system or composition of any one of claims 247-261, wherein the template sequence comprises a sequence for guiding deletion relative to a corresponding genomic sequence.

263. The system or composition of claim 262, wherein the template sequence comprises a sequence for guiding deletions of at least 3, 10, 15, 20, 30, 40 or 50 nucleotides in length, optionally wherein the template sequence comprises a sequence for guiding deletions of up to 3,500 nucleotides in length, optionally up to 10,000 nucleotides in length.

264. The system or composition of any one of claims 247-263, wherein the template sequence comprises at least one mismatch relative to a corresponding genomic sequence, optionally at least three mismatches, wherein the mismatch provides the template sequence for template-based genome editing comprising substitution.

265. The system or composition of any one of claims 247-264, wherein the template sequence comprises 1-10 mismatches relative to a corresponding genomic sequence, wherein the mismatches provide the template sequence for template-based genome editing including substitutions.

266. The system or composition of claim 264 or 265, wherein the substitution is a change or transversion.

267. The system or composition of any one of claims 264-266, wherein the template-based editing of the genome sequence results in a change in the amino acid sequence encoded by a locus present in the genome sequence.

268. The system or composition of any one of claims 264-267, wherein the template-based editing of the genome sequence does not result in a change in the amino acid sequence encoded by a locus present in the genome sequence.

269. The system or composition of any one of claims 264-268, wherein the template further comprises an insert sequence or a sequence for guiding the missing sequence.

270. The system, tgRNA, or composition of any one of claims 1-194 and 211-269, wherein the SpyCas9 guide RNA comprises a spacer sequence and a SpyCas9 guide RNA scaffold sequence from 5' to 3'.

271. The system, tgRNA, or composition of any one of claims 1-194 and 211-270, wherein the SpyCas9 guide RNA scaffold sequence comprises an internal adapter.

272. The system, tgRNA, or composition according to any one of claims 1-194 and 211-271, wherein the spacer of the guide RNA comprises DNA nucleotides.

273. The system, tgRNA, or composition of any one of claims 1-194 and 211-272, wherein the spacer or scaffold of the guide RNA comprises a modified nucleotide selected from 2'-O-methyl (2'-O-Me) modified nucleotides or 2'-F modified nucleotides, or wherein the spacer or scaffold of the guide RNA comprises a phosphate thioester (PS) bond between nucleotides.

274. The system, tgRNA, or composition according to any one of claims 1-194 and 211-273, wherein the guide RNA comprises DNA nucleotides at at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of the spacer, optionally wherein the guide RNA comprises DNA nucleotides at one or more of positions S11, S12, and S18.

275. The system, tgRNA, or composition as described in any one of claims 1-194 and 211-274.

276. The system, tgRNA, or composition according to any one of claims 1-194 and 211-275, wherein the guide RNA comprises 2'-O-Me or 2'-F modified nucleotides at at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of the spacer, optionally wherein the guide RNA comprises 2'-O-Me or 2'-F modified nucleotides at one or more of positions S4, S5, S9, S10, S13, S14, S17, and S20.

277. The system, tgRNA, or composition according to any one of claims 1-194 and 211-276, wherein the guide RNA is terminated with 1-4 uridine nucleotides or 1-4 modified uridine nucleotides, optionally with a modified uridine nucleotide at the 3' end.

278. The system, tgRNA, or composition according to any one of claims 1-194 and 211-277, wherein the guide RNA comprises a 3' end modification and a 5' end modification.

279. The system, tgRNA, or composition of claim 278, wherein the 3' or 5' modification comprises or further comprises a 2'-O-methyl (2'-O-Me) modified nucleotide or a phosphate thioester (PS) bond between nucleotides.

280. The system, tgRNA, or composition of any one of claims 1-194 and 211-279, wherein the SpyCas9 guide RNA comprises, from 5' to 3', a spacer subsequence and a scaffold sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: 4, 5, 27, 370, 429, and 430, or a scaffold portion of any one of the sequences listed in Tables 1A to 1D.

