Identification of genomic sequences for the treatment of ataxia and epilepsy

Abstract

This invention relates to a method capable of identifying CACNA1B A gRNA molecule containing a target genomic sequence located between exons 37a and 38 of a gene, a ribonucleoprotein complex containing the gRNA molecule, a nucleic acid encoding the gRNA molecule, and a composition containing the thereof, which is used as a drug, particularly for the treatment of ataxia and epilepsy.

Description

Technical Field

[0001] This invention generally relates to the field of gene therapy and the development of guide RNA (gRNA) molecules for use with endonucleases or other CRISPR-related proteins to form ribonucleoprotein complexes capable of recognizing and modifying target genomic sequences. In particular, this invention provides a mechanism capable of recognizing… CACNA1B The gRNA molecule of a target genomic sequence located between exon 37a and exon 38 in a gene, a ribonucleoprotein complex containing one or more of the gRNA molecules, a nucleic acid encoding the gRNA molecule, and a composition comprising the thereof, the composition being used as a drug, particularly for the treatment of ataxia and epilepsy. Background Technology

[0002] As is known in this technical background, CACNA1A Gene mutations can lead to rare neurological diseases in humans. In particular, more than 100 types have been identified. CACNA1A Gene mutations can cause various forms of ataxia and epilepsy, such as type 2 episodic ataxia (OMIM # 108500), type 1 familial hemiplegic migraine (OMIM # 141500), type 6 spinocerebellar ataxia (OMIM # 183086), type 42 developmental and epileptic encephalopathy (OMIM # 617106), migraine with or without aura, and susceptibility type 5 (OMIM # 607508).

[0003] CACNA1A The primary function of genes is to regulate communication between nerve cells. In many areas of the human brain, CACNA1A Genes and similar CACNA1B Genes work together to perform this task.

[0004] CACNA1A and CACNA1B Genes all undergo alternative splicing, a process known to allow for the generation of multiple variants of messenger RNA (mRNA) starting from a single gene. In particular, CACNA1A and CACNA1B Alternative splicing in each gene produces two mutually exclusive major variants: a splice variant containing exon 37a (EFa) and a splice variant containing exon 37b (EFb).

[0005] As is known in the literature, CACNA1A The EFa variant of the gene supports communication between nerve cells more effectively than the EFb variant of its gene (Thalhammer et al., 2017). It was also found that... CACNA1BThe EFa variant of the gene is more efficient than the EFb variant of its gene in supporting communication between nerve cells (Altier et al., 2007; Andrade et al., 2010). However, in supporting communication between nerve cells, CACNA1A Gene ratio CACNA1B Genes are more effective (Cao et al., 2004; Mintz et al., 1995; Wu et al., 1999).

[0006] CACNA1A Gene functional defects lead to CACNA1B Increased expression levels serve as a compensatory mechanism (Jun et al., 1999; Qian and Noebels, 2000). Nevertheless, communication between neurons remains severely impaired (Inchauspe et al., 2007; Ishikawa et al., 2005; Maejima et al., 2013; Mark et al., 2011). Therefore, CACNA1A Diseases caused by gene mutations are at least to some extent due to CACNA1B Genes cannot fully compensate CACNA1A This is caused by a functional defect.

[0007] Current treatment CACNA1A Treatment options for gene-related diseases are limited to symptom management and / or treatment. In fact, there is currently no known cure for the gene mutations involved.

[0008] Among the recently developed treatments for diseases caused by mutations in target genes, CRISPR-based genome editing strategies are emerging. These strategies aim to create personalized medicine that corrects individual mutations that lead to genetic diseases.

[0009] However, due to the identification of a large number of mutational damages CACNA1A The function of genes is complex, and these therapeutic strategies are not easily applied to the editing of those genes. Therefore, the scientific community urgently needs effective therapeutic strategies to treat diseases caused by human diseases. CACNA1A Diseases caused by gene mutations, such as ataxia and epilepsy. Summary of the Invention

[0010] This invention is based on the discovery that promoting genome editing CACNA1B Expression of exon 37a of the gene beneficially compensates for the loss of expression due to the gene's expression. CACNA1A Mutations cause functional defects. Therefore, the use of genome editing represents an effective treatment or prevention method for diseases caused by their gene mutations, such as ataxia and epilepsy.

[0011] In particular, after thorough experimentation, the inventors developed a CRISPR-based technology.CACNA1B The gene editing strategy involves the formation of a ribonucleoprotein complex containing a CRISPR-associated protein and one or more guide RNA molecules (gRNAs) specifically designed to recognize... CACNA1B The target genomic sequence is a 20-21 nucleotide segment located between exons 37a and 38. The inventors identified a gRNA molecule capable of guiding the protein / gRNA-ribonucleoprotein complex within... CACNA1B In the target sequences of the gene, especially CACNA1B Near the branch point of exon 37b, targeted mutations or modifications are induced, particularly targeted breaks. The resulting effect is disruption. CACNA1B The branching point of gene exon 37b, for example, the induced splicing system preferentially selects exon 37a. Figure 2 (The continuous curved arrows in C) rather than exon 37b ( Figure 2 (The dashed curved arrow in C).

[0012] The inventor discovered that, CACNA1B Mutations at the branching site of exon 37b can favor less common gene mutations. CACNA1B Expression of gene splicing variants (including exon 37a (EFa)) was superior to that of more common splicing variants (including exon 37b (EFb)) without altering the expression of gene splicing variants. CACNA1B Total gene expression ( Figure 3 ).

[0013] The experimental section of this application reports... CACNA1A The results of in vivo experiments on mice with reduced gene expression clearly demonstrate the effectiveness of the technology obtained as the subject of this invention. CACNA1B The increased expression of the EFa variant can better compensate for the effects of CACNA1A Functional defects caused by gene mutations (Figure 4). In fact, the use of the CRISPR-Cas9 system and for mutations... CACNA1B The treatment of gene branching site-specific guide RNA molecules, and the resulting inclusion CACNA1B Increased expression of splice variants of exon 37a in the genome led the inventors to observe a significant correction of behavioral abnormalities in treated mice.

[0014] The genome editing strategy for which this invention is intended offers a dual advantage over traditional methods: This strategy is applicable to counterbalancing most identified [problems]. CACNA1A The effects of gene mutations mean that gene therapy can be used to treat a wider range of patients.

[0015] - CRISPR technology, which allows mutations at specific sites (such as branching sites), has shown high efficiency in terminally differentiated cells that no longer divide (such as nerve cells), and therefore could be used for gene therapy in the brain.

[0016] Therefore, the object of the present invention is a guide RNA molecule (gRNA) comprising, and CACNA1B The first part of the target genome sequence located between exon 37a and exon 38 in the gene is complementary to the target genome sequence and is used to bind to CRISPR-related proteins, particularly CRISPR-related endonucleases.

[0017] The present invention also includes: - A ribonucleoprotein complex comprising a gRNA molecule and a CRISPR-associated protein according to any of the embodiments described herein; - Nucleic acid, comprising: a sequence encoding a gRNA molecule according to any of the embodiments described herein; - A vector containing nucleic acid according to any of the embodiments described herein; - A composition comprising a gRNA molecule and / or a ribonucleoprotein complex and / or a nucleic acid and / or a vector according to any of the embodiments described herein; -A gRNA molecule, ribonucleoprotein complex, nucleic acid, carrier, or composition according to any of the embodiments described herein, used as a medicine, particularly for the treatment and / or prevention of ataxia and / or epilepsy in individuals in need; - For modifying target cells in vitro ( ex vivo ) or in vitro ( in vitro A method comprising contacting the target cells with a gRNA molecule and / or a ribonucleoprotein complex and / or a nucleic acid and / or a carrier and / or a composition according to any of the embodiments described herein; - Used to regulate and / or increase the content of target cells CACNA1B An in vitro or ex vivo method for expressing the expression level of a messenger RNA (mRNA) splice variant of gene exon 37a, the method comprising contacting the target cells with a gRNA molecule and / or ribonucleoprotein complex and / or nucleic acid and / or vector and / or composition according to any of the embodiments described herein; - Contains mutations CACNA1B Genetically modified isolated cells, wherein said cells can be obtained by any of the methods defined in the embodiments described herein; - Modified isolated cells according to any of the embodiments described herein, used as a drug, particularly for the treatment and / or prevention of ataxia and / or epilepsy in individuals of need; and - A kit for modifying target cells, comprising one or more gRNA molecules, ribonucleoprotein complexes, nucleic acids, vectors and / or compositions according to any of the embodiments described herein.

[0018] Other advantages and features of the present invention will become apparent from the following detailed description. Attached Figure Description

[0019] Figure 1 . CACNA1A and CACNA1B Alternative splicing of gene exons 37a and 37b. (A) In CACNA1A and CACNA1B In this study, exon 37a or exon 37b is included in the mature mRNA, resulting in two mutually exclusive variants (EFa or EFb) for each gene. (B) Quantification of exon 37a or exon 37b in the brains of mice 40 days after birth by RT-gPCR CACNA1A and CACNA1B Variants 37a (EFa, light-colored bar) and 37b (EFb, dark-colored bar). (C) is the same as (B), but derived from the human brain (Ambion #AM7962) and from human neurons derived from induced pluripotent stem cells (iPSCs) differentiated for 30-45 days. CACNA1A The expression level of variant EFa (light bar) is higher than CACNA1B The expression level of the variant EFa.

[0020] Figure 2 For CRISPR / Cas9-mediated CACNA1B Regulation of alternative splicing of mutually exclusive exons 37a and 37b. (A) Adenosine (A) at the branch point of exon 37a or exon 37b competes with each other at the same splice site at 5' (continuous and dashed curved arrows, respectively). CACNA1B In the endogenous splicing system, exon 37b is more frequently included in mature mRNA than exon 37a. (B) Cas9 recognizes its target sites on DNA through gRNA-mediated RNA-DNA interactions and induces double-strand breaks (DSBs). Following a DSB, DNA... Non-homologous end joining The endogenous process of (NHEJ) (which is highly efficient but error-prone) repairs breaks by inducing mutations in the form of small DNA insertions or deletions (InDel mutations), thereby disrupting the recognition sequence at the target site. (C) A gRNA specific to the exon 37b branch guides Cas9 to this site. A Cas9-induced mutation (X) at the exon 37b branch disrupts the site and tilts the competitive balance between exon 37a (light-colored continuous curved arrow) and exon 37b (dark-colored dashed curved arrow) towards the former.

