Compositions and methods comprising small nuclear RNA (snRNA) for the treatment of DMD

Abstract

This article discloses a SnRNA system that targets DMA RNA sequences.

Description

[0001] Related applications This application claims priority and benefit to U.S. Provisional Application No. 63 / 585,293, filed September 26, 2023, the contents of which are hereby incorporated in their entirety.

[0002] Reference to the electronic sequence list The contents of the electronic sequence list (LOCN_024_001WO_SeqList_ST26.xml; size: 1,227,589 bytes; and creation date: September 25, 2024) are hereby cited in their entirety and incorporated into this article. Technical Field

[0003] This disclosure relates to molecular biology, gene therapy, and compositions and methods for modifying the expression and activity of RNA molecules. Background Technology

[0004] There is a long-standing but unmet need in this field for effective therapies to correct dysfunctional messenger RNA.

[0005] Small nuclear RNAs (snRNAs) are among the smallest RNA types, averaging about 150 nucleotides in size. snRNAs are functional non-coding RNAs. Eukaryotic genomes encode a variety of non-coding RNAs, including snRNAs, a highly abundant class of RNAs located in the cell nucleus that play important roles in intron splicing and RNA processing. During precursor mRNA splicing, snRNAs can form ribonucleoprotein particles (snRNPs) with other proteins. These snRNPs then form large particle complexes (spliceosomes) that bind to unspliced ​​precursor mRNA transcripts with other proteins. Besides splicing, snRNAs play roles in nuclear maturation of nascent transcripts, regulation of gene expression, acting as splice donors in non-canonical systems, and 3' end processing of replication-dependent histone mRNAs. U7 snRNAs can be programmed to bind and regulate mRNAs without expressing exogenous proteins, which could ultimately reduce the risk of immunogenicity observed in some other protein-based gene therapy treatments. Furthermore, the small size of these programmed snRNAs creates opportunities for developing single-vector, highly specific (allele-specific), single-target, and multi-target gene therapy methods.

[0006] Duchenne muscular dystrophy is caused by DMDMutations in the gene cause DMD. The monogenic diseases or disorders associated with DMD are Duchenne muscular dystrophy or Becker muscular dystrophy. DMD is the largest gene in the human genome, containing 79 exons separated by introns up to 250 kb in length. DMD encodes dystrophin, a protein that stabilizes the plasma membrane in skeletal muscle. Exon skipping to restore the frame (e.g., caused by a frameshift due to exon 50 deletion) reduces the severity of Duchenne muscular dystrophy to the severity exhibited in patients with Becker muscular dystrophy. Therefore, exon skipping to restore near-full-length dystrophin offers a promising opportunity for treating patients with Duchenne muscular dystrophy (DMD), who... DMD The gene contains a frameshift deletion of mRNA; however, exon skipping is usually limited to antisense oligonucleotides, which are poorly taken up in diseased tissues. Recent efforts in AAV9-U7 snRNA gene therapy targeting exon 2 and in converting out-of-frame mutations to in-frame mutations using modified U7 snRNAs (Goyenvalle et al., 2009, 17(7): 1234-1240.) have shown promise, but these early strategies struggle to address low titers and inconsistent transgene expression. Therefore, this disclosure provides compositions and methods comprising a novel therapeutic RNA targeting platform containing engineered snRNA. Summary of the Invention

[0007] This disclosure provides nucleic acid molecules comprising a target RNA of small nuclear RNA (snRNA), wherein the snRNA comprises a target sequence that binds to a dystrophin (DMD) RNA sequence, wherein the DMD RNA sequence comprises at least one splicing regulatory sequence selected from the group consisting of a splice acceptor sequence, a splice donor sequence, and an exon splice enhancer sequence.

[0008] In some respects, the DMD RNA sequence is at least one of exon 2, exon 44, exon 45, exon 51 and / or exon 53.

[0009] In some respects, the target sequence comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with the nucleic acid sequence shown in any one of SEQ ID NO: 59-118, 126, 206-227, and 237-1344.

[0010] In some aspects, the snRNA comprises a stem loop (SL) containing a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with one or more nucleic acid sequences shown in any one of SEQ ID NO: 1 - SEQ ID NO: 11, SEQ ID NO: 144 - SEQ ID NO: 148, SEQ ID NO: 164, SEQ ID NO: 186, SEQ ID NO: 190 - SEQ ID NO: 205, SEQ ID NO: 228 - SEQ ID NO: 230, SEQ ID NO: 235, or SEQ ID NO: 236.

[0011] The nucleic acid molecule of the target RNA of claim 1, wherein the stem loop (eSL) comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with the engineered stem loop, and the engineered stem loop comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with one or more nucleic acid sequences shown in any one of SEQ ID NO: 1 - SEQ ID NO: 11.

[0012] In some respects, the snRNA comprises an engineered stem-loop (eSL) that contains one or more nucleic acid sequences shown in any one of SEQ ID NO:1 - SEQ ID NO:11.

[0013] In some respects, DMD RNA sequences are precursor mRNA or mRNA sequences.

[0014] In some respects, snRNA contains two target sequences that target two different RNAs. In other respects, the two target sequences are a fusion sequence.

[0015] In some aspects, the snRNA comprises a SmBD selected from the U1, U2, U4, and U5 Sm-binding domains (SmBD). In some aspects, the SmBD comprises the nucleic acid sequence shown in any one of SEQ ID NO: 31 - SEQ ID NO: 38.

[0016] In some respects, the snRNA contains a 5' interaction stabilizer domain (5'ISD), which comprises a nucleotide sequence selected from any one of SEQ ID NO: 12 - SEQ ID NO: 23.

[0017] In some respects, snRNA contains the nucleic acid sequence shown in this disclosure.

[0018] A vector comprising one or more snRNAs according to any embodiment of the present disclosure. In some aspects, the vector is an AAV vector.

[0019] In some respects, the snRNA is operatively linked to a promoter. In some respects, the snRNA is operatively linked to either the U7 or U1 promoter. In some respects, the snRNA is operatively linked to a downstream terminator (DT). In some respects, the snRNA is operatively linked to either the U7 or U1 downstream terminator.

[0020] In some respects, the vector contains at least one, at least two, at least three, at least four, or at least five snRNAs. In some respects, at least one, at least two, at least three, at least four, or at least five snRNAs each target the same target RNA sequence. In some respects, at least one, at least two, at least three, at least four, or at least five snRNAs target two or more target RNA sequences.

[0021] In some respects, each snRNA is separated by a buffer sequence. In some respects, the buffer sequence contains a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with the nucleic acid sequences shown in any one of SEQ ID NO: 24 - SEQ ID NO: 30.

[0022] In some respects, the vector contains a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage therebetween) identity with the nucleic acid sequence shown in any one of SEQ ID NO: 130 - SEQ ID NO: 138.

[0023] This disclosure provides methods for targeting one or more target RNAs and blocking, knocking down, editing, exon skipping, or splicing the one or more target RNAs, including contacting the snRNA of this disclosure with a cell containing the one or more target RNAs.

[0024] This disclosure provides a nucleic acid molecule that targets DMD RNA, comprising any one of the target sequences shown in 59-118, 206-227, and 237-333.