281. The system, tgRNA, or composition according to any one of claims 1-194 and 211-280, wherein the SpyCas9 guide RNA comprises (a) a modified nucleotide sequence having at least 90% identity with any one of SEQ ID NO: 201-218, 223, 224, 225-231, 232-235, 236, 237-239, 240-269, 270-276, 300-318, 319, 323-325, 326-344, 345-349 and 372-374, 375-383 and 431-434 or any one of the sequences listed in Table 1C and Table 1D, or with SEQ ID NO: (a) A modified nucleotide sequence having at least 90%, 95%, or 98% identity with any of SEQ ID NO: 201-218, 223, 224, 225-269, 270-271, 272-273, 274, 275, 276, 300-318, 323-325, 326-344, 345-346, 347-349, 372-383 and 431-433, 434, or any of the sequences listed in Tables 1C and 1D, or a modified nucleotide sequence having at least 90 ... The SpyCas9 guide RNA comprises any of SEQ ID NO: 201-218, 223, 224, 225-250, 269, 272-273, 274, 275, 276, 301-318, 323-325, 326-334, 347-349, 372-374, and 431-433, 434; or the SpyCas9 guide RNA comprises any of SEQ ID NO: 201-274, 384-400, 429-430, and 435-454. The modified nucleotide sequence of any of 201-218, 224, 225-231, 232-235, 236, 237-239, 240-269, 270-273, 274, 275, 276, 300-318, 319, 323-325, 326-344, 345-349, 372-374 and 375-383 or any of the sequences listed in Tables 1C and 1D, or the modified nucleotide sequence of any of SEQ ID NO: 350-374 and 384-400, 429-430, 435-454 or any of the sequences listed in Table 4;Or (b) a modified nucleotide sequence of any of SEQ ID NO: 201-218, 224, 225-269, 270-271, 272-273, 274, 275, 276, 300-318, 319, 323-325, 326-344, 345-346, 347-349, 372-383 and 431-433, 434, or any of the sequences listed in Tables 1C and 1D, or a modified nucleotide sequence of any of SEQ ID NO: 350-374 and 384-400 and 435-454, or any of the sequences listed in Table 4; optionally, wherein the SpyCas9 guide RNA comprises SEQ ID NO: Modified nucleotide sequences of any of the following: 201-218, 224, 225-250, 269, 272-273, 274, 275, 276, 301-318, 319, 323-325, 326-334, 347-349, 372-374, and 431-433, 434.

282. The system, tgRNA, or composition according to any one of claims 1-194 and 211-281, wherein the SpyCas9 guide RNA comprises: i) mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGA(L3)AAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGCACCGAGUCGGmU*mG*mC*mU (SEQ ID NO: 371) or a sequence having at least 90%, 95%, 98% or 99% identity with SEQ ID NO: 371; ii) mN*mN*mN*NNNNNNNNNNNNNNNNNmGUUUUAGmAmGmC(L1)mGmCmAAGUUmAAmAAmUmAmAGmGCUmAGUCmCmGUUAUmCAmC(L1)mGGmGmCmAmCmGmAGUCmGmGmUmGmC(L1)mGGmGmCmAmCmGmAGUCmGmGmUmGmC (SEQ ID NO: 347) or a sequence having at least 90%, 95%, 98% or 99% identity with SEQ ID NO: 347; or iii) mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmA(L1)mUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAC(L1)GGGCACCGAGUCGGmUmGmC (SEQ ID NO: 348) or a sequence having at least 90%, 95%, 98% or 99% identity with SEQ ID NO: 348; The asterisk (*) indicates that the nucleotide is linked to the next nucleotide via a PS bond, and the lowercase "m" indicates that the nucleotide is modified with 2'-O-Me, where N is any nucleotide.

283. A lipid nanoparticle (LNP) composition comprising the system, tgRNA, guide RNA, or composition as described in any one of claims 1-194 and 211-282.