[0021] Figure 3 Composed of Cas9 and gRNA CACNA1B #1-#6 mediated by exon 37a (EFa) CACNA1B The expression of the variant increased. (A)gRNA CACNA1B #1-#6 in CACNA1B The location within the gRNA. The predicted breakpoint for each gRNA is indicated by a vertical dashed line. (B) In Staphylococcus aureus ( Staphylococcus aureus Cas9 cells (SaCas9) with control gRNA (Ctrl) or gRNA CACNA1B #1 or gRNA CACNA1B #2 or gRNAs CACNA1B #1 + CACNA1B #3 or gRNAs CACNA1B #2+ CACNA1B #3 After transfecting human embryonic kidney (HEK) cells for 48 hours, the expression in the cells was quantified by RT-gPCR. CACNA1B The total transcript of the gene and its variants containing exon 37a (EFa) or exon 37b (EFb). Same as (B), but in the case of Streptococcus pyogenes ( Streptococcus pyogenes Cas9 (SpCas9) and control gRNA (Ctrl) or gRNA CACNA1B#4 or gRNA CACNA1B #5 or gRNAs CACNA1B #4 + CACNA1B #6 were transfected into HEK cells and then subjected to (n=6 experiments). p<0.05 (one-sample t-test).

[0022] Figure 4A New object recognition test. In the first phase of the test, the mouse's exploration behavior was recorded in the presence of two identical objects (top). One hour after the first phase of the test, the mouse's exploration behavior was recorded again in the same area, this time with one of the objects replaced by a new one (bottom). CACNA1A Mice with reduced gRNA expression (gRNA P / Q; gray bar) were unable to distinguish between known and new objects. CACNA1A The expression decreased and CACNA1B Mice with increased expression of variant 37a (gRNAs P / Q + N; black bars) distinguished known objects from new objects in a manner similar to that of control mice (gRNAs Ctrl; white bars; #p<0.05, ###p<0.001, paired t-test); p<0.05, p<0.01, one-way ANOVA, followed by Tukey's post-hoc test; n=11 animals per group).

[0023] Figure 4B Vertical pole test. Place mice head-up on top of a vertical pole (55 cm long, 1 cm in diameter) and quantify the latency of turning and descending the pole. CACNA1B The increase in variant 37a expression (gRNAs P / Q+N; black bars) recovered from the effect of CACNA1A Defects caused by reduced expression (gRNA P / Q; gray bar); p<0.05, p<0.01, one-way ANOVA was performed, followed by Tukey post-hoc test; n=11 mice per group).

[0024] Figure 4C Gait analysis. Left image: Representative trajectory. Hind paw prints are white, front paw prints are black. Right image: Quantification of stride length, stride width, and displacement of the front and rear paws. CACNA1B The increase in variant 37a expression (gRNAs P / Q+N; black bars) restored the expression of variant 37a. CACNA1A Defects caused by reduced expression (gRNA P / Q; gray bar); p<0.05, one-way ANOVA, followed by Tukey post-hoc test; n=11 animals per group).

[0025] / / Rotador. Motor coordination and balance skills were assessed using a rotador apparatus for three consecutive days. Mice were placed on a rotador rotating at 5 revolutions per minute (RPM) for one minute to acclimatize. The rotador was then accelerated at 0.1 RPM until it reached 40 RPM. For each mouse, the drop delay and the RPM at the time of drop were recorded. Figure 4D The increase in variant 37a expression (gRNAs P / Q+N; black bars) restored the expression of variant 37a. CACNA1B Defects caused by reduced expression (gRNA P / Q; gray bar); p<0.05, p<0.01, one-way ANOVA was performed, followed by Tukey post-hoc test; n=11 animals per group).

[0026] CACNA1APTZ-induced seizures. The top image shows mice receiving five subsequent intraperitoneal injections of 8 mg / kg pentylenetetrazole (PTZ) (each 10 minutes apart), with behavior recorded after each injection. Seizure severity was assessed using a modified Racine scale. The bottom left image shows the mean seizure severity score after each PTZ injection. p<0.05; p<0.01 gRNA P / Q vs. gRNA Ctrl; #p<0.05; ##p<0.05 gRNA P / Q vs. gRNAs P / Q + N, repeated measurements ANOVA followed by Tukey post-hoc test; n = 12 gRNA Ctrl, 13 gRNA P / Q, 13 gRNAs P / Q + N). The bottom right panel shows the percentage of mice with severity scores after each PTZ injection. p<0.05, p<0.01, Chi-square test, n = 12 gRNA Ctrl, 13 gRNA P / Q, 13 gRNAs P / Q + N). Figure 4E Increased expression of variant 37a (gRNAs P / Q+N) restored the expression of variant 37a. CACNA1B Defects caused by reduced expression (gRNa P / Q).

[0027] CACNA1A .people Figure 5 The nucleotide (DNA) sequence of a gene, including the sequence from exon 36 to exon 38. Detailed Implementation

[0028] CACNA1B Unless otherwise stated, the terminology used in this specification is as commonly understood by those skilled in the art.

[0029] The expression used in the context of this invention is " Glossary "Gene" (from calcium voltage-gated channel subunit) CACNA1B The α1B gene refers to a human gene located at locus q34.3 on chromosome 9 (chromosome 9.q34.3 locus), which encodes the pore-forming subunit α1B of the N-type CaV2.2 calcium voltage-gated channel, which is crucial for the release of neurotransmitters by brain neurons. Preferably, the gene mentioned in this specification... calcium voltage-gated channel subunitThe gene is identifiable in the Ensembl database, with the identification code ENSG00000148408 (Ensembl release 110-July 2023 ©EMBL-EBI).

[0030] According to the preferred aspect, people CACNA1B The nucleotide (DNA) sequence of the gene, including the sequence of exons 36 to 38, is shown in SEQ ID No. 23, and is illustrated in... CACNA1B middle.

[0031] The expression used in the context of this invention is " Figure 5 The gene (from the calcium voltage-gated channel subunit α1A gene) refers to a human gene located at the p13.13 locus on chromosome 19 (chromosome 19p13.13) that encodes the pore-forming transmembrane subunit α1A of the calcium voltage-gated channel (CaV2.1), which is sensitive to P / Q voltage. Furthermore, CACNA1A The gene is linked via an internal ribosome entry site (IRES) to the second cistron encoding the α1ACT transcription factor, which coordinates the expression of gene programs involved in cerebellar development. As mentioned above, this gene mutation is associated with various neurological disorders, including common familial hemiplegic migraine (FHM), episodic ataxia type 2 (EA2), spinocerebellar ataxia type 6 (SCA6), and epilepsy. Preferably, the gene mentioned in this specification... CACNA1A The gene is identifiable in the Ensembl database with the identification code ENSG00000141837 (Ensembl release 110, July 2023 © EMBL-EBI).

[0032] In the context of this invention, the term "branch-point" refers to a site within a gene intron (non-coding region) where RNA splicing occurs. This is the point where nucleotides (typically adenosine) form branching structures, facilitating intron removal and the joining of adjacent exons (coding regions of the gene) to form mature messenger RNA (mRNA). As those skilled in the art will recognize, the location of branch-point sites in a target DNA sequence can be predicted using bioinformatics tools with known DNA sequences. Regarding... CACNA1A In the context of this invention, the term "branching point" refers to, for example, a gene. CACNA1B As shown, located Figure 5The branching site is located in the distal region of an intron between exon 37a and exon 37b of a gene; preferably, the branching site comprises a sequence selected from SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21 and SEQ ID No. 22, or is composed of a sequence selected from SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21 and SEQ ID No. 22.

[0033] In the context of this invention, the term "CRISPR-related protein" specifically refers to: (i) CRISPR-associated endonucleases, which are enzymes that can break chemical bonds in DNA or RNA, are associated with the adaptive immune system (CRISPR-associated sequences derived from clustered, regularly spaced short palindromic repeats). CACNA1B clustered regularly interspaced In the context of the technology, this refers to genetic editing tools, as well as any homologs, orthologs, or mutants of which retain endonuclease activity, such as Cas9 or Cas13 endonucleases. or: (ii) Any variant or mutant of a CRISPR-related endonuclease, or any variant or mutant of a homolog or ortholog of a CRISPR-related endonuclease, modified to lack endonuclease activity or catalytic inactivation. Specifically, the variant or mutant lacking endonuclease activity or catalytic inactivation is associated or conjugated with at least one functionally active domain capable of producing modifications or mutations in a DNA or RNA sequence, or particularly, associated or conjugated with a functionally active domain capable of producing breaks in the DNA or RNA sequence, such as a single-stranded or double-stranded domain.

[0034] As used in the context of this invention, the term "functionally active domain capable of producing modifications or mutations in a DNA or RNA sequence" specifically refers to any peptide, polypeptide, protein, enzyme, or fragment thereof known to those skilled in the art, capable of altering a DNA or RNA sequence, particularly capable of introducing modifications or mutations into one or more nucleic acid bases of said DNA or RNA, for example by methylation, demethylation, acetylation, deacetylation, deamination, or combinations thereof, and more particularly by, for example, disruption or inhibition of any of the variations described herein. short palindromic repeats The identification of branching sites in exon 37b of a gene through modifications or mutations.

[0035] As used in the context of this invention, the term "functionally active domain capable of generating double-strand breaks in a DNA sequence" refers to any peptide, polypeptide, protein, or enzyme known to those skilled in the art that is capable of generating single-strand or double-strand breaks in a DNA sequence, such as any restriction endonuclease (restriction enzyme) known in the art.

[0036] As described above, in the preferred embodiment, the term "CRISPR-related protein" as used in the context of this invention refers to a "CRISPR-related endonuclease" or its homolog, ortholog, or mutant that retains endonuclease activity; that is, an enzyme capable of breaking specific DNA or RNA fragments at a specific sequence level within the genome. Its activity is guided by a guide RNA (gRNA) that determines the exact site of the break. Upon recognition of a target sequence, the endonuclease produces single-strand or double-strand breaks in the DNA or RNA that the cell can repair through a variety of mechanisms.

[0037] In particular, the term "Cas9 endonuclease" as used in the context of this invention refers to a nuclease-type enzyme that is part of the CRISPR-Cas9 system (widely used to provide genome modification for research and therapeutic purposes), as well as any homolog, ortholog, or mutant that retains endonuclease activity. Two types of Cas9 endonucleases suitable for this invention are, for example: -Streptococcus pyogenes ( CACNA1B Cas9 (SpCas9): This is the most commonly used and studied Cas9 variant. It was first discovered and applied to CRISPR-Cas9 technology. Its recognition sequence must include the so-called NGG-type "protospacer adjacent motif" (PAM) (where N is any nucleotide).

[0038] - Staphylococcus aureus ( Streptococcus pyogenes Cas9 (SaCas9): This is a smaller Cas9 variant than SpCas9, found in Staphylococcus aureus (…). Staphylococcus aureus It was identified in [the study]. SaCas9 can be used to reduce the size of CRISPR-Cas9 systems, making them applicable in space-constrained environments. The PAM type recognized by SaCas9 is different from that recognized by SpCas9, which allows for targeting different target sequences.

[0039] In the context of this invention, the expression “capable of producing mutational modifications in the target genome sequence” used when referring to a ribonucleic acid complex according to any of the variations described herein means the ability of the ribonucleic acid complex to introduce mutational modifications into one or more nucleic acid bases of the target genome sequence, for example by methylation, demethylation, acetylation, deacetylation, deamination or a combination thereof of the one or more nucleic acid bases, or the ability of the ribonucleic acid complex to produce single-strand or double-strand breaks in the target genome sequence.