[0025] This disclosure provides a method for treating a subject’s disease or disorder, including administering a nucleic acid molecule of the target RNA of this disclosure or an AAV vector of this disclosure.

[0026] In some respects, the disease or disorder is Duchenne muscular dystrophy.

[0027] In some respects, administration is intravenous, intramuscular, subpiacular, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intraocular, and / or parenteral. Attached Figure Description

[0028] Figure 1A-1C The study showed that fusion spacer regions promote higher levels of exon skipping than single spacer regions alone. U7 snRNAs modified to include splice regulatory sequences (SA = splice acceptor, SD = splice donor, and / or ESE = exon enhancer sequence) to skip the spacer region of exon 53 resulted in the restoration of the DMD mRNA reading frame and the restoration of dystrophin in patients with del52 mutations in DMD patients. Figure 1A A schematic diagram is provided depicting the expected PCR product size when primers are used in exons 51 and 54. Figure 1B TapeStation images of RT-PCR products after U7snRNA treatment with single U7 synthetic RNA and fusion U7 synthetic RNA are shown, displaying the non-jumping PCR product (top band, 365 bp) and jumping product (bottom band, -153 bp) of DMD exon 53. Untreated cells were used as a negative control sample. Figure 1C Provided from Figure 1B The quantitative results are shown as the percentage of exon 53 skipping (skipping bands / skipping bands + non-skipping bands).

[0029] Figure 2 Recovery of dystrophin staining reveals AAV9 snRNA-mediated exon 53 skipping in human del45-52 DMD myotubes. The images depict immunofluorescence of dystrophin after 1-week treatment with A05014 (scAAV9-dual snRNA cassette targeting exon 53), 1E5 vector genomic / cell transduction of DMD myotubes. Untreated cells shown on the right serve as a negative control. DAPI staining represents the cell nucleus.

[0030] Figure 3A-3B demonstrates AAV9 snRNA-mediated exon 53 skipping in vitro and in vivo. Figure 3 A provides a graph depicting the percentage of exon 53 skipping in human DMD myotubes 7 days after treatment with A05211 at MOIs of 1E3, 1E4, and 1E5 vg / cells. Figure 3 B provides a graph depicting the percentage of exon 53 skipping in various tissues (gastroc, heart, liver, tibialis anterior (TA), brain, diaphragm, and triceps) 4 weeks after administration of 2.4E12 vg / AAV9-A05211 to the retroorbital region.

[0031] Figures 4A-4C This study demonstrates the use of synthetic fusion U7 snRNA to target DMD exon 44 in myotubes of patients with exon 45 deletion. Figure 4A This study demonstrates the mechanism by which snRNA promotes exon 44 skipping and frame recovery in patients with DMD due to mutations (e.g., exon 45 deletion). Therefore, U7 snRNA is modified to bind splicing regulatory sequences to promote exon 44 skipping. Figure 4B TapeStation images of RT-PCR products after treatment with single and fused U7 synthetic RNAs in Δ45 Inserm tubes are shown, displaying the non-jumping (top band) and jumping (bottom band) products of DMD exon 44 PCR. Untargeted U7 (NT) and untreated cells (U) were used as negative control samples. Figure 4C Quantitative results from 4B are depicted as the percentage of exon 44 skipping (intensity of skipping bands / intensity of skipping bands + intensity of non-skipping bands).

[0032] Figures 5A-5B The study showed an increased exon 44 skipping level using a second-generation fusion spacer region targeting exon 44 in the Δ45 myotube. Figure 5A TapeStation images of RT-PCR products after treatment with U7 snRNA using an optimized second-generation fusion spacer region (synthetic RNA) are shown. The gel images show the non-jumping product (top band) and jumping product (bottom band) of DMD exon 44 PCR. Untargeted U7 (NT) and untreated cells (U) were used as negative control samples. Figure 5B Depicting from Figure 5A The quantitative results are shown as the percentage of exon 44 skipping (intensity of skipping bands / intensity of skipping bands + intensity of non-skipping bands).

[0033] Figures 6A-6D This shows AAV9-mediated snRNA exon 44 skipping in the patient's myotube. Figure 6A A graph depicting the percentage of exon 44 skipping in Δ45 Inserm myotubes transduced with A05374 and A05375 (scAAV9 vectors with 2×U7 snRNA cassettes) at different MOIs is provided (intensity of skipping bands / intensity of skipping bands + intensity of non-skipping bands). Synthetic U7sR220334 was used as a positive control, and untreated (UNT) and AAV null (empty capsid) were used as negative controls. Figure 6B U7 snRNA expression at different MOIs is shown, and is represented as snRNA copy number per nanogram of total RNA obtained by ddPCR for A05374 and A05375. Figure 6C Jess blots of dystrophin expression after treatment with A05374 or A05375 at different MOIs are shown. AAV null and untreated (NT) are negative controls. Lysates from wild-type (WT) myotubes were used to generate 0-50% standard curves for dystrophin (Dys) expression. α-Act (α-actin) is a loading control. Figure 6D A graph showing the quantification of dystrophin expression relative to WT levels and normalized for α-actin is provided.

[0034] Figures 7A-7C Screening for synthetic snRNAs targeting exon 45 for skipping was demonstrated. U7 snRNAs were engineered to bind splicing regulatory sequences (SA, splice acceptor; SD, splice donor; and / or ESE, exon splicing enhancer sequence) to promote exon 45 skipping, which resulted in the restoration of the DMD mRNA reading frame in patients with Δ44 mutations, as well as the restoration of dystrophin. Figure 7A A schematic diagram is provided depicting the expected RT-PCR product sizes using primers in exons 43 and 46 / 47 after transfection of human muscle tubes with 100 nM synthetic snRNA. The predicted size including exon 45 is 487 bp, while excluding exon 45 it is 311 bp. Figure 7B TapeStation image showing RT-PCR products after transfection with synthetic RNA. sR04 (a synthetic snRNA carrying a non-target sequence) and untreated cells (unt) were used as negative control samples. Figure 7C Provided a description Figure 7B The quantitative plot shows the percentage of exon 45 skipping (skipping bands / skipping bands + non-skipping bands).

[0035] Figures 8A-8BThis study demonstrates the screening of synthetic snRNAs at a low concentration (25 nM) to identify effective spacer sequences. Figure 8A TapeStation images of RT-PCR products after transfection with U7 snRNA to synthesize RNA are shown. sR04 (which is a synthetic snRNA carrying a non-target sequence) and untreated (unt) cells were used as negative control samples. Exon 45 was predicted to be 487 bp, while exon 45 was predicted to be 311 bp. Figure 8B Provided a description Figure 8A The quantitative plot shows the percentage of exon 45 skipping (skipping bands / skipping bands + non-skipping bands).

[0036] Figures 9A-9B This study demonstrates AAV9-mediated exon 45 skipping in human Δ44 (exon 44 deleted) myotubes. Figure 9A A graph depicting the percentage of exon 45 skipping 7 days after transduction with A05189 and A05190 (scAAV9-dual snRNA boxes) at different MOIs is provided. Figure 9B A graph is provided depicting the snRNA copy number per nanogram of total RNA as assessed by ddPCR for the snRNAs expressed by A05189 and A05190.