284. The system, tgRNA, guide RNA, composition, or LNP composition according to any one of claims 1-194 and 211-283, wherein one or more of the tgRNA, first polynucleotide, second polynucleotide, nucleic acid encoding the DNA-dependent DNA polymerase, nucleic acid encoding the nCas9, or nucleic acid encoding the fusion protein are associated with one or more LNPs.

285. The system, tgRNA, guide RNA, composition, or LNP composition of any one of claims 1-194 and 211-284, wherein the DNA-dependent DNA polymerase and nCas9 are fusion proteins encoded by a single mRNA associated with an LNP; or, wherein the tgRNA is associated with a single LNP from which the LNP is associated with the mRNA encoding the DNA-dependent DNA polymerase and nCas9 is a fusion protein, optionally wherein the system or composition further comprises mRNA encoding a template-based genome editing enhancer associated with the LNP.

286. The system, tgRNA, guide RNA, composition or LNP composition of any one of claims 283-285, wherein the LNP comprises (i) ionizable lipids; (ii) accessory lipids; (iii) stealth lipids; (iv) neutral lipids; or a combination of one or more of (i)-(iv).

287. The system, tgRNA, guide RNA, composition, or LNP composition of claim 286, wherein the ionizable lipid is octadecyl-9,12-dienoic acid (9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester, also known as (9Z,12Z)-octadecyl-9,12-dienoic acid 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ester.

288. The system, tgRNA, guide RNA, composition, or LNP composition of claim 286 or 287, wherein the accessory lipid is cholesterol; the hidden lipid is PEG-DMG; or the neutral lipid is DSPC.

289. A pharmaceutical composition comprising the system, tgRNA, guide RNA, composition, fusion peptide or LNP composition of any one of claims 1-194 and 211-288, and a pharmaceutically acceptable carrier.

290. A method for template-based genome editing, the method comprising delivering to a cell or subject the system, tgRNA, guide RNA, composition, or LNP composition of any one of claims 1-194 and 211-288, or the fusion polypeptide or nucleic acid of any one of claims 195-210.

291. The use of the system, tgRNA, guide RNA, composition or LNP composition or the fusion polypeptide or nucleic acid of any one of claims 1-194 and 211-288 for template-based genome editing in cells or subjects.

292. The method or use of claim 290 or 291, wherein template-based genome editing produces edits comprising insertions or deletions in a nucleotide sequence.

293. The method or use of claim 290 or 291, wherein template-based genome editing produces an edit comprising substitutions in a nucleotide sequence, optionally wherein the substitutions are transitions or transversions.

294. The method or use of any one of claims 290-293, wherein the template-based genome editing produces at least 20%, 25%, 30%, 35%, 40%, 45%, optionally at least 50%, 55%, 60%, 65%, optionally at least 70%, 75%, or 80% of the total edited content in the target nucleic acid, and further optionally, no more than 30% of the templated edits, and optionally no more than 20% or 10% of the templated edits, further include byproduct editing.

295. The method or use of any one of claims 290-294, wherein the cell is a quiescent cell, optionally wherein the quiescent cell is selected from hepatocytes, inactive T cells, muscle cells, neuronal cells and lung cells, and wherein at least 5% of the cells in the cell population contain template-based genome editing in the target nucleic acid.

296. The method or use as described in any one of claims 290-295, wherein the cell is a primary cell.

297. The method or use of any one of claims 290-296, wherein the cell is an immune cell and wherein at least 50% of the cells in the cell population contain template-based genome editing in the target nucleic acid, optionally wherein no more than 30% of the templated editing, optionally no more than 20% or 10% of the templated editing further comprises byproduct editing.

298. The method or use of any one of claims 290-297, wherein (i) the length of the templated insert is at least 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, optionally wherein the length of the templated insert is 1-10, 1-20, 1-50, 1-75 or 1-100 nucleotides; or (ii) the length of the templated insert is at most 500, 1000, 3500, 5000 or 10,000 nucleotides.