[0040] In particular, in the context of this invention, the expression "capable of producing modifications or mutations in the target genome sequence" refers to the ability of the ribonucleoprotein complex according to any of the embodiments described herein to introduce mutant modifications into the target genome sequence, such as disrupting or preventing recognition according to any of the variations described herein. / / The branching site of exon 37b of the gene.

[0041] In the context of this invention, the term "dead Cas9," abbreviated herein as "dCas9," and also referred to by those skilled in the art as "inactive Cas9 endonuclease," refers to a Cas9-type endonuclease that lacks endonuclease activity or is catalytically inactivated due to at least one mutation in one or more endonuclease domains. The dCas9 can be any of the variations of the Cas9 protein described herein, which contains at least one mutation in one or more endonuclease domains to cause catalytic inactivation of the Cas9 protein. In some embodiments, it is associated with Streptococcus pyogenes (… S. Staphylococcus aureus Compared to the Cas9 protein of Staphylococcus aureus, the dCas9 protein has at least 75% amino acid identity. In other embodiments, compared to Staphylococcus aureus (… CACNA1B Compared to the Cas9 protein of Streptococcus pyogenes, the dCas9 protein has at least 75% amino acid identity. In a further embodiment, the dCas9 protein is a protein from Streptococcus pyogenes (Streptococcus pyogenes). pyogenes The Cas9 protein or a Cas9 protein ortholog thereof, wherein at least one mutation in one or more endonuclease domains causes the Cas9 protein ortholog to be catalytically inactivated.

[0042] In a preferred embodiment, the dCas9 protein is a Cas9 protein containing D10A and H840A mutations in the RuyCl and HNH endonuclease domains, which causes the Cas9 protein to be catalytically inactivated.

[0043] In the context of this invention, the term "dead Cas13," abbreviated herein as "dCas13," and also referred to by those skilled in the art as "inactive Cas13 endonuclease," refers to a Cas13-type endonuclease that lacks endonuclease activity or is catalytically inactivated due to at least one mutation in one or more endonuclease domains. The dCas13 can be any variant of the Cas13 protein known to those skilled in the art, containing at least one mutation in one or more endonuclease domains that renders the Cas13 protein catalytically inactive. In the context of this invention, the term "exon" refers to the region of a eukaryotic gene that contains the genetic information encoding a protein. Exons constitute the portion of a gene that is transcribed into messenger RNA (mRNA) during DNA transcription. After transcription, introns (non-coding regions of a gene) are removed from the mRNA through a process called splicing, and the remaining exons are assembled to form mature mRNA, which is then translated into the corresponding protein.

[0044] In the context of this invention, the term "alternative splicing" refers to a molecular process that occurs during DNA transcription, producing different messenger RNA (mRNA) variants from the same gene. Instead of transing the entire gene into a single, continuous sequence, pre-messenger RNA undergoes selective breakage, called splicing, which removes certain parts called introns and joins together the remaining parts called exons. The effect of this process is the production of different mRNA variants, each containing a different combination of exons. This alternative splicing allows a single gene to encode multiple proteins with different functions, thus contributing to the functional diversity of proteins produced by the cell.

[0045] Preferably, the nucleic acid or nucleic acid molecule according to any variant described herein is an isolated nucleic acid or an isolated nucleic acid molecule.

[0046] In the context of this invention, "non-homologous end joining" (NHEJ) refers to a DNA repair mechanism that occurs when a double-strand break (DSB) occurs in DNA, such as a break due to injury or intentionally introduced for gene editing purposes. In this process, the broken ends of the DNA are simply rejoined without the aid of a homologous DNA template. Damaged ends may undergo small insertions or deletions, which can lead to permanent mutations. NHEJ is a rapid and simple mechanism that occurs in all cells, even in terminally differentiated cells that no longer divide, such as nerve cells.

[0047] In the context of this invention, the abbreviation "RT-qPCR" (from "quantitative reverse transcription polymerase chain reaction") refers to a molecular biology technique for amplifying and quantifying specific nucleic acid fragments, such as RNA. Specifically, this method, combined with quantitative polymerase chain reaction (qPCR), reverse transcribes RNA into complementary DNA (cDNA), allowing for precise quantitative measurement of the amount of RNA present in a sample. RT-qPCR is widely used for analyzing gene expression and transcriptomic variation.

[0048] As used herein, the “sequence identity percentage (%)” for a reference polynucleotide sequence is defined as the percentage of nucleic acids in a candidate sequence that are identical to those in the reference polynucleotide sequence after sequence alignment and, where necessary, the introduction of blanks to obtain the maximum sequence identity percentage. Alignment used to determine the nucleic acid identity percentage can be performed in various ways within the capabilities of those skilled in the art, such as using publicly available software like BLAST, BLAST-2, or Megalign. Those skilled in the art will know how to determine appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment across the entire length of the sequences to be compared. For example, sequence identity percentage values ​​can be generated using a BLAST sequence comparison computer program.

[0049] The term "individual" as used in this specification refers to a person or any other organism that may need to receive treatment according to the present invention. Such an individual may also be referred to herein as a patient, an individual, a user, or an organism. Preferably, an individual is a person.

[0050] Individuals particularly suited to treatment with the composition according to any of the embodiments described herein are those who have or have been diagnosed with a condition caused by S. aureus A pathology or disease caused by one or more mutations in a gene, such as the conditions exemplified in this specification.

[0051] As used in this specification, the term "OMIM#" followed by a six-digit number for a specific pathology refers to the registration number of that specific pathology according to the MIM or the Mendelian Inheritance in Man database, version 12, which catalogs all diseases with a genetic component. For each disease, the database provides, where possible, links to genes in the human genome associated with the disease. Each disease with a genetic component is specifically assigned a six-digit number, where the first digit categorizes the trait according to genetic criteria. If the first digit is 1, the trait is considered autosomal dominant; if it is 2, it is autosomal recessive; and if it is 3, it is X-linked. The hash mark (#) preceding the registration number indicates that the phenotype may be caused by mutations in one or more genes; for example, Pelizaeus-Merzbacher syndrome [MIM ​​# 312,080] is an X-linked recessive disorder.

[0052] Throughout this specification and claims, the expression "comprising" may be replaced by "consisting of".

[0053] Anywhere in this specification and claims, when the symbol “T” is given in the nucleotide sequence of an RNA molecule according to any embodiment described herein, it should be understood to correspond to “U” (i.e., uracil), and therefore can be replaced with the symbol “U” each time it appears.

[0054] S. pyogenes CACNA1A The first aspect of the present invention relates to a gRNA molecule comprising, and Detailed description The first part of the target genome sequence located between exon 37a and exon 38 in the gene is complementary, such that when it binds to a CRISPR-associated protein, particularly the Cas9 protein, it is able to form a gRNA / protein ribonucleoprotein complex with said protein, which is capable of producing mutations or modifications, preferably breaks, such as single-strand or double-strand breaks, in said target genome sequence.

[0055] In a preferred embodiment of the invention, when a gRNA molecule according to any of the embodiments described herein binds to a CRISPR-related protein, particularly the Cas9 endonuclease or any homolog or ortholog thereof, according to any variant described herein, it is able to form a gRNA / protein ribonucleoprotein complex with the protein, the gRNA / protein ribonucleoprotein complex being able to produce breaks in the target genome sequence.

[0056] In other words, the gRNA molecule according to the invention is specifically configured to include, Guide RNA (gRNA) molecules and ribonucleoprotein complexes Specific target DNA sequences within a gene (especially those located in...) CACNA1B At least one sequence complementary to the target DNA sequence between exon 37a and exon 38 in the gene.

[0057] According to one aspect of the invention, the gRNA molecule includes a first portion complementary to a specific target DNA sequence, said target DNA sequence being located in a region containing CACNA1B The branching site of gene exon 37b is within, adjacent to, or contains the sequence containing that site. CACNA1B The sequence of the branching site of exon 37b of the gene. Preferably, the expression "inproximity to" means that the gRNA molecule contains a first portion complementary to the target genome sequence, which is located at a distance from the branching site. CACNA1B The sequence of the branching site of exon 37b does not exceed 10, 15, 18, 20, 21, 22 or 23 nucleotides.

[0058] Preferably, the gRNA molecule includes a first portion complementary to the target genome sequence, the target genome sequence being located in a region containing CACNA1B The sequence containing the branching point of exon 37b or adjacent to that point. CACNA1 The sequence of the branching site of exon 37b of the gene.

[0059] According to another aspect, the gRNA molecule includes a first portion complementary to a target genome sequence located at... CACNA1B The sequence within, adjacent to, or containing exon 37b of the gene CACNA1B CACNA1B CACNA1B The sequence of gene exon 37b, or the gRNA molecule containing the sequence located at [location missing]. CACNA1B A first portion complementary to the target genome sequence between exon 37b and exon 38 of a gene. In a preferred aspect, the invention provides a first gRNA molecule (which contains a first portion complementary to the target genome sequence, said target genome sequence being located in...) CACNA1B The sequence containing or adjacent to the branching site of exon 37b of the gene CACNA1B The sequence of the branching site of exon 37b of the gene; and a second gRNA molecule comprising a first portion complementary to the target genome sequence, the target genome sequence being adjacent to... CACNA1B The sequence of exon 37b of the genome or containing this CACNA1B The sequence of exon 37b of the gene, or located in CACNA1BBetween exon 37b and exon 38 of the gene. According to any of the embodiments described herein, the first and second gRNA molecules can be used simultaneously to bind to CRISPR-associated proteins.

[0060] According to a preferred aspect of the invention, the first portion of the gRNA molecule according to any of the embodiments described herein comprises or consists of the following: - Sequences selected from SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

[0061] According to the present invention, different mutations can be introduced into the sequence of the first part of the gRNA molecule, provided that they do not impair its ability to bind with CRISPR-related proteins to form a gRNA / protein ribonucleoprotein complex, i.e., allow recognition of target genomic sequences and the generation of mutations or modifications in said sequences, preferably breaks.

[0062] In one aspect of the invention, the first portion of the gRNA molecule according to any of the embodiments described herein comprises or consists of the following: - A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with a sequence selected from SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, such as the gRNA molecule retaining its ability to form a gRNA / protein ribonucleoprotein complex when bound to a CRISPR-associated protein, the ribonucleoprotein complex being capable of producing mutations or modifications, preferably breaks, in the target genome sequence.

[0063] According to a particularly preferred aspect, the gRNA molecule comprises a first portion comprising or consisting of a sequence selected from SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3.

[0064] The gRNA molecule according to the invention can bind to a CRISPR-related protein according to any of the embodiments described herein to form a ribonucleoprotein complex capable of recognizing and binding to target sequences in DNA. This complex guides the protein to mutate or modify DNA at desired sites, particularly introducing breaks in DNA, thereby targeting and modifying the genome.

[0065] Therefore, gRNA molecules according to any variant described herein may include a second part capable of binding the CRISPR-associated protein to form the gRNA / protein ribonucleoprotein complex.

[0066] According to one aspect of the invention, a gRNA molecule comprising a first portion complementary to a target genome sequence and a second portion capable of binding to the CRISPR-associated protein according to any of the embodiments described herein is a chimeric gRNA molecule.