[0037] Figures 10A-10B Single exon skipping and multiple exon skipping of DMD exons 50-53 are shown. Figure 10A TapeStation images of RNA extracted by RT-PCR 7 days after transduction of human del52 myotubes with the AAV-based 4× construct A05178 are provided to identify exon skipping. A05178 carries engineered snRNAs targeting exons 50, 51, 52, and 53. Figure 10B A graph of exon skipping percentages is provided. Exon skipping bands are quantified by dividing the peak molar concentration of the amplicon (representing a single exon skip or multiple exon skips) by the signal of all DMD amplicones.

[0038] Figure 11A-11B The multi-exon skipping strategy for skipping exons 44 and 45 is shown. Figure 11A TapeStation images of the RT-PCR products were provided to identify skipping 24 hours after transfection of human wild-type myotubes with U7 synthetic snRNA targeting exons 44 and 45. Figure 11B A graph of exon skipping percentages is provided. To determine the multiple skipping percentage, the signals of the skipping bands of exon 44 and exon 45 are divided by the signals of all DMD amplicon bands. Detailed Implementation

[0039] This disclosure provides gene therapy compositions comprising a therapeutic RNA targeting platform comprising a short nuclear RNA (snRNA) that targets a precursor mRNA (pre-mRNA) or mRNA sequence encoding dystrophin (DMD). The targeted precursor mRNA or mRNA sequence may include exon regions of DMD and / or splicing regulatory sequences of DMD.

[0040] This document discloses compositions comprising nucleic acid molecules and vectors comprising one or more snRNA constructs targeting DMD. The snRNA molecules disclosed herein may be non-natural, modified, and / or engineered snRNAs (esnRNAs). The DMD-targeting esnRNAs disclosed herein contain mutant snRNA stem-loops. In some aspects, the DMD-targeting snRNAs disclosed herein contain natural stem-loops.

[0041] Small nucleoribonucleic acid (snRNA) is an essential component of the small nucleoribonucleoprotein complex (snRNP), which, when assembled with other proteins, forms a large nucleoribonucleoprotein complex called the spliceosome, a cellular mechanism responsible for mediating the entire mRNA maturation process. The spliceosome is responsible for precursor mRNA splicing, the process of removing introns from RNA transcripts before protein production. The size of a single snRNA is typically about 250 nucleotides or less. For example, U1 snRNA is 164 nucleotides long and is encoded by a gene present in several copies within the human genome. U1 snRNA represents the ribonucleic acid component of the nuclear particle U1 snRNP. U1 snRNA has a stem-loop three-dimensional structure and a single-stranded sequence, typically about 9 nucleotides long, located in the 5' region, which can bind to the splice donor site on the precursor mRNA molecule via complementary base pairing (Horowitz et al., 1994, Trends Genet., 10(3):100-6). Different spliceosomal snRNAs have been named U1, U2, U4, U5, U6, U4ATAC, U6ATAC, U7, U11 and U12 due to the large amount of uridine monophosphate they contain (Mattaj et al., 1993, FASEB J, 15, 7:47-53).

[0042] snRNA systems can be used to address toxic mutations. For example, antisense oligonucleotides that interfere with splicing sites and regulatory elements within exons containing toxic mutations can induce specific exon skipping at the precursor RNA level. Such antisense sequences can be packaged in snRNA sequences delivered using viral vectors carrying nucleic acid sequences that can be transcribed from those nucleic acid sequences. U7 snRNAs are endogenously involved in the processing of the 3' end of histone precursor mRNAs, but can be transformed into a universal tool for splicing regulation through minor changes to the binding sites of Sm / Lsm proteins. One such therapeutic strategy for treating Duchenne muscular dystrophy uses modified U7 snRNAs to convert out-of-frame mutations into in-frame mutations, resulting in toxic RNA with an internal deletion, but still functioning as a dystrophic protein (Goyenvalle et al., 2009, 17(7): 1234-1240.).

[0043] Most U-rich snRNPs are complexes that mediate the splicing of precursor mRNAs. U7 snRNPs are an exception. U7 is not involved in splicing but is a key factor in the unique 3' end processing of replication-dependent histone mRNAs. By modifying the histone-binding sequence and Sm motif of U7 snRNAs, U7 no longer participates in the processing of precursor histone mRNAs but instead targets precursor mRNAs or smRNAs for blocking or splicing regulation. In this way, U7 snRNAs can be used as an effective gene therapy platform. The U7 snRNA platform also has the following additional advantages: compact size, ability to accumulate in the cell nucleus without causing cytotoxicity, and minimal immunoreactivity (Gadgil et al., 2021, J Gene Med, 23(4): e3321.).

[0044] In some respects, this paper discloses esnRNAs containing engineered stem-loops (eSLs). Compensatory modifications to the natural stem-loop sequence produce engineered stem-loops (eSLs) that communicate more effectively with the snRNA interaction stabilization domain (ISD) (folding and annealing), resulting in a snRNA platform with enhanced stability. U7 snRNAs have previously been shown to be programmable to regulate mRNA. This paper discloses programmed engineered snRNA improvements that can be used as gene therapy tools.

[0045] The snRNA system disclosed herein is configured to bind to a target DMD RNA sequence to regulate RNA splicing, which can cause single or multiple exon skipping or exon inclusion of the targeted DMD RNA sequence. The DMD-targeting snRNA is configured to bind to a DMD precursor mRNA molecule at a site regulating RNA splicing. The splicing regulatory site may include a splice acceptor sequence, a splice donor sequence, and an exon splicing enhancer sequence. The disclosed snRNA sequence can induce exon skipping (single or multiple exons) of the targeted exon sequence.

[0046] In one embodiment, these snRNAs are human snRNAs. In another embodiment, these snRNAs are mouse snRNAs. In yet another embodiment, the snRNAs belong to any species. In another embodiment, the snRNAs are a combination of human and mouse snRNAs. In one embodiment, the U7 snRNA is either human or mouse U7 snRNA. In another embodiment disclosed herein, the snRNAs contain different types of snRNAs (U1-U12, etc.) by combining domains of endogenous snRNAs to fine-tune platform stability and / or reduce off-target effects. For example, in one embodiment, the snRNA system comprises a combination of human or mouse U7 snRNA and human or mouse U1 snRNA components.

[0047] Additional elements that can regulate RNA processing and abundance can be further engineered into snRNA or eSL-containing esnRNA. In one embodiment, additional elements that can regulate the processing, stability, and abundance of esnRNA can be further engineered into esnRNA at the 5' or 3' end. In another embodiment, such elements may include, but are not limited to, stem loops, hairpins, GC clips, kissing loops, triple strands, quadruple strands, and protein binding sites.

[0048] The snRNA platform disclosed herein, and portions thereof, can be used in any therapeutic setting and context, provided that a suitable spacer region or target sequence TS is included in the design of the therapeutic composition. In some embodiments, the therapeutic snRNA composition is used to treat diseases associated with dysregulated, mutated, or nonfunctional dystrophin proteins. In some aspects, the disease or dysregulation is Duchenne muscular dystrophy.