299. A method for generating conjugated template guide RNA (tgRNA), the method comprising: Provide a first polynucleotide comprising a 3' end, wherein the 3' end comprises at least 10 nucleotides; Provide a second polynucleotide comprising a 5' end, wherein the 5' end comprises at least 10 nucleotides; A splint oligonucleotide is provided that can adhere to at least 10 nucleotides at the 3' end of the first polynucleotide and at least 10 nucleotides at the 5' end of the second polynucleotide; and A ligase is provided to join the 3' end of the first polynucleotide to the 5' end of the second polynucleotide, thereby forming a joined tgRNA; The tgRNA that is conjugated contains the SpyCas9 guide RNA, the template sequence, and the DNA-dependent DNA polymerase recruitment sequence (DRS).

300. A method for generating conjugated template guide RNA (tgRNA), the method comprising: Provide a first polynucleotide comprising a 3' end, wherein the 3' end comprises at least 10 nucleotides; Provides a second polynucleotide comprising a 5' end containing at least 10 nucleotides and a 3' end containing at least 10 nucleotides; Provide a third polynucleotide comprising a 5' end, wherein the 5' end comprises at least 10 nucleotides; A first splint oligonucleotide is provided that can adhere to at least 10 nucleotides at the 3' end of the first polynucleotide and at least 10 nucleotides at the 5' end of the second polynucleotide; Provides a second splint oligonucleotide capable of adhering to at least 10 nucleotides at the 3' end of the second polynucleotide and at least 10 nucleotides at the 5' end of the third polynucleotide; and One or more ligases are provided to (i) attach the 3' end of the first polynucleotide to the 5' end of the second polynucleotide and (ii) attach the 3' end of the second polynucleotide to the 5' end of the third polynucleotide, thereby forming a conjugated tgRNA. The conjugated tgRNA contains a SpyCas9 guide RNA, a template sequence, and a DNA-dependent DNA polymerase recruitment sequence (DRS).

301. The method of any one of claims 299-300, wherein the conjugated tgRNA is at least 100 nucleotides long, at least 110 nucleotides long, at least 120 nucleotides long, at least 130 nucleotides long, at least 140 nucleotides long, at least 150 nucleotides long, at least 160 nucleotides long, or at least 170 nucleotides long.

302. The method of any one of claims 299-301, further comprising separating the conjugated tgRNA from the splint oligonucleotide.

303. The method of any one of claims 299-302, further comprising a purification step of the conjugated tgRNA.

304. The method of any one of claims 299 and 301-303, wherein the splice oligonucleotide is a DNA splice oligonucleotide.

305. The method of any one of claims 299 and 301-304, wherein the length of the splint oligonucleotide is at least 15 or at least 20 nucleotides, or optionally about 15-20 nucleotides.

306. The method of any one of claims 299-305, wherein the binding occurs at the binding site within the scaffold of the SpyCas9 guide RNA.

307. The method of any one of claims 300-303 and 306, wherein the first splint oligonucleotide and the second splint oligonucleotide are DNA splint oligonucleotides.

308. The method of any one of claims 300-303 and 306-307, wherein the length of the first splint oligonucleotide is at least 15, 20, 30, 40, 50, 60, 70, 80 or 90 nucleotides, optionally about 15 to 25 nucleotides, or the length of the second splint oligonucleotide is at least 15, 20, 30, 40, 50, 60, 70, 80 or 90 nucleotides, optionally about 15 to 25 nucleotides.

309. The method of any one of claims 299-308, wherein the one or more ligases comprise RNA ligase or DNA ligase, optionally wherein the ligase comprises T4 DNA ligase or T4 RNA ligase.

310. The method of any one of claims 300-303 and 306-309, wherein the first binding occurs at a first binding site side-attached by an RNA nucleotide and the second binding occurs at a second binding site side-attached by a DNA nucleotide.

Citation Information

Patent Citations

  • RNA Modification to Engineer Cas9 Activity

    US20170114334A1

  • Backbone modified oligonucleotide analogs

    US5378825A

  • Linking reagents for nucleotide probes

    US5585481A

  • CRISPR-Cas nickase systems, methods and compositions for sequence manipulation in eukaryotes

    US8889356B2

  • Gapped 2' modified oligonucleotides

    WO1993013121A1