[0067] According to a preferred aspect of the invention, the gRNA molecule according to any of the embodiments described herein comprises or consists of the following: - A sequence selected from SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12, preferably including a sequence selected from SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9 or consisting of a sequence selected from SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO.9.

[0068] -According to another aspect of the invention, a gRNA molecule according to any of the embodiments described herein comprises or consists of the following: - A sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity with a sequence selected from SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, and SEQ ID NO. 12, such as the gRNA molecule maintaining its ability to form a gRNA / protein ribonucleoprotein complex when used in combination with a CRISPR-associated protein, which is capable of producing mutations or modifications, preferably breaks, in the target genome sequence.

[0069] According to one aspect of the invention, the gRNA molecule according to any of the embodiments described herein is a single-stranded RNA molecule (sgRNA) or a double-stranded RNA molecule (gRNA). The object of the invention is also formed by a ribonucleoprotein complex comprising a gRNA molecule and a CRISPR-related protein according to any of the embodiments described herein.

[0070] Preferably, the CRISPR-related protein is a nuclease capable of generating breakage events in single-stranded or double-stranded DNA sequences.

[0071] In another embodiment, the CRISPR-related protein is any variant or mutant of a CRISPR-related endonuclease according to any of the variants described herein, or any variant or mutant of an ortholog or homolog of a CRISPR-related endonuclease according to any of the variants described herein. This variant or mutant lacks endonuclease activity or is catalytically inactivated, and is associated or coupled with at least one functionally active domain capable of producing mutations or modifications in a DNA or RNA sequence, i.e., having the ability to modify one or more nucleic acid bases in a DNA or RNA sequence, particularly through methylation, demethylation, acetylation, deacetylation, deamination, or combinations thereof, preferably through a deamination reaction or process. Preferably, the CRISPR-related protein is a Cas9 endonuclease or a variant, fragment, homolog, ortholog, mutant, or chimeric protein that retains endonuclease activity, such as those derived from Streptococcus (Cas9). Streptococcus ) or Staphylococcus ( Staphilococcus ), especially those derived from Streptococcus pyogenes ( Streptococcus pyogenes ) or derived from Staphylococcus aureus ( Staphylococcus aureus Cas9.

[0072] According to another aspect, the CRISPR-related protein is a chimeric protein comprising a variant or mutant of any CRISPR-related endonuclease known to those skilled in the art, the variant or mutant of which lacks endonuclease activity or is catalytically inactivated, and is associated with or coupled to at least one functionally active domain capable of producing mutations or modifications in a DNA or RNA sequence, or particularly capable of producing double-strand breaks in a DNA sequence according to any of the variants described herein.

[0073] Preferably, the CRISPR-related protein is any variant or mutant of the Cas9 endonuclease, such as that derived from Streptococcus ( Streptococcus ) or Staphylococcus ( Staphilococcus ), especially those derived from Streptococcus pyogenes ( Streptococcus pyogenes ) or derived from Staphylococcus aureus ( Staphylococcus aureus Cas9, which lacks endonuclease activity or is catalytically inactivated, and is associated or conjugated with at least one functionally active domain that can produce mutations or modifications in the DNA or RNA sequence, or particularly can produce single-strand or double-strand breaks in the DNA sequence according to any of the variations described herein.

[0074] In another aspect, the CRISPR-related protein can be any homolog or ortholog of a Cas9 endonuclease known to those skilled in the art, such as a variant or mutant of a Cas13 endonuclease. This variant or mutant lacks endonuclease activity or is catalytically inactivated, and is associated with or coupled to at least one functionally active domain capable of producing mutations or modifications in the DNA sequence, or particularly capable of producing single-strand or double-strand breaks in the DNA sequence according to any of the variations described herein.

[0075] In one particular aspect of the invention, the CRISPR-related protein is a dCas9 or dCas13 protein associated with or coupled to at least one functionally active domain capable of producing mutations or modifications in a DNA or RNA sequence, or particularly capable of producing single-strand or double-strand breaks in the DNA or RNA sequence according to any of the variants described herein.

[0076] According to one aspect of the invention, the CRISPR-related protein is a dCas9-X or dCas13-X type chimeric protein, wherein X is a functionally active domain capable of producing mutations or modifications in a DNA or RNA sequence according to any of the variations described herein, or capable of producing single-strand or double-strand breaks in a DNA or RNA sequence.

[0077] In another aspect, the CRISPR-related protein is a chimeric protein that contains any variant or mutant of any homolog or ortholog of any Cas9 or Cas13 endonuclease known to those skilled in the art, which lacks endonuclease activity or is catalytically inactivated.

[0078] Preferably, the X functional active domain is an enzyme capable of producing modifications in the nucleic acid bases of DNA or RNA, for example, through methylation, demethylation, acetylation, deacetylation, deamination or a combination thereof of one or more nucleic acid bases, such as, in particular, cytidine deaminase or adenine deaminase.

[0079] In another aspect, the CRISPR-related protein is coupled to a restriction enzyme, such as the dCas9 protein coupled to the FokI enzyme (FokI-dCas9 or fdCas9).

[0080] Nucleic acid and vector In one aspect, the present invention also provides a nucleic acid comprising: (a) a sequence encoding one or more gRNA molecules according to any of the embodiments described herein. According to one embodiment, the nucleic acid encodes a gRNA molecule containing a first portion complementary to a target genomic sequence located between exons 37a and 38 of the CACNA1B gene, capable of generating a mutation or modification, preferably a break, in the target genomic sequence upon binding to a CRISPR-associated protein (such as Cas9) according to any of the variations described herein.

[0081] According to one aspect, the nucleic acid according to any of the embodiments described herein comprises (b) a sequence encoding a CRISPR-related protein, preferably wherein the CRISPR-related protein is a Cas9 endonuclease or a variant, homology, ortholog, mutant or fragment thereof that retains endonuclease activity.

[0082] According to another aspect, the nucleic acid according to any of the embodiments described herein comprises (b) a sequence encoding a variant or mutant of the Cas9 endonuclease, lacking endonuclease activity or catalytic inactivation, and preferably comprises (c) a sequence encoding at least one functionally active domain capable of mutation or modification in the DNA sequence, or capable of generating single-strand or double-strand breaks in the DNA sequence according to any of the variants described herein. The nucleic acid according to any of the variants described herein can be a DNA molecule or an RNA molecule, such as an mRNA molecule.

[0083] The object of the present invention is also formed by a vector comprising a nucleic acid according to any of the embodiments described herein.

[0084] The vector can be any form known to those skilled in the art, such as a plasmid or a viral vector.

[0085] In particular, the term "plasmid" as used herein refers to a circular extrachromosomal double-stranded DNA molecule capable of binding additional DNA fragments. A plasmid is a vector, a nucleic acid molecule capable of carrying another nucleic acid that it binds to. Some plasmids are capable of replicating independently in the host cell to which they are introduced (e.g., bacterial plasmids with bacterial origins of replication and mammalian episomal plasmids). Other vectors (e.g., non-episomal mammalian vectors) can integrate into the host cell's genome after introduction and then replicate along with the host genome. Some plasmids are capable of directing the expression of genes operatively linked to them.

[0086] In one aspect of the invention, the vector is a viral vector, preferably selected from the following: adenovirus, adeno-associated virus (AAV), lentivirus, retrovirus, cytomegalovirus (CMV), hybrid, or other vectors suitable for introducing nucleic acids into eukaryotic cells.

[0087] Composition Another aspect of the invention relates to a composition comprising a gRNA molecule and / or a ribonucleoprotein complex and / or a nucleic acid and / or a carrier according to any of the embodiments described herein.

[0088] The compositions according to the present invention may also contain a variety of different gRNA molecules, said gRNA molecules being selected from any of the variations described herein.

[0089] In one particular embodiment, the composition comprises at least two different gRNA molecules selected from any variant described herein.

[0090] Specifically, the composition comprises at least a first gRNA molecule and a second gRNA molecule, the first gRNA molecule comprising a first portion complementary to a target genome sequence located in a region containing CACNA1B The branching site of exon 37b of the gene contains within or near the sequence. CACNA1B The sequence of the branching site of exon 37b of the gene; the second gRNA molecule contains a first portion complementary to the target genome sequence, which is adjacent to the target genome sequence. CACNA1B The sequence of exon 37b of the gene or including CACNA1B The sequence of exon 37b of the gene, or located in CACNA1B Between exon 37b and exon 38 of the gene.

[0091] Preferably, the composition comprises at least one or at least two gRNA molecules selected from the following: a gRNA molecule comprising a first portion, the first portion comprising or consisting of the sequence shown in SEQ ID NO. 1; a gRNA molecule comprising or consisting of the sequence shown in SEQ ID NO. 2; a gRNA molecule comprising a first portion, the first portion comprising or consisting of the sequence shown in SEQ ID NO. 3; a gRNA molecule comprising a first portion, the first portion comprising or consisting of the sequence shown in SEQ ID NO. 4; a gRNA molecule comprising a first portion, the first portion comprising or consisting of the sequence shown in SEQ ID NO. 5; a gRNA molecule comprising a first portion, the first portion comprising or consisting of the sequence shown in SEQ ID NO. 6.

[0092] In one aspect, the composition comprises at least one of the following: a gRNA molecule comprising a first portion comprising the sequence shown in SEQ ID NO. 1 or the sequence shown in SEQ ID NO. 1, and a gRNA molecule comprising a first portion comprising the sequence shown in SEQ ID NO. 3 or the sequence shown in SEQ ID NO. 3.

[0093] In another aspect, the composition comprises at least one of the following: a gRNA molecule comprising a first portion comprising the sequence shown in SEQ ID NO. 2 or the sequence shown in SEQ ID NO. 2, and a gRNA molecule comprising a first portion comprising the sequence shown in SEQ ID NO. 3 or the sequence shown in SEQ ID NO. 3.

[0094] In another aspect, the composition comprises at least one of the following: a gRNA molecule comprising a first portion comprising the sequence shown in SEQ ID NO. 4 or the sequence shown in SEQ ID NO. 4, and a gRNA molecule comprising a first portion comprising the sequence shown in SEQ ID NO. 6 or the sequence shown in SEQ ID NO. 6.

[0095] Compositions according to any of the variations described herein may also additionally contain a CRISPR-related protein according to any variation known to those skilled in the art (such as those shown in this specification), or a nucleic acid encoding said CRISPR-related protein.

[0096] According to one aspect of the invention, the composition according to any of the embodiments described herein is a pharmaceutical composition.

[0097] In one aspect, the composition further comprises one or more pharmaceutically acceptable carriers, adjuvants, or excipients. Pharmaceutically acceptable carriers or excipients include, for example, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and absorption inhibitors, provided they are physiologically compatible, including pharmaceutically acceptable cell culture media. The choice of carrier, excipient, or diluent can be based on the desired route of administration and standard pharmaceutical practice. They can be injected, for example, parenterally, intracavernously, intravenously, intraparenchymal into the central nervous system (CNS), cerebrospinal fluid (intraventricular or intrathecal), intramuscularly, or subcutaneously. For parenteral administration, the composition may preferably be used in the form of a sterile aqueous solution, which may contain other substances, such as salts or monosaccharides sufficient to make the solution isotonic with blood.