[0049] Target sequence SnRNA systems can be programmed to include a target sequence (TS) (also called a “spacer region”) that targets a specific target RNA. SnRNA systems can be programmed with one or more target sequences that target one or more target RNAs. In some aspects, the target sequence is a 5' target sequence (5'TS) (also called a “spacer region”) that targets one or more target RNAs. In this case, 5' refers to the 5' end of the snRNA insert and not necessarily to the overall vector configuration containing one or more snRNA inserts. The TS can be located at or near the 5' end of the snRNA. In an alternative implementation, the target sequence (TS) can be located at or near the 3' position in the snRNA construct, resulting in a 3' target sequence (3'TS), particularly when the snRNA construct is not based on U7-based snRNAs.

[0050] The length of the target sequence (including the 5'TS and 3'TS) disclosed herein can be between about 1 and about 200 nucleotides. In some aspects, the length of the target sequence disclosed herein is between about 10 and about 150 nucleotides. In some aspects, the length of the target sequence disclosed herein is between about 10 and about 100 nucleotides. In some aspects, the length of the target sequence disclosed herein is between about 20 and about 60 nucleotides. In some aspects, the length of the target sequence disclosed herein is at least about 10, 20, 30, 40, 50, 60, or about 70 nucleotides.

[0051] The snRNA compositions disclosed herein may contain more than one target sequence, wherein each target sequence binds to a different RNA sequence. In some aspects, the esnRNAs disclosed herein contain fusion target sequences. In some aspects, a fusion target sequence is a nucleic acid sequence comprising two target sequences directly linked or linked via one or more adapter nucleic acid sequences, wherein each target sequence binds to a different target RNA sequence.

[0052] In one instance, U7 snRNA can be programmed by replacing the histone mRNA binding sequence with a sequence complementary to the target. In some aspects, the snRNA systems disclosed herein bind to target mRNA or precursor mRNA sequences. The exemplary snRNA systems shown herein result in exon skipping (for treating DMD, e.g., DMD exon skipping).

[0053] In some embodiments, the snRNA of this disclosure targets a precursor mRNA or mRNA sequence encoding the DMD gene. DMD is a gene encoding the protein dystrophin. Mutations in DMD are associated with Duchenne muscular dystrophy. In some embodiments, the DMD RNA sequence targeted by the snRNA composition of this disclosure can be any exon or intron DMD RNA sequence. In some embodiments, the DMD RNA sequence targeted by the snRNA composition of this disclosure is an exon 2, exon 44, exon 45, exon 51, or exon 53 DMD RNA sequence. In some embodiments, the DMD RNA sequence targeted by the snRNA composition of this disclosure is a combination of sequences selected from exon 1, exon 2, exon 3, exon 4, exon 5, exon 44, exon 45, exon 50, exon 51, exon 52, exon 53, exon 54, and exon 55 DMD RNA sequences, arranged in a manner that skips multiple exons. In some embodiments, the targeting sequence targets the target RNA to skip DMD exons 50, 51, 52, and 53. In some embodiments, the targeting sequence targets the target RNA to skip exons 44 and 45. In some embodiments, the DMD RNA sequence targeted by the snRNA composition of this disclosure is a combination of sequences selected from exons 1, 2, 3, 4, and 5. In some embodiments, the DMD RNA sequence targeted by the snRNA of this disclosure is a splicing regulatory sequence selected from splice acceptor sequences, splice donor sequences, and / or exon splicing enhancer sequences.

[0054] In some embodiments, the nucleic acid sequence encoding wild-type human DMD mRNA comprises or consists of SEQ ID NO: 139. In some embodiments, the nucleic acid sequence encoding wild-type human DMD mRNA comprises a sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the sequence shown in SEQ ID NO: 139. In some embodiments, the nucleic acid sequence encoding wild-type human DMD precursor mRNA comprises or consists of SEQ ID NO: 140. In some embodiments, the nucleic acid sequence encoding wild-type human DMD precursor mRNA comprises a sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the sequence shown in SEQ ID NO: 140. In some embodiments, the nucleic acid sequence encoding human DMD contains a deletion. In some embodiments, the deletion is a single nucleotide. In some embodiments, the deletion may be one or more nucleotides. In some embodiments, the deletion is an exon or intron sequence. In some embodiments, the deletion comprises intron and exon sequences. In some embodiments, the deletion occurs in a region comprising one or more of exons 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, and 55, and any introns upstream and downstream of these exons. In some embodiments, the amino acid sequence encoding dystrophin comprises or consists of SEQ ID NO:141. In some embodiments, the amino acid sequence of human dystrophin comprises a sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the sequence shown in SEQ ID NO:141.

[0055] The target sequence binding to DMD exon 2 may comprise, substantially comprise, or comprise of one or more of the following nucleotide sequences shown in Table 1 below, having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with them: Table 1: DMD Exon 2 RNA Targeting Sequences In some implementation plans, combined with human DMD The target sequence for exon 2 includes the sequence shown in SEQ ID NO: 59. In some embodiments, it is combined with human... DMDThe target sequence for exon 2 includes the sequence shown in SEQ ID NO: 60. In some embodiments, the target sequence for binding human DMD exon 2 includes the sequence shown in SEQ ID NO: 61. In some embodiments, the target sequence for binding human DMD exon 2 includes the sequence shown in SEQ ID NO: 61. DMD The target sequence for exon 2 includes the sequence shown in SEQ ID NO: 62. In some embodiments, it is combined with human... DMD The target sequence for exon 2 includes the sequence shown in SEQ ID NO: 63. In some embodiments, it is combined with human... DMD The target sequence for exon 2 includes the sequence shown in SEQ ID NO: 64. In some embodiments, it is combined with human... DMD The target sequence for exon 2 includes the sequence shown in SEQ ID NO: 65. In some embodiments, it is combined with human... DMD The target sequence for exon 2 includes the sequence shown in SEQ ID NO: 66. In some embodiments, it is combined with human... DMD The target sequence for exon 2 includes the sequence shown in SEQ ID NO: 67. In some embodiments, it is combined with human... DMD The target sequence for exon 2 includes the sequence shown in SEQ ID NO: 68. In some embodiments, it is combined with human... DMD The target sequence for exon 2 includes the sequence shown in SEQ ID NO: 69. In some embodiments, it is combined with human... DMD The target sequence for exon 2 comprises one or more sequences shown in any of SEQ ID NO: 334-674. In some embodiments, it is combined with human... DMD The target sequence of exon 2 comprises one or more sequences shown in any of SEQ ID NO:675-1011. In some embodiments, it combines with human... DMD The target sequence of exon 2 includes one or more sequences shown in any of SEQ ID NO: 1012-1344.

[0056] The target sequence binding to DMD exon 44 may comprise, substantially comprise, or comprise of one or more of the following nucleotide sequences shown in Table 2 below, having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with them: Table 2: DMD exon 44 RNA targeting sequence In some implementation plans, combined with human DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 70. In some embodiments, it binds to human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 71. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 72. In some embodiments, it binds to human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 73. In some embodiments, it binds to human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 74. In some embodiments, it binds to human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 75. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 76. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 77. In some embodiments, it binds to human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 78. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 79. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO:80. In some embodiments, it binds to human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 81. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 82. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 83. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 84. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 85. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 86. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 87. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 88. In some embodiments, it binds to human... DMDThe target sequence of exon 44 includes the sequence shown in SEQ ID NO: 89. In some embodiments, it is combined with human... DMD The target sequence of exon 44 includes the sequence shown in SEQ ID NO: 90.