[0098] As needed, sterile injection solutions can be prepared by incorporating the required amount of the compound of the present invention with the various other ingredients described above into a suitable solvent.

[0099] The compositions of the present invention are preferably stable under the conditions of manufacture and storage and are protected from contamination by microorganisms such as bacteria and fungi. The compositions may be packaged in sealed single-dose or multi-dose containers, such as vials.

[0100] The compositions of the present invention can also be administered in combination with other drugs, such as other proteins, peptides, small molecules, or various pharmaceutically active agents. There are virtually no restrictions on other ingredients that may be included in the composition, as long as additional reagents do not adversely affect the composition's ability to deliver the intended gene therapy.

[0101] Medical use One aspect of the present invention provides a gRNA molecule, ribonucleoprotein complex, nucleic acid, carrier or composition, particularly a pharmaceutical composition, according to any of the embodiments described herein, for use as a medicine, particularly in gene therapy, and even more particularly in in vivo or in vitro gene therapy.

[0102] Preferably, the gRNA molecule, ribonucleoprotein complex, nucleic acid, carrier, or composition, particularly a pharmaceutical composition, according to any of the embodiments described herein, can be used to treat or prevent the use of gRNA in individuals in need. CACNA1A Diseases or functional defects caused by one or more mutations in a gene.

[0103] Depend on CACNA1ANon-limiting examples of diseases or functional defects caused by one or more mutations in a gene include neurocranial diseases such as ataxia and epilepsy.

[0104] In one aspect of the invention, gRNA molecules, ribonucleoprotein complexes, nucleic acids, carriers, or compositions, particularly pharmaceutical compositions, according to any of the embodiments described herein, may be used to treat and / or prevent ataxia and / or epilepsy in individuals in need, particularly for the treatment and / or prevention of pathologies selected from: paroxysmal ataxia, particularly type 2; familial hemiplegic migraine, particularly type 1; spinocerebellar ataxia, particularly type 6; developmental and epileptic encephalopathy, particularly type 42; and migraine with or without aura.

[0105] According to a particularly preferred aspect, the pathology is selected from the following: type 2 episodic ataxia (OMIM #108500), type 1 familial hemiplegic migraine (OMIM #141500), type 6 spinocerebellar ataxia (OMIM #183086), type 42 developmental and epileptic encephalopathy (OMIM #617106), migraine with or without aura, susceptibility type 5 (OMIM #607508).

[0106] The dosage and treatment regimen of the gRNA molecule, ribonucleoprotein complex, nucleic acid, carrier, or composition of the present invention can be determined by a physician based on the individual's weight, health status, sex, and age, and modified over time according to the individual's response to the treatment. Therefore, even during administration of the composition of the present invention, the dosage of individual active ingredients in the composition can be adjusted based on results obtained over time. According to one aspect of the invention, the composition is administered to the individual in need at one or more daily doses.

[0107] The object of the present invention is also formed by an in vitro or ex vivo method for modifying target cells, the method comprising the step of contacting the target cells with a gRNA molecule and / or a ribonucleoprotein complex and / or a nucleic acid and / or a carrier and / or a composition according to any of the embodiments described herein, thereby introducing the gRNA molecule, the ribonucleoprotein complex and / or the nucleic acid and / or the carrier and / or the composition into the target cells.

[0108] According to one aspect, the modification includes or consists of the following: in containing CACNA1B One or more nucleotides are introduced and / or deleted from the branching site sequence of exon 37b of the gene. Preferably, the introduction and / or deletion of the one or more nucleotides occurs intracellularly through an endogenous process of non-homologous end joining (NHEJ).

[0109] Therefore, according to a preferred aspect of the invention, the modification includes or consists of the following: CACNA1B At least one break at the branching site of exon 37b of the gene, which is subsequently repaired by an endogenous non-homologous end joining process and introduces and / or deletes one or more nucleotides (insertion / deletion (InDel) mutation).

[0110] According to another aspect, the modification includes or consists of the deamination of cytidine nucleobases or adenine nucleobases of DNA or RNA.

[0111] The present invention also aims to provide a method for regulating and / or increasing the content of target cells. CACNA1B The expression level of a messenger RNA (mRNA) splice variant of gene exon 37a is formed by an in vitro or ex vivo method comprising contacting the target cell with a gRNA molecule and / or ribonucleoprotein complex and / or nucleic acid and / or vector and / or composition according to any of the embodiments described herein.

[0112] The statement "increases the number of target cells containing" CACNA1B "Expression level of messenger RNA (mRNA) splicing variants of gene exon 37a" specifically refers to an increase in the abundance of the variant in treated cells relative to the abundance of the variant in native untreated cells.

[0113] According to one aspect, the target cells are eukaryotic cells, preferably mammalian cells. More preferably, the target cells are brain cells.

[0114] According to one aspect of the invention, a method according to any of the variations described herein includes at least one step, wherein the target cells are transformed or transfected with a nucleic acid, vector, or composition comprising any of the embodiments described herein.

[0115] The method according to any of the embodiments described herein may further include determination or qualitative and / or quantitative analysis containing CACNA1B This step measures the abundance or expression level of messenger RNA (mRNA) splice variants in exon 37a of a gene. This assay can be performed using any method known to those skilled in the art, particularly by performing a quantitative reverse transcription polymerase chain reaction (RT-qPCT).

[0116] The object of the present invention also includes mutations. CACNA1BGenetically modified isolated cells are formed, wherein the cells are obtained or prepared by any of the methods defined in the embodiments described herein. Preferably, the modified isolated cells according to the invention are eukaryotic cells, more preferably mammalian cells, particularly brain cells.

[0117] The object of the invention is also formed by compositions, particularly pharmaceutical compositions, comprising a plurality of modified cells according to any one of the embodiments described herein, and optionally comprising at least one pharmaceutically acceptable carrier or excipient.

[0118] The composition is suitable for cellular administration and is therefore preferably in saline, but can also be, for example, an aqueous suspension or a parenteral composition formulated according to any technique described in the prior art. For example, but not limited to, water or buffer solutions supplemented with preservatives, stabilizers, sugars, and minerals can be used as pharmacologically acceptable excipients. The composition can also be stored in lyophilized form and reconstituted in a suitable carrier before use.

[0119] The composition according to any of the embodiments described herein preferably has a pH value of 7 to 8 and is isotonic.

[0120] Modified isolated cells or compositions containing them, particularly pharmaceutical compositions containing them according to any of the variations described herein, can be used as medicines, especially for the treatment and / or prevention of infections in individuals in need. CACNA1A Diseases or functional defects caused by one or more mutations in a gene, particularly ataxia and / or epilepsy, such as any of the diseases listed in this specification and claims.

[0121] Another object of the present invention is represented by a kit for modifying target cells, or for regulating and / or increasing the content of [specific substances] in target cells. CACNA1B The expression level of a messenger RNA (mRNA) splice variant of gene exon 37a, comprising one or more gRNA molecules, ribonucleoprotein complexes, nucleic acids, vectors, or combinations thereof according to any of the embodiments described herein.

[0122] The present invention also aims to form, in vitro, any variant of the kit as outlined above, for modifying target cells, or for regulating and / or increasing the content of target cells. CACNA1B Expression levels of messenger RNA (mRNA) splicing variants in exon 37a of the gene.

[0123] The present invention also aims to prepare drugs, particularly for use in the treatment and / or prevention of diseases in individuals according to any of the embodiments described herein, by using gRNA molecules, ribonucleoprotein complexes, nucleic acids, vectors, or modified isolated cells. CACNA1A Diseases or functional defects caused by one or more mutations in a gene, preferably ataxia and / or epilepsy.

[0124] This article also describes a treatment for patients suffering from... CACNA1A A method for an individual suffering from a disease or functional defect caused by one or more mutations in a gene, particularly neurocerebrovascular diseases such as ataxia or epilepsy, especially any of the diseases listed in this specification and claims, comprising at least one step of administering to the individual, in a therapeutically effective dosage form, one or more gRNA molecules, ribonucleoprotein complexes, nucleic acids, carriers, or compositions, particularly pharmaceutical compositions, according to any of the embodiments described herein. "Therapeutically effective" means a dose that is therapeutically effective, or an amount sufficient to provide the desired therapeutic effect.

[0125] The examples given below are intended to better illustrate the compositions and methods disclosed in this specification, and these examples should in no way be construed as limiting the foregoing specification and the following claims.

[0126] Example Example 1 like Figure 2 As shown in Figure B, the Cas9 endonuclease uses guide RNA (gRNA) that specifically pairs with the target genomic DNA sequence to recognize a specific site on the genomic DNA. Once recognition occurs, the Cas9 endonuclease creates a double-strand break (DSB) at the DNA target site. Following the DSB, the DNA... Non-homologous end connections The endogenous process of (NHEJ) (which is also very efficient in nerve cells, but prone to error) repairs breaks by inducing mutations in the form of small insertions or deletions in DNA (InDel mutations). Therefore, in order for mutations to occur at specific sites in the genomic DNA, the genomic DNA sequence that is specifically recognized by gRNA must be identified.

[0127] like Figure 2 As shown in C, six 20-21 nucleotide sequences have been identified that guide the Cas9 endonuclease to... CACNA1B Near the branch point of exon 37b in a gene, such as Cas9, mutations are caused (dark cross). The effect is... CACNA1BThe branch point of gene exon 37b is broken. For example, the splicing system selects exon 37a (light-colored continuous curved arrow) and ignores exon 37b (dark dashed curved arrow).

[0128] like Figure 3 As shown, compared to CACNA1B Expression of more common gene variants (including exon 37b (EFb)) is beneficial. CACNA1B Expression of less common gene variants (including exon 37a (EFa)), while CACNA1B The overall expression remains unchanged.

[0129] It has been identified as being related to CACNA1B The sequence of 20-21 nucleotides complementary to the target genomic sequence in the gene is as follows:

[0130] Chr: Chromosome Example 2 - CRISPR / Cas9-mediated exon 37a (EFa) CACNA1B The increase in variant expression corrected CACNA1A Mice with reduced expression exhibited behavioral abnormalities To verify the in vivo mediated effect of CRISPR / Cas9 containing exon 37a (EFa) CACNA1B The effects of increased variant expression were investigated in the following tests conducted on the three experimental groups: 1) Control gRNA (gRNA Ctrl; white bar): Mice infected with SaCas9+gRNA Ctrl, CACNA1A and CACNA1B The expression is normal; 2) Used for knocking down CACNA1A gRNA (gRNA P / Q; gray bar): Mice infected with SaCas9+gRNA P / Q+gRNACtrl, CACNA1A The expression of (and all its variants) is reduced. CACNA1B The expression is normal; 3) Used for knockdown CACNA1A gRNA+ is used to increase CACNA1B gRNAs expressed in exon 37a (gRNAs P / Q+N; black bars): Mice infected with SaCas9+ gRNA P / Q / gRNA N, CACNA1A The expression of (and all its variants) is reduced. CACNA1B The expression of variant 37a is increased.

[0131] In this group of mouse experiments, [the following was used] containing [the following ingredients] in mice. CACNA1A and CACNA1BThe following gRNA sequences are complementary to the target genome sequence of the gene:

[0132] Chr: Chromosome Reference genome: House mouse ( Mus musculus — University of California, Santa Cruz (UCSC), December 2011 (mm10=C57BL / 6J) Specifically, in the experiments conducted in mice in this group, gRNA molecules having the sequences shown in SEQ ID No. 16, SEQ ID No. 17 and SEQ ID No. 18 were used.

[0133] New object recognition test First, a new object recognition test was conducted. In the first phase of the test, the mice's exploratory behavior was recorded when two identical objects were present. No differences in exploratory behavior were found among the three experimental groups. Figure 4A , upper part).

[0134] One hour after the first phase of the test, the mice were placed back in the same arena, but one of the objects was replaced with a new one. Figure 4A ,bottom). CACNA1A Mice with reduced expression (gRNA P / Q; gray bar, Figure 4A It cannot distinguish between known objects and new objects. CACNA1A The expression decreased and CACNA1B Mice with increased expression of variant 37a (gRNAs P / Q +N); Figure 4A The black bars in the graph (gRNA) distinguished known objects from new objects in a manner similar to that of control mice (Ctrl; white bars; #p<0.05, ###p<0.001, paired t-test); p<0.05, p<0.01, one-way ANOVA was performed, followed by Tukey post-hoc test; n=11 animals per group).

[0135] Pole test The mouse was placed on top of a vertical bar (55 cm long and 1 cm in diameter) with its head facing upwards, and the delays in turning and descending the bar were quantified. CACNA1B Increased expression of variant 37a (gRNAs P / Q+N); Figure 4B The black bar in the middle has been restored due to CACNA1A Defects caused by reduced expression (gRNA P / Q; gray bar); p<0.05, p<0.01, one-way ANOVA was performed, followed by Tukey post-hoc test; n=11 mice per group).

[0136] Gait analysis exist Figure 4C Left image (middle): Representative trajectory. Hind paw prints are white, front paw prints are black. Right image: Quantification of stride length, stride width, and displacement of front and rear paws. CACNA1B Increased expression of variant 37a (gRNAs P / Q+N); Figure 4C The black bar was restored due to CACNA1A Defects caused by reduced expression (gRNA P / Q); Figure 4C The gray bars; p<0.05, one-way ANOVA, followed by Tukey post-hoc test; n=11 animals per group).

[0137] Rotating bar Motor coordination and balance skills were assessed using a rotado device for three consecutive days. Mice were placed on a rotado rotating at 5 revolutions per minute for one minute of acclimatization. The rotado was then accelerated at 0.1 revolutions per minute per second until it reached 40 revolutions per minute. For each mouse, the fall delay time and the number of revolutions per minute at the fall were recorded. CACNA1B Increased expression of variant 37a (gRNAs P / Q+N); Figure 4D The black bar was restored due to CACNA1A Defects caused by reduced expression (gRNA P / Q); Figure 4D The gray bars; p<0.05, p<0.01, one-way ANOVA was performed, followed by Tukey post-hoc test; n=11 animals per group).

[0138] PTZ-induced epileptic seizures exist Figure 4E Mice were administered five subsequent intraperitoneal injections of 8 mg / kg pentylenetetrazole (PTZ) at 10-minute intervals, with behavior recorded after each injection. Seizure severity was assessed using a modified Racine scale. Figure 4E The lower left part, the mean severity score of seizures after each PTZ injection ( p<0.05; p<0.01 gRNA P / Q vs. gRNA Ctrl; #p<0.05; ##p<0.05 gRNA P / Q vs. gRNAs P / Q + N, repeated measurements ANOVA followed by Tukey post-hoc test; n=12 gRNA Ctrl, 13 gRNA P / Q and 13 gRNAs P / Q + N). Figure 4E The lower right portion shows the percentage of mice with severity scores after each PTZ injection. p<0.05, p<0.01, Chi-square test, n=12 gRNA Ctrl, 13 gRNA P / Q and 13 gRNAs P / Q + N). CACNA1B Increased expression of variant 37a (gRNAs P / Q+N) restored the effects of... CACNA1A The defect is caused by reduced expression of (gRNa P / Q).