[0057] The target sequence binding to DMD exon 45 may comprise, substantially comprise, or comprise of one or more of the following nucleotide sequences shown in Table 3 below, having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with them: Table 3: DMD exon 45 RNA targeting sequences In some implementation plans, combined with human DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 91. In some embodiments, it binds to human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 92. In some embodiments, it binds to human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 93. In some embodiments, it binds to human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 94. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 95. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 96. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 97. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 98. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 99. In some embodiments, it binds to human... DMD The target sequence for exon 45 includes the sequence shown in SEQ ID NO: 100. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO:101. In some embodiments, it is combined with human... DMDThe target sequence of exon 45 includes the sequence shown in SEQ ID NO: 102. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 103. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 104. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 105. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 106. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 107. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 108. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 109. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 110. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 111. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 112. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 113. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 114. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO:115. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 116. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 117. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 118. In some embodiments, it is combined with human... DMD The target sequence of exon 45 includes the sequence shown in SEQ ID NO: 126.

[0058] The target sequence binding to DMD exon 51 may comprise, substantially comprise, or comprise of one or more of the following nucleotide sequences shown in Table 4 below, having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with them: Table 4: DMD exon 51 RNA targeting sequences In some implementation plans, combined with human DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 206. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 207. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 208. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 209. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 210. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 211. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 212. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 213. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 214. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 215. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 216. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 217. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO:218. In some embodiments, it is combined with human... DMDThe target sequence of exon 51 includes the sequence shown in SEQ ID NO: 219. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 220. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 221. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 222. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 223. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 224. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 225. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 226. In some embodiments, it is combined with human... DMD The target sequence of exon 51 includes the sequence shown in SEQ ID NO: 227.

[0059] The target sequence binding to DMD exon 53 may comprise, substantially comprise, or comprise of one or more of the following nucleotide sequences shown in Table 5 below, having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with them: Table 5: DMD exon 53 RNA targeting sequence In some implementation plans, combined with human DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 237. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 238. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 239. In some embodiments, it is combined with human... DMDThe target sequence for exon 53 includes the sequence shown in SEQ ID NO: 240. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 241. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 242. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 243. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 244. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 245. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 246. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 247. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 248. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO:249.

[0060] In some implementation plans, combined with human DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 250. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 251. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 252. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 253. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 254. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 255. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 256. In some embodiments, it is combined with human... DMDThe target sequence for exon 53 includes the sequence shown in SEQ ID NO: 257. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 258. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 259.

[0061] In some implementation plans, combined with human DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 260. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 261. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 262. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 263. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 264. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 265. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 266. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 267. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 268. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 269.

[0062] In some implementation plans, combined with human DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 270. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 271. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 272. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 273. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 274. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 275. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 276. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 277. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 278. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 279.

[0063] In some implementation plans, combined with human DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 280. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 281. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 282. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 283. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 284. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 285. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 286. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 287. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 288. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 289.

[0064] In some implementation plans, combined with human DMDThe target sequence for exon 53 includes the sequence shown in SEQ ID NO: 290. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 291. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 292. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 293. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 294. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 295. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 296. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 297. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 298. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 299.

[0065] In some implementation plans, combined with human DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 300. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 301. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 302. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 303. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 304. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 305. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 306. In some embodiments, it is combined with human... DMDThe target sequence for exon 53 includes the sequence shown in SEQ ID NO: 307. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 308. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 309.

[0066] In some implementation plans, combined with human DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 310. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 311. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 312. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 313. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 314. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 315. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 316. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 317. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 318. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 319.

[0067] In some implementation plans, combined with human DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 320. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 321. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 322. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 323. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 324. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 325. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 326. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 327. In some embodiments, it is combined with human... DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 328. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 329.

[0068] In some implementation plans, combined with human DMD The target sequence for exon 53 includes the sequence shown in SEQ ID NO: 330. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 331. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 332. In some embodiments, it is combined with human... DMD The target sequence of exon 53 includes the sequence shown in SEQ ID NO: 333.

[0069] engineered stem ring The engineered snRNA (esnRNA) system disclosed herein may include an engineered stem-loop (eSL) comprising compensatory modifications to the stem-loop of a natural snRNA. These modifications result in improved stability of the engineered small nucleoribonucleoprotein complex (esnRNP) compared to snRNPs containing unmodified stem-loops. The eSL disclosed herein may be derived from any snRNP, such as U1-U12. In one embodiment, the eSL is a human or mouse U7 eSL. In another embodiment, the eSL is a human or mouse eSL. In some embodiments, the eSL is both human and mouse eSLs. In some embodiments, the eSL is a non-human eSL selected from mice, pigs, sheep, goats, cattle, dogs, cats, horses, or combinations thereof. In some embodiments, the eSL is an eSL selected from humans, mice, pigs, sheep, goats, cattle, dogs, cats, horses, or combinations thereof. In some embodiments, the eSL sequence is not a natural stem-loop sequence. In some implementations, at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) of the nucleic acid sequence of the eSL are not natural stem-loop sequences. The engineered stem-loop is described in WO2023168458, the contents of which are incorporated herein by reference in their entirety.

[0070] In some implementations, the human eSL comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with one or more of the following nucleotide sequences, and is substantially composed of or constitutes thereof: ggctttctggctccttaccggaaagcc (SEQ ID NO: 1)), ggctttctgggaggttaccggaaagcc (SEQ ID NO: 2), ggctttctggcctccttaccggaaagcc (SEQ ID NO: 3), ggctttctggggaggttaccggaaagcc (SEQ ID NO: 4), ggctttctggctggctaccggaaagcc (SEQ ID NO: 5), ggctttctggcttccccggaaagcc (SEQ ID NO: 6), ggctttctggcttcttcccggaaagcc (SEQ ID NO: 7), ggctttctggcaacttaccggaaagcc (SEQ ID NO: 8), ggctttctggttcggtaccggaaagcc (SEQ ID NO: 9), ggctttctggaagccttaccggaaagcc (SEQ ID NO: 10), ggctttctggcttcttaccggaaagcc (SEQ ID NO: 11) or GGCTTTCTGGCCTCCGCCGGAAAGCCCCT (SEQ ID NO: 186).

[0071] In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 1. In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 2. In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 3. In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 4. In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 5. In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 6. In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 7. In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 8. In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 9. In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 10. In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 111. In some embodiments, the human eSL comprises the sequence shown in SEQ ID NO: 186.

[0072] In some implementations, the mouse eSL comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with one or more of the following nucleotide sequences, and is substantially composed of or constitutes thereof: ggctttctggctccttaccggaaagcccct (SEQ ID NO: 164) Ggttttctgacctccgtcggaaaacccct (SEQ ID NO: 146), ggttttctgacctccttcggtcggaaaacccct (SEQ ID NO: 147), Ggttttctgacctccgtcggaaaacc (SEQ ID NO: 148), GGTTTTCTGACACTCCGTCGGAAAACCCCT (SEQ ID NO: 228), GGTTTTCTGATCTCCATCGGAAAACCCCT (SEQ ID NO: 229) or GGTTTTCCGACCTCCGTCGGAAAACCCT (SEQ ID NO: 230).

[0073] In some embodiments, the mouse eSL comprises the sequence shown in SEQ ID NO: 164. In some embodiments, the mouse eSL comprises the sequence shown in SEQ ID NO: 146. In some embodiments, the mouse eSL comprises the sequence shown in SEQ ID NO: 147. In some embodiments, the mouse eSL comprises the sequence shown in SEQ ID NO: 148. In some embodiments, the mouse eSL comprises the sequence shown in SEQ ID NO: 228. In some embodiments, the mouse eSL comprises the sequence shown in SEQ ID NO: 229. In some embodiments, the mouse eSL comprises the sequence shown in SEQ ID NO: 230.

[0074] In some implementations, the human or mouse eSL comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with one or more of the following nucleotide sequences, and is substantially composed of or constitutes thereof: GGCTTTCTGGCACTCCACCGGAAAGCCCCT (SEQ ID NO: 190), GGCTTTCTGGCACTCCGCCGGAAAGCCCCT (SEQ ID NO: 191) or GGCTTTCTGGCCTCCACCGGAAAGCCCCT (SEQ ID NO: 192).

[0075] In some embodiments, the human or mouse eSL comprises the sequence shown in SEQ ID NO: 190. In some embodiments, the human or mouse eSL comprises the sequence shown in SEQ ID NO: 191. In some embodiments, the human or mouse eSL comprises the sequence shown in SEQ ID NO: 192.

[0076] In some implementations, the dog or cat eSL contains a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with one or more of the following nucleotide sequences, and is substantially composed of or constitutes thereof: GGTTTTCCGGTCTCCACCGGAAAGCCCCC (SEQ ID NO: 193). In some embodiments, the dog or cat eSL contains the sequence shown in SEQ ID NO: 193.

[0077] In some implementations, the bovine, sheep, or goat eSL contains a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with one or more of the following nucleotide sequences, and is substantially composed of or constitutes thereof: GGCTTTCCGGTCTCCACCGGAAAGCCCCT (SEQ ID NO: 194) or GGCTTTCCGGCCTCCGCCGGAAAGCCCCT (SEQ ID NO: 195).

[0078] In some embodiments, the cow, sheep, or goat eSL contains the sequence shown in SEQ ID NO: 194. In some embodiments, the cow, sheep, or goat eSL contains the sequence shown in SEQ ID NO: 195.

[0079] In some implementations, the porcine eSL comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with one or more of the following nucleotide sequences, and is substantially composed of or constitutes thereof: GGTTTTCCGGTCTCCACCGGAAAACCCTT (SEQ ID NO: 196), GGTTTTCCGTGCTCCCACGGAAAACCCTT (SEQ ID NO: 197), GGTTTTCCGGCCTCCGCCGGAAAACCCTT (SEQ ID NO: 198), GGTTTTCCGTGACTCCCACGGAAAACCCTT (SEQ ID NO: 199) or GGTTTTCCGGCACTCCGCCGGAAAACCCTT (SEQ ID NO: 200).

[0080] In some embodiments, the porcine eSL comprises the sequence shown in SEQ ID NO: 198. In some embodiments, the porcine eSL comprises the sequence shown in SEQ ID NO: 199. In some embodiments, the porcine eSL comprises the sequence shown in SEQ ID NO: 200.

[0081] In some implementations, the horse eSL comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with one or more of the following nucleotide sequences, and is substantially composed of or constitutes thereof: GGTCTTCCGGTCTCCTCCGGAAGGCCCCC (SEQ ID NO: 201) or GGTCTTCCGGCTCCCCGGAAGGCCCCC (SEQ ID NO: 202).

[0082] In some embodiments, the MA eSL comprises the sequence shown in SEQ ID NO: 201. In some embodiments, the MA eSL comprises the sequence shown in SEQ ID NO: 202.

[0083] In some implementations, the sheep eSL comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with one or more of the following nucleotide sequences, and is substantially composed of or constitutes thereof: GGCTTTCCGTGCTCCCACGGAAAGCCCCT (SEQ ID NO: 203), GGCTTTCCGTGACTCCCACGGAAAGCCCCT (SEQ ID NO: 204) or GGCTTTCCGGCACTCCGCCGGAAAGCCCCT (SEQ ID NO: 205).

[0084] In some embodiments, the sheep eSL comprises the sequence shown in SEQ ID NO: 203. In some embodiments, the sheep eSL comprises the sequence shown in SEQ ID NO: 204. In some embodiments, the sheep eSL comprises the sequence shown in SEQ ID NO: 205.

[0085] In some embodiments, engineered stem-loops provide enhanced stability of the snRNA compared to snRNAs containing natural stem-loops. In some embodiments, the natural snRNA stem-loop comprises, or is substantially composed of, a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with one or more of the following nucleotide sequences: Ggttttctgacttcggtcggaaaacccct (SEQ ID NO: 145), ggttttctgacttcggtcggaaaacc (SEQ ID NO: 144), Ggctttctggctttttaccggaaagcc (SEQ ID NO: 235), ggctttctggctttttaccggaaagccCCT (SEQ ID NO: 236), GGCTTTCCGGCCTCCGCCGGAAAGCCCCT (SEQ ID NO: 142) or GGCTTTCCGGCCTCCGCCGGAAAGCC (SEQ ID NO: 143).

[0086] In some embodiments, the natural snRNA stem-loop comprises the sequence shown in SEQ ID NO: 145. In some embodiments, the natural snRNA stem-loop comprises the sequence shown in SEQ ID NO: 144. In some embodiments, the natural snRNA stem-loop comprises the sequence shown in SEQ ID NO: 235. In some embodiments, the natural snRNA stem-loop comprises the sequence shown in SEQ ID NO: 236. In some embodiments, the natural snRNA stem-loop comprises the sequence shown in SEQ ID NO: 142. In some embodiments, the natural snRNA stem-loop comprises the sequence shown in SEQ ID NO: 143.

[0087] 5' Interaction Stable Domain The eSL disclosed herein exhibits more efficient folding and annealing properties in the presence of a 5' interacting stable domain (5'ISD), which in turn leads to improved stability of the esnRNA compared to unengineered snRNA. The 5'ISD contains nucleotides complementary to those within the engineered SL, and it is not desired to be bound by theory that the interaction between the 5'ISD and the eSL will form a secondary structure protecting the 5' end of the snRNA. In some aspects, the 5'ISD anneals and / or hybridizes with the eSL disclosed herein. In some aspects, the 5'ISD is a sequence that is complementary and / or anticomplementary to a sequence present in the eSL disclosed herein. In some aspects, the 5'ISD disclosed herein may be a 5'ISD selected from the following nucleotide sequences: ggagt (SEQ ID NO: 12), cctct (SEQ ID NO: 13), ggaggt (SEQ ID NO: 14), cctcct (SEQ ID NO: 15), agccag (SEQ ID NO: 16), ggaag (SEQ ID NO: 17), gaagaag (SEQ ID NO: 18), gttg (SEQ ID NO: 19), ccgaa (SEQ ID NO: 20), taaggag (SEQ ID NO: 21), gaag (SEQ ID NO: 22) or ggctt (SEQ ID NO: 23).