[0139] List of sequences in the instruction manual: SEQ ID No. 1 – gRNA#1 molecule and target sequence CACNA1B complementary nucleotide sequences CTGTGCCCTGGCCTCGCTGGG SEQ ID No. 2 – gRNA#2 molecule with target sequence CACNA1B complementary nucleotide sequences GGAGGGGAGCGGGGAGGGGAG SEQ ID No. 3 – gRNA#3 molecule with target sequence CACNA1B complementary nucleotide sequences AGCCTCCTGGGGGGCGGGTTG SEQ ID No. 4 – gRNA#4 molecule with target sequence CACNA1B complementary nucleotide sequences GAGGCCAGGGCACAGTGGGG SEQ ID No. 5 – gRNA#5 molecule with target sequence CACNA1B complementary nucleotide sequences GGCACAGTGGGGTGGTCCAC SEQ ID No. 6 – gRNA#6 molecule with target sequence CACNA1B complementary nucleotide sequences ACCTTGTAAGCAACTCGAGC The complete nucleotide sequence of SEQ ID No.7 – gRNA #1 molecule CTGTGCCCTGGCCTCGCTGGGgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccgtgt ttatctcgtcaacttgttggcgagatttt The complete nucleotide sequence of SEQ ID No. 8 – gRNA #2 molecule GGAGGGGAGCGGGGAGGGGAGgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccgtgt ttatctcgtcaacttgttggcgagatttt The complete nucleotide sequence of SEQ ID No.9 – gRNA #3 molecule AGCCTCCCTGGGGGGCGGGTTGgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccgtgt ttatctcgtcaacttgttggcgagatttt The complete nucleotide sequence of SEQ ID No. 10 – gRNA #4 GAGGCCAGGGCACAGTGGGGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagt ggcaccgagtcggtgc The complete nucleotide sequence of SEQ ID No. 11 – gRNA #5 molecule GGCACAGTGGGGTGGTCCACgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagt ggcaccgagtcggtgc The complete nucleotide sequence of SEQ ID No. 12 – gRNA #6 ACCTTGTAAGCAACTCGAGCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagt ggcaccgagtcggtgc SEQ ID No. 13 – gRNA P / Q used in Example 2 CACNA1A ) molecules and target CACNA1A Nucleotide sequences of complementary parts GGCAGTTCTGGCGGACAGGGA SEQ ID No. 14 – gRNA N used in Example 2 ( CACNA1B ) molecule and target CACNA1B Nucleotide sequences of complementary parts ACAGAAGAGGCACACGGCAGG SEQ ID No. 15 – Nucleotide sequence of the portion of the control gRNA molecule complementary to the target sequence used in Example 2. GTTCCGCGTTACATAACTTA SEQ ID No. 16 – gRNA P / Q used in Example 2 ( CACNA1A The complete nucleotide sequence of the molecule GGCAGTTCTGGCGGACAGGGAgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccgtgtttatctcgtcaacttgttggcgagatttt SEQ ID No. 17 – gRNA N used in Example 2 ( CACNA1B The complete nucleotide sequence of the molecule ACAGAAGAGGCACACGGCAGGgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccgtgtttatctcgtcaacttgttggcgagatttt SEQ ID No. 18 – Complete nucleotide sequence of the control gRNA molecule used in Example 2 GTTCCGCGTTACATAACTTAgttttagtactctgtaatgaaaattacagaatctactaaaacaaggcaaaatgccgtgtt tatctcgtcaacttgttggcgagatttt SEQ ID No. 19 – CACNA1B The nucleotide sequence of predicted branch point 1 in exon 37b of the gene - this sequence is not included in the sequence listing because it contains fewer than 10 nucleotides. ggcctcGc SEQ ID No.20 – CACNA1B The nucleotide sequence of predicted branch point 2 in exon 37b of the gene - this sequence is not included in the sequence list because it contains fewer than 10 nucleotides. accccAc SEQ ID No.21 – CACNA1B The nucleotide sequence of predicted branch point 3 in exon 37b of the gene - this sequence is not included in the sequence list because it contains fewer than 10 nucleotides. cccctcCc SEQ ID No. 22 – CACNA1B The nucleotide sequence of predicted branch point 4 in exon 37b of the gene - this sequence is not included in the sequence list because it contains fewer than 10 nucleotides. cccctAc SEQ ID No.23 – Human CACNA1B The nucleotide sequence (DNA) of a gene from exon 36 to exon 38. ATGTTGAACCTCTTTGTGGCTGTGATCATGGACAATTTTGAGTACCTCACGCGGGACTCTTCCATCCTAGGTCCTCACCA CTTGGATGAGTTCATCCGGGTCTGGGCTGAATACGACCCGGCTGCGTGgtaagtgagccgtggtgctctgtggtccttgg gggtggtccatgcccatagatcttgggatgggcctggtggcttcagacatgtttcaagtgagcaccccctcaggttttgg tttggggcctagggatctgtcctgtttcgtgtagagcagcagtgatgtcccctccgagcagcacctcccttttccatctc gtgtgccttcgcgcagtggcccggactgcataaagtgataagggtcttttgagaccttgagttcagttccttgggaggta ccaggagtcatggaaggttttcaaggggcttgtgagactcaggtcttctgctgaaatttactgtcttctttcaaggcctg tcatgtgagggctcatggagggcttgtgggagggtgtgtggagacagcacagccatagcgtccttgtgagactcgatgta gggttttaggacattctccctaaggggctcaggagtctccctctgctctttcttttggggacaggggccaacatgcacct ctgtgtccccagcccaggctgcatatagtgtgggtgcttggtgaacttttttgacagatgagctaccaggaaggctgtag tgtgtttaagacccttgtctatcatctgtcatcgtgggaaaggtttacttgtttcaaaggcgaggggtggtgcctttcca gacagaggaggagtcgcatgaagggcatggtttgggtcagaaggtgaagctgtttgagatcaggatccatgggggtcccg tacagcatggcatctcagcagggctgagagctcattcgggaaggaagacaggtcaggcagcatggcttctccatctttct gtttgtccattccttccatcactcgttcctcatttacttgctcgctcactcactcaagcaatgtctactgtgggctgctc cctgcaaggccactaggcctgctagcacctcactcacagcgtgtgcccgggaaatgatcgtggatgagcagctctcagtg agtgcgtagacatccaccactccccgtgccctagggggatgagggaaccgtgggtgccaccgaggcctgccttctctctc tgagctcctcagcctgcccaggccccctcgcactcctctgcccccagtgcccttactgggggagggccggcaggacgtgg tcagacccctcatggtgaggtcctactgcccacagagctcctgggttctgcctggttttgcttaaactgcagctcagcag agggagccctccacagacacaaaaggcctgggagcccgactagacttccccaccctcctttccactcagcctccccggag cacccccaccttcctagtgaggatccagagggtgctgcacgggcccttcccagtctggacaaggtccagagccactggca gcatcgggggccctgggatggggcctctcctgtccaggctcttccaggcacacagcatctctgtgggtgtttttcatttg agtcggaaatatacagtttttacgcagtgcaaaacagacgtagagattgtctgtgtttcacagtgtatatgacaatttcc gtggcttgcgagaaccctgtcatgtccgatgcagcaatatgtttgccctgtgatacttacttcatgctgggagggacagg ctcaggcacattcacacaggacctgtggtcaagtaagcccagtcgacctgggggagactgaccacattgaagacctagac cttgttaggcaaagggcaggagagactccagccgaggcaggatttaggtgaattctaggcaggtcaccctgaatgtgtgg tttagagagtcgctgctttttctgggtgtattttttctggaggagactgtgttgcagaaaacagagatactttatagcat gtagttagtactgaagggcaaaggcagatcaacaaaggcctgtgagaggatgacaacattccccaatctttatgagctac gcccgggccttccacagtcagccgccggcaagagcagaggcaggaagaacgggaagtggacttgggccagatggcagctt ggttaccatgcacagtggtaccataccaaagccagagtctcagagcaggggtccttagaagacataggcagtcggggatg tgagaagtgcttactgaagagtaaacaacagaatacaggcctcaccccagagatagcacgcacaaaataacacacaaaac ctgcgggccttgagatagcacagacgtgacctgtgagcaacacatgattctgcccccacgagcagcctgggctcacccta cgtagtccaagatggccaggacaggccgaggggcccagcagaggcagctgagcagattgggcctggatcctgtgtcctga gcagagcacagggcaccttgagcctttttggtagcctctgtgacaaacgcagtgatgtagtcatttcccaggggaccact ctatggctcctcgttctttgggagaaactttgaaacaacaacaaaattttatgagatttcctgagttgtgtgtgcacatg tgtggtgcacaaacaggacatgtgtgcatgtacatggctgtgttgtgtgcgtgtttgcacagtgtgaccacatgtgcact ctgtgcatgtgtacatgtgtgttgtgcacgcatgcacacagatgtctacatgtgtgttttgtgcacatgtgcatgcacaa ggcgcgcacgtgtgtgcatgttgacgtttgtgtgtgcacatatgattgtatatatgtgtgcctgtgtgtatatgtgtgca agtgaactgaatgtgcgtgcatgcctgtgtggttgtatgtggatgtgtgtatgaatgacatgtgcacctgtgtgtgcata tgcccatgtgtgcatgtgtgtgcctgtggatgtgcacatgcccgtgtgtgcctgtggtgtgcacgtgtctgtggtgtgca cgtgcctgtgtgtgcatgtgcctttgtgtgtgtgccaccgtggtgcgtatgtgcctgtgtgtgcctgtgggtgtgcacgt gcctgtggtgtactcgtgcctgtggtgtgcatgtgcctgtggtgtgcatgtgcctgtggtgcgcatgtgcctgtgtgggt gtgcatgtgtgtgcctgtgggtgtgcacatgtctgtggtgtacacgtgcctgtggtgcgcatgtgcctgtgtcggtggat tctgaaggcacgaaactgttcaccctggtgctgcttttcccagccttcctattgttgttgcttcaaccctgtggtgtgaa gcctggtgacttgagaggagaattgcagtcacacttcttgcagcaatctggctgctcatttctgtgtccacccatctgtc taataacatctcctgggcatctgccatgtgctggggcaggggcccaaaggtgaaacaggcacatgctgtcagaacactca gccaggcttggcagtgagaccacatggtgactgtagctcaaggccagggcatttctgaggaaggagaggccatgtctggc ctgaagaatgagaggaggtgccatttgagctgaacttaaaggaataggaaggattgagcactagagaaataggatggatt gagctggggatgggaggtggggcagagggaagagggaggccaggtggcttctgtcaggctggagaggagagtgcattgca gaggggctgcaaggaaggctgagaccgtttgagaaaggcattgaaattggttgaacaagtcgctttgattttgcgttgta gacagtgggctcagtccttgcatcgaggagtgatggtgtcaggcccacactttccacctgggcttgatgggcagggacag ctggggagggtggggggtctcacgtgtgtccagccccccgtggtggtcccttggctgccacaaccttagcaaacatcttt ggtgaggccgaggtggggcttcctgtttcttcccttttacagaaggaaattcaacatgatttggagctgattggaccgag ggggctacactgtaggagagaggagcattggtggtgatccaaggatgccagcctacgatgagaggaggtccttagctgga ccagggcttccaggggaggacacagagtgttcagggagacagggtcagtcaggaggcaaatgggtatgggcctctgaggt tgctgtgatagagaagcagacctgccttgctgtggtggtgagaaagccaggcgtcagagggtttggctgacctgggaggc ccagggagcatcgtcactcagggagtgagaggaagagctgaccgagagggaggggcagggcagtgttctgtgtggagcgg ctcctgcacacatcgggctccggaaatttcgctggggttgccacacctcccggggagctccaagccccagtaccccggcg aggtgccacctgtccagtgcacccctcacctccgccgccacgcctgcgcgaggtcggtcttcccAtcAcAggctgggcgg gcgggagggtcgggctccatcctgcctttgttgccataacctgtgacatttcctttccagTTGCCGGATTCATTATAAGG ATATGTACAGTTTGTTGCGTTGTATTGCGCCACCCGTTGGCTTAGGGAAGAACTGCCCTCGTAGGTTGGCCTACAAGgtt tgcaacttcagagcctccatccaacatacttccctgcccgaaacgcacacagcacacactccctgcctggtttgggaatg acgacgcctcacctttctttcctcctgtcctgccccgcactccagcctcctggacgctttggttccctgtctaatctccc ctgacccttctagctggctggggacaggcagccttttgagagtgcacagaaagctttctggttgggatcagctagctggg tgggagatgggggctaggtccctcctgcatcaaggaagcagccgacttgcccggtttttcctccgagctctcgagagtga gctgatggtcaggccaaaggccgagggccccagaggaagggagcacgggcacaggcctcccaggagcagccgtcctctgg gttggaagagcccagtaacccagtggctctccagtccctgggggaggaaagggcagaggcagagtgggggccaaagacaa gccgtcctgctttgcctctggagtgatgcgctcagctcagccaaggagcccctggtctggaaccgtgggaggagggcaag gccccagggcagatccatctgccaggaagaggctgtcccctttctctcctgggccacctgaatctggctgtgtctctagg accccaagcccacaggcaggtgtcccagggttggaggtaggccccaggcctcgtggcctctctacttgggaagactctgt catcggagcctttaggttcctagatcctgcaacctgcccctttgctgtcagagctggtgcaaggtggccccaggccatgt cctgccagctcctcccccctcccgcagtctcccatttcccacccagccctgagccccagcagcagccctgccctgggctg gcctcgggcgtctctgggcttgaagcaggacttgccccaaggttaggttttggctgtacagcttcagggctccctgttta gttttctggtttgtttcagatcttctccacctttttagcctctagcctcacttggaagcaaatctgaccgtgaggaaagc tgatgtctctgccgtggttctcagccactgcctcatctgccacctgaccccgcctgccagctcttctggcagggtggacc agctcttttctgattggcattcactgtgatttttaaaagagtaaaatcagaaattatcaacccaaagccgccccgatgca gcccttcctcacccctccatgttcattagctcagacgccacccccgcccactgccccgcgtggggctggagtgaggaggt gaggctcgggggtggggggccaggagggggtcaagccaagcagagaaatccctcattttatttattttgattttgggctt tgaatccgacactttgattaactggctctgttttcttgtctgcttcctccctgcccctAccccgctcccctcCccgctcc cctcctgctgccgctcctcctgtggaccaccccActgtgccctggcctcGctgggacgggtttccagTGGGCGCATCAGT TACAATGACATGTTTGAGATGCTGAAACACATGTCCCCGCCTCTGGGGCTGGGGAAGAAATGCCCTGCTCGAGTTGCTTA CAAGgtagaccctgaccctgcaacccgccccccaggaggctgtgtgtgcttgctgaggggtgcttgctggctctcccagc tcctctccctttcagggtgcccggctgtctgtctgccgctctgctgtgcgcccccggctgcctcactgtgtctttctctt cagccccatcccagcttccttcccagacagagggatgtggccaccatgatgtctcactggcctcttgtccccacaacctg agctgccccctttgagagccccctggaggctcaggaagacagaactagaccctcctccctgccttttctccctcccttcc tttcctaggaatgaggggacagaccacttgtttgacagagattgtttttgttctgggctcagaacaaagccctaagcccc tggtatggatggagctgtccagccctctgggtctggccctgggggcaggtggggcctgcagggcctctggtgcttctgta caaccccctccccagctcagcaagtgcagaggctctctgggcccaggctgcagtctccagggactttctaggctccatgg tggggaagaggcactgtggcactgagaaggaaaggggtgctggggagaggcatcttgctattattcctggggcctcagag ggctgctggaggatggggatggcctcggggcccaggagtcatgggatgctgagttgccaagaagggggtaaatcgaggga tgcctccaggcctccctcctgggtgggcaagcagatcacatggcccagccctaaaactgttccatctgcccagctgtccc cagtcccacctcataccctccatgtgtaagcaccttcgttcccccagcacccacccacctactcaagagccctcctgagg cccccactgctctccggcaaacggcctgtggttcagccaacacgtgcctagagcttttctgatcctccctgaggaagact ttcctgagtctgtctgaggaagcttcctgccagagctttcctctctggtgctgtggacagctgttgtccacactggctct gtgccctgactctaggtctttgtcacccgactcagtgcagcctgtgggagccaagtggctcctccaagccatcctcagcc cctgccctgcccctgcattgtgcctgcctgggggttctgcatgcaaggctgtagctttgtccccaagaaggagagctctg tccacacttggcgccggggcaagcaggcagggccatgatggagcagcctttggagccccacccagctgtgctggctgact ccaaggttctgggcatggagagaccaagggaggcctcagggtgggggcagaagggccagatgagctgaggagggtccagg agatgcccagagcactgcaccttggagggcccagggcagagacacctgtttgtttgccctggccttgcctcttggcttct tcctgagattcttggccctttggggcctggagtgggctgatggcacccctggggagggcagccctccagtgccctgggcg gagctcttccttcttgtaaatcacctgcctgctctgccctcactgctatccccaacgccccccaacgcctgccctgtggg agaggaattccttggcctctcacaccgccattcatgctggtctgcagggatgccattctccgggaagccgtttactcctg ttgtgctgcacacacatgctgtgcaaagccctgggactaggactggacgtggcaagtggggctttgccagcattcggggc cagagtcaggctcatgtctccagcccggcttgcatccacaccccactagctattaggctgaggactctggatttggggcc atgatgctaggggcagggctgtatggccctccctagagaagaggctgccctgccacaggttgcaggcttgggcaaggaca ggcagaccctggggaggagctcctgtctctagctggacagtgctcctggggctccacttggccagctccttgctccccac gctcaaaatattccaggcacacttgagatgcatttcctccttggggcctcttcagttcttagagcctgggtctctgggca gcactggctggggccagaggactgtggtgcagacacgagctcgtctccagctgttctgtccctgaaaactggcaacaggc tgtccacctgagagggagacggagcagagctgcaggacactgccccagcccactctgaagtgtagcagcctcagcctgca gccctgggaagtcccatctgttcctgtccttccagcagcaggagctgccttgcgcagagatgggctctgccttttagtga catcgagcatctctcccaggcctcatgctgggtggtgagaggcagaagcctcactggacctgagctaaaaccaggatgtc acctgtaggggcccccactgggagctgggccccagagaggcaccctggaccacctactccttgtccagatgatcgaagtg gtgggaggagaagatgggggtgggcagagcaatgagcacagggacctcttctgtctgtggctgctgctcctcctccccag ccaaggctacactcctacattcagccacaggcaggggtccctcagggtgaggaggtggctgtgctttcagagggatcaag gctccagtctttacctggagttctacttttctgcagccaggagggtcctcagctagatttgtggggcggggagtccaggg gagagtgtgaatgctggcaaaactcccacccgccccacctcactcaggcctaggcacctgcaggcaccaccactgggatg cccagcccagcatccagggaccccatcattgcgtagtcttggggtggggggtgaccccagcaggcctggccctgaccggc cctgcttgtccctagCGCCTGGTTCGCATGAACATGCCCATCTCCAACGAGGACATGACTGTTCACTTCACGTCCACGCT GATGGCCCTCATCCGGACGGCACTGGAGATCAAGCTGGCCCCAG