[0088] Sm binding domain The snRNA system disclosed herein utilizes a Sm-binding domain (SmBD). The Sm protein loops assembled around the Sm-binding domain (SmBD) to form snRNPs include SmB / B', SmD1, SmD2, SmD3, SmE, SmF, and SmG. The U7 Sm binding site recruits endogenous RNA-binding factors and can be replaced with non-U7 snRNAs to make the snRNA more stable. In one embodiment, the SmBD is selected from U1, U2, U4, and U5 snRNAs. In another embodiment, the SmBD is derived from pseudosnRNA. In yet another embodiment, the SmBD is a nucleotide sequence containing SEQ ID NO: 31 (ATTTTT). In another embodiment, SmBD comprises nucleotide sequences selected from SEQ ID NO: 32 (AATTTTTGG), SEQ ID NO: 33 (AATTTGTGG), SEQ ID NO: 34 (AATTTGTGG), SEQ ID NO: 35 (AATTTCTGG), SEQ ID NO: 36 (GATTTTTGG), SEQ ID NO: 37 (AATTTTTGA), SEQ ID NO: 38 (AATTTTTTG), SEQ ID NO: 161 (AATTTTTGGAGCA), and SEQ ID NO: 163 (AATTTTTGGAGTA).

[0089] promoter sequence The snRNA system disclosed herein comprises a snRNA promoter from any one of U1-U12. In one embodiment, the snRNA promoter is the U7 promoter. In another embodiment, the U7 promoter is the human U7 promoter (hU7) or the mouse U7 promoter (mU7). In another embodiment, the U7 promoter is an endogenous human U7 promoter having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with the following SEQ ID NO: 39: TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCTGTGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCCTTAGAATATTATTTTTCCTACTGAAAGTTACCACATGCGTCGTTGTTTATACAGTAATAGGAACAAGAAAAAAGTCACCTAAGCTCACCCTCATCAATTGTGGAGTTCCTTTATATCCCATCTTCTCTCCAAACACATACGCA.

[0090] In one implementation, the snRNA promoter is the U1 promoter. In another implementation, the U1 promoter is the human U1 promoter or the mouse U1 promoter.

[0091] In another embodiment, the same snRNA promoter drives the expression of each copy of the snRNA insert. In another embodiment, each copy of the snRNA insert is identical. In another embodiment, different snRNA promoters drive each copy of the snRNA insert. In one embodiment, the 2×snRNA comprises a mouse U7 promoter driving one copy of the snRNA insert and a mouse U1 promoter driving another copy of the snRNA insert.

[0092] In other respects, the snRNA promoter is a Pol II promoter or a Pol III promoter. In still other respects, the snRNA promoter comprises, or is substantially composed of, a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with the promoters and / or promoter sequences listed in Table 6 below. Table 6: Exemplary Startup Subtable In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 40. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 41. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 42. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 43. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 44. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 45. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 46. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 47. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 48. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 151. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 39. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 152. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 153. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 154. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 155. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 165. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 166. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 167. In some embodiments, the snRNA promoter comprises the sequence shown in SEQ ID NO: 168.

[0093] Termination subsequence The snRNA system disclosed herein includes a snRNA downstream terminator (DT). The downstream terminator defines the end of a transcription unit (e.g., esnRNA or snRNA). In another embodiment, the snRNA DT is a U7 DT, which comprises: CCTCTTATGATGTTTGTTGCCAATGATAGATTGTTTTCACTGTGCAAAAATTATGGGTAGTTTTGGTGGTCTTGATGCAGTTGTAAGCTTGGAG (SEQ ID NO: 49).

[0094] In one embodiment, the esnRNA comprises eSL, one or more promoters, and DMD-targeting TS, SmBD, 5'ISD, and DT. In one aspect, the promoters and DT are combined, mixed, and matched. In another embodiment, the snRNA comprises a natural stem-loop, one or more promoters, and DMD-targeting TS, SmBD, and DT.

[0095] In some implementations, DT comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with the DT sequences listed in Table 7 below, and is substantially composed of or constitutes thereof: Table 7: Example DT Table In some embodiments, DT comprises the sequence shown in SEQ ID NO: 50. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 51. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 52. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 53. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 54. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 55. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 56. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 57. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 58. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 156. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 49. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 234. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 157. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 158. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 169. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 170. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 171. In some embodiments, DT comprises the sequence shown in SEQ ID NO: 172. In some embodiments, DT comprises the sequence shown in SEQ ID NO: TTTTTT.

[0096] In one implementation, the snRNA is delivered in a vector.

[0097] In one implementation, the snRNA is delivered in an AAV vector.

[0098] In some embodiments, the AAV vector contains multiple copies of snRNA. In some embodiments, the multiple copies of snRNA are 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies (2×, 3×, 4×, 5×, 6×, 7×, 8×, 9×, or 10×). In some embodiments, the multiple copies of snRNA are 4 or more copies.

[0099] In some implementations, each of the multiple copies of the snRNA is separated by a nucleic acid buffer sequence derived from a human non-coding genome sequence downstream of the snRNA. In one implementation, the buffer sequence is derived from a human genome sequence downstream of U7.

[0100] In one implementation, the buffer sequence is selected from the following nucleic acid sequences: Buffer 1 (30bp) CAAACTACAGAGCCAAGTGCTATCCAGA (SEQ ID NO: 24), Buffer 2 (30bp) GAGCTTTCTGGGTTGCCATCTCAAGCAGAC (SEQ ID NO: 25), Buffer 3 (30bp) TACAAGGCCATCAGCTCATACTCACAATTG (SEQ ID NO: 26), and combinations thereof.

[0101] In another embodiment, the buffer sequence is selected from the following nucleic acid sequences: Buffer 1 (100bp) CAAACTACAGAGCCAAGTGCTATCCAGAGAGCTTTCTGGGTTGCCATCTCAAGCAGACTACAAGGCCATCAGCTCATACTCACAATTGACTTTGAGAG (SEQ ID NO: 27), Buffer 2 (100bp) TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTATGTTAGTAACAACTGATGCCCATCCTGCAATGACAAATCCAATTCTCAGTGCAGCTC (SEQ ID NO: 28), and combinations thereof.

[0102] In another embodiment, the buffer sequence is selected from the following nucleic acid sequences: Buffer 1 (500bp) CAAACTACAGAGCCAAGTGCTATCCACAGAGAGCTTTCTGGGTTGCCATCTCAAGCAGACTACAAGGCCATCAGCTCATACTCACAATTGACTTTGAGAGTCATTTTCCAATGCTCCTACACACCCCTTCTTCACAATCCCCAACAAATCTGAGGCTGGAACTTGGTACCATAACAATCATTACATTATTTCACCAGAAGTACACCTTGCCTGGAAGATTGGCATTATAGCATCTTCTAACATTGTGAAAGTTAGTGACCAATGAGGAGATCCAAGTCAGTTCCAGTTGGATTTCTCTATACTCTATAATAAATATATATGGTGTCTTCAACAATAGGACTTTGCCATCCAGTGATGCTAAAAATCAATAACAATGGCAATAACCTGCCCTGTTTGGAAAGCCTCTGGCTTCCATGACTAACAATTCAAGGCAGGTCTCCTATACCTAGTACTGAGATTTTTATTTGATAAACTATATCTTCTGGGAGGAGAAGCATTGT(SEQ ID NO: 29), Buffer 2 (500bp) TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTAGTTAGTAACAACTGATGCCCATCCTGCAATGACAAATCCAATTCTCAGTGCAGCTCTCTGAAATAGTTTGCTTTCTCTCTAGGTCTGTTCTATACTCCTAACTCTCCAGGAGTTTACAAGGAATAAAATCTCTTCCAAATGCTTTCTGTTGCAACAACTGGACCATACTGAAAGCTGAGGCCCACAATTGCAATCTAGGTTAGCA GGTAATCATTGTTGGTGAGGTCCTCCCTTTCCCCAGGCTCGTGTTTGTATTGGGGAGCAGGAAATTTTTGCTAGAGCAGCACTGCCATCTCTCTACACTCCACCTGATTGGTGGGATGGACCAGAGAAATGGACATTCCACACAGTCCCTCCTTTCACATCTGCTCACCTGCCCACAGGATACTTTCCACCATGCATACTGGGCTCTGCACCAACCATTCAGCAGTGATGAAGAGGAAACTTGAAC(SEQ ID NO: 30), and / or combinations thereof.