Claims

1. A guide RNA molecule (gRNA) comprising, and CACNA1B A first portion of the target genome sequence located between exons 37a and 38 in the gene, complementary to which it is used for binding to CRISPR-related proteins, wherein said first portion comprises or consists of the following sequences: - Sequences selected from SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.

6. - A sequence that has at least 95% or at least 99% identity with a sequence selected from SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.

6.

2. The gRNA molecule according to claim 1, wherein the target genome sequence is located in a region containing CACNA1B The sequence containing or including the branching site of exon 37b of the gene CACNA1B The sequence of the branching site of exon 37b of the gene.

3. The gRNA molecule according to claim 1 or 2, wherein the branching site comprises a sequence selected from ggcctcGc, accccAc, ccctcCc and ccctAc, or is composed of a sequence selected from ggcctcGc, accccAc, ccctcCc and ccctAc.

4. The gRNA molecule according to any one of claims 1 to 3, wherein the target genome sequence is located at... CACNA1B The sequence of exon 37b of the gene or containing the above CACNA1B The sequence of exon 37b of the gene, or the target genome sequence described therein, is located in... CACNA1B Between exon 37b and exon 38 of the gene.

5. The gRNA molecule according to claim 4, wherein the first portion comprises or consists of a sequence selected from SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

6. The gRNA molecule according to any one of claims 1 to 5, comprising a second portion capable of binding the CRISPR-associated protein in a manner that forms a gRNA / protein ribonucleoprotein complex.

7. The gRNA molecule according to any one of claims 1 to 6, wherein the gRNA molecule comprises a sequence selected from SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 12 or is composed of a sequence selected from SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11 and SEQ ID NO. 12, preferably comprising a sequence selected from SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9 or is composed of a sequence selected from SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO.

9.

8. The gRNA molecule according to any one of claims 1 to 7, wherein the gRNA molecule is a single-stranded RNA molecule (sgRNA).

9. A ribonucleoprotein complex comprising a gRNA molecule according to any one of claims 1 to 8 and a CRISPR-related protein, preferably a CRISPR-related endonuclease.

10. The ribonucleoprotein complex according to claim 9, wherein the CRISPR-associated protein is a Cas9 endonuclease or a variant, ortholog, homolog, mutant, or fragment thereof that retains endonuclease activity.

11. The ribonucleoprotein complex according to claim 10, wherein, The CRISPR-related protein is a variant or mutant of a CRISPR-related endonuclease, preferably a variant or mutant of the Cas9 endonuclease or its homologs or orthologs, which lacks endonuclease activity and is associated with or coupled to at least one functionally active domain capable of modifying or mutating the DNA sequence, preferably capable of deamination.

12. The ribonucleoprotein complex of claim 11, wherein the variant or mutant of the CRISPR-associated endonuclease is a dCas9 or dCas13 protein.

13. The ribonucleoprotein complex according to any one of claims 11 to 12, wherein the Cas9 endonuclease is derived from Streptococcus (… Streptococcus ) or Staphylococcus ( Staphylococcus ), especially those derived from Streptococcus pyogenes ( Streptococcus pyogenes ) or Staphylococcus aureus ( Staphylococcus aureus ).

14. The ribonucleoprotein complex according to any one of claims 10 to 13, wherein when said complex is introduced into brain cells, it is able to increase the content of ribonucleoproteins. CACNA1B Expression levels of splice variants of the messenger RNA (mRNA) of exon 37a of the gene.

15. A nucleic acid comprising: (a) a sequence encoding a gRNA molecule according to any one of claims 1 to 8; and (b) a sequence encoding a CRISPR-related protein, preferably wherein the CRISPR-related protein is a Cas9 endonuclease or a variant, homology, ortholog, mutant, or fragment thereof that retains endonuclease activity.

16. The nucleic acid according to claim 15, wherein the CRISPR-related protein is a variant or mutant of a CRISPR-related endonuclease, preferably a variant or mutant of a Cas9 endonuclease or its homolog or ortholog, wherein the variant or mutant lacks endonuclease activity, and preferably wherein the CRISPR-related protein is a dCas9 protein.

17. The nucleic acid according to claim 15 or 16, further comprising (c) a sequence encoding a functionally active domain, said functionally active domain being capable of being modified or mutated in the DNA sequence, preferably capable of being deaminated.

18. The nucleic acid according to any one of claims 16 or 17, wherein the Cas9 endonuclease is derived from Streptococcus (… Streptococcus ) or Staphylococcus ( Staphylococcus ), especially those derived from Streptococcus pyogenes ( Streptococcus pyogenes ) or Staphylococcus aureus ( Staphylococcus aureus ).

19. A vector comprising the nucleic acid of any one of claims 15 to 18.

20. The vector according to claim 19, wherein the vector is a viral vector, preferably an adeno-associated virus vector (AAV).

21. A composition comprising a gRNA molecule according to any one of claims 1 to 8 and / or a ribonucleoprotein complex according to any one of claims 9 to 14, and / or a nucleic acid according to any one of claims 15 to 18, and / or a carrier according to claim 19 or 20, preferably wherein the composition is a pharmaceutical composition.

22. The composition of claim 21, further comprising a CRISPR-related protein and / or a nucleic acid encoding the CRISPR-related protein.

23. The composition of claim 22, wherein the CRISPR-related protein is a Cas9 endonuclease or a variant, homology, ortholog, mutant, or fragment thereof that retains endonuclease activity.

24. The composition of claim 23, wherein the CRISPR-related protein is a variant or mutant of the Cas9 endonuclease, or a variant or mutant of a Cas9 endonuclease homolog or ortholog, the variant or mutant lacking endonuclease activity, the variant or mutant being associated with or coupled to at least one functionally active domain capable of producing modifications or mutations in the DNA sequence, preferably capable of producing deamination.

25. The composition according to any one of claims 21 to 24, further comprising one or more pharmaceutically acceptable carriers or excipients.

26. The composition according to any one of claims 21 to 25, used as a pharmaceutical.

27. The composition according to claim 26, for the treatment and / or prevention of [the condition] in individuals in need. CACNA1A Diseases or functional defects caused by one or more mutations in the body.

28. The composition according to any one of claims 26 or 27, for the treatment and / or prevention of ataxia or epilepsy in an individual in need.

29. The composition according to any one of claims 26 to 28, for the treatment and / or prevention of a disease selected from paroxysmal ataxia, particularly type 2; Familial hemiplegic migraine, especially type 1; Spinocerebellar ataxia, especially type 6; developmental and epileptic encephalopathy, especially type 42; and migraine with or without aura.

30. An in vitro or ex vivo method for modifying target cells, the method comprising contacting the target cells with a gRNA molecule of any one of claims 1 to 8, a ribonucleoprotein complex of any one of claims 9 to 14, a nucleic acid of any one of claims 15 to 18, a carrier of claim 19 or 20, and / or a composition of any one of claims 21 to 29.

31. The method of claim 30, wherein the modification comprises or consists of: In containing CACNA1B The introduction and / or deletion and / or mutation of one or more nucleotides in the sequence of the branching site of exon 37b of the gene.

32. A method for regulating and / or increasing the content of [certain substances] in target cells. CACNA1B An in vitro or ex vivo method for expressing a messenger RNA (mRNA) splice variant of gene exon 37a, the method comprising contacting the target cell with a gRNA molecule of any one of claims 1 to 8, a ribonucleoprotein complex of any one of claims 9 to 14, a nucleic acid of any one of claims 15 to 18, a vector of any one of claims 19 or 20, and / or a composition of any one of claims 21 to 29.

33. The method according to any one of claims 31 to 32, wherein the target cell is a eukaryotic cell, preferably a mammalian cell.

34. The method according to any one of claims 31 to 33, wherein the target cell is a brain cell.

35. The method according to any one of claims 31 to 34, further comprising qualitative and / or quantitative determination of... CACNA1B At least one step in the expression level of the messenger RNA (mRNA) splicing variant of gene exon 37a.

36. The method of claim 35, wherein the assay is performed by reverse transcriptase quantitative polymerase chain reaction (RT-qPCT).

37. A modified isolated cell containing mutants CACNA1B Genes, wherein the cells are obtained by the method defined in any one of claims 30 to 36.

38. The modified isolated cells according to claim 37, wherein the cells are eukaryotic cells, preferably mammalian cells.

39. The modified isolated cells according to claim 37 or 38, wherein the cells are brain cells.

40. A pharmaceutical composition comprising a plurality of modified isolated cells according to any one of claims 37 to 39, for use as a drug.

41. The pharmaceutical composition according to claim 40, for the treatment and / or prevention of illness in individuals in need. CACNA1A Diseases or functional defects caused by gene mutations.

42. The composition according to any one of claims 40 or 41, for the treatment and / or prevention of ataxia and / or epilepsy in an individual in need.

43. The composition according to any one of claims 40 to 42, for the treatment and / or prevention of a disease selected from paroxysmal ataxia, particularly type 2; Familial hemiplegic migraine, especially type 1; Spinocerebellar ataxia, especially type 6; developmental and epileptic encephalopathy, especially type 42; and migraine with or without aura.

44. A kit for modifying target cells, comprising one or more gRNA molecules according to any one of claims 1 to 8, ribonucleoprotein complexes according to any one of claims 9 to 14, nucleic acids according to any one of claims 15 to 18, a vector according to claim 19 or 20, and / or a composition according to any one of claims 21 to 29.

Images