[0103] Buffer 1 (100bp and 500bp) originates from a 100bp sequence downstream of the mouse U7 pseudogene 8 (located on chromosome 14: 4,409,359-4,409,421, reverse strand. GRCm39:CM001007.3). Buffer 2 (100bp and 500bp) originates from a 130bp sequence downstream of the human U7 pseudogene 5 (chromosome X: 140,451,148-140,451,208, forward strand. GRCh38:CM000685.2). Both 100bp buffers are the first 100bp of their respective 500bp buffers. Buffers 1, 2, and 3 (30bp) are consecutive 30bp sequences within "100bp buffer 1" downstream of the mouse U7 pseudogene 8. These downstream sequences were chosen because, in addition to the lack of repetitive sequences, they lack any known regulatory sites or genes in or near the sequence (using Gencode / Ensembl), have a total GC content of 40-60% in the buffer, have a GC content of 40-60% in the 20bp regions at both ends of the buffer, and have minimal sequence complexity.

[0104] snRNA sequence The exemplary snRNA sequences disclosed herein may contain any combination of esnRNA or snRNA features described herein.

[0105] carrier This article also provides vectors (e.g., recombinant expression vectors) containing snRNAs targeting DMD. In some embodiments of the compositions and methods disclosed herein, the vector comprises the snRNA system for targeting DMD provided herein. In some embodiments, the vector is a single or unitary vector.

[0106] In some implementations, the snRNA system is capable of targeting one or more DMD RNA sequences. In some aspects, the DMD RNA sequence is a DMD precursor mRNA sequence. In some aspects, the snRNA system is capable of targeting multiple (i.e., two or more) target RNAs. In some implementations, the two or more target RNAs may be the same precursor mRNA molecule, but different sequences within the precursor mRNA molecule.

[0107] In the context of recombinant expression vectors, the term "operably ligated" means that when the vector is introduced into (or brought into contact with) a host cell, the heterozygous promoter is ligated to the target nucleotide sequence (NOI) in a manner that allows the nucleotide sequence to be expressed, for example, in the host cell.

[0108] In some embodiments of the compositions and methods disclosed herein, the vector comprises a snRNA targeting DMD. In some embodiments, the therapeutic snRNA is in a single or modular vector.

[0109] In some embodiments of the compositions and methods disclosed herein, the RNA-binding snRNA system is capable of targeting DMD RNA sequences. In some embodiments of the compositions and methods disclosed herein, the RNA-targeting system is capable of targeting one or more DMD RNA sequences. In some aspects, the DMD RNA sequence is a DMD precursor mRNA sequence. In some aspects, the snRNA system is capable of targeting multiple (i.e., two or more) target RNAs. In some embodiments, the two or more target RNAs may be the same precursor mRNA molecule, but different sequences within the precursor mRNA molecule.

[0110] One type of vector is a "plasmid," which is a circular double-stranded DNA loop into which additional DNA segments can be inserted (e.g., via standard molecular cloning techniques). Another type of vector is a viral vector, in which a virally derived DNA or RNA sequence is present for packaging into a virus (e.g., retrovirus, replication-defective retrovirus, adenovirus, replication-defective adenovirus, and adeno-associated virus). Viral vectors also include viral polynucleotides for transfection into host cells. In some embodiments, the vector is a lentivirus (e.g., an integration-defective lentiviral vector) or an adeno-associated virus (AAV) vector. Vectors are capable of autonomous replication in the host cell to which they are introduced; for example, bacterial vectors with bacterial origins of replication and free-living mammalian vectors, as well as other vectors (e.g., non-free-living mammalian vectors), integrate into the host cell's genome upon introduction and thereby replicate along with the host genome.

[0111] In some embodiments, vectors (e.g., expression vectors) are capable of directing the expression of genes operatively linked to them. Common expression vectors are typically in the form of plasmids. In some embodiments, recombinant expression vectors contain nucleic acids provided herein, such as esnRNA in a form suitable for expressing RNA molecules in host cells. Recombinant expression vectors include one or more regulatory elements, which can be selected based on the host cell to be used for expression, and are operatively linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operatively linked" is intended to mean that the target nucleotide sequence is linked to the regulatory element in a manner that allows the expression of that nucleotide sequence (e.g., in an in vitro transcription / translation system or in the host cell when the vector is introduced into the host cell). Certain embodiments of the vector depend on factors such as, for example, the selection of the host cell to be transformed and the desired expression level. Vectors can be introduced into host cells to thereby produce transcripts, proteins, or peptides encoded by the nucleic acids described herein, including fusion proteins or peptides, such as snRNA, CRISPR transcripts, proteins, enzymes, their mutant forms, their fusion proteins, etc.

[0112] In some embodiments of the compositions and methods disclosed herein, the expression vectors, viral vectors, or non-viral vectors provided herein include, but are not limited to, expression control elements. As used herein, “expression control element” refers to any sequence that regulates the expression of a coding sequence (e.g., a gene). Exemplary expression control elements include, but are not limited to, promoters, enhancers, microRNAs, posttranscriptional regulatory elements, polyadenylation signal sequences, and introns. For example, expression control elements can be constitutive, inducible, repressive, or tissue-specific. A “promoter” is a control sequence, which is a region in a polynucleotide sequence that controls the initiation and rate of transcription. It may contain genetic elements that regulate the binding of proteins and molecules (e.g., RNA polymerases and other transcription factors). An “enhancer” is a region of DNA that can be activated by proteins to increase the likelihood or frequency of transcription.

[0113] In some embodiments of the compositions and methods disclosed herein, the expression vectors, viral vectors or non-viral vectors provided herein include, but are not limited to, vector elements, such as buffer sequences derived from human genome sequences downstream of snRNAs, and will therefore have the ability to encode multiple snRNAs from a single construct.

[0114] In some implementations, the snRNA constructs disclosed herein include bidirectional snRNA promoters for snRNA expression.

[0115] In another embodiment, the carrier configuration may include a connector, a signal sequence, and / or a tag.

[0116] Viral vector In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adenovirus vector, an adeno-associated virus (AAV) vector, or a lentiviral vector. In some embodiments, the vector is a retroviral vector, an adenovirus / retrovirus chimeric vector, a herpes simplex virus I or II vector, a parvovirus vector, a reticuloendotheliosis virus vector, a poliovirus vector, a papillomavirus vector, a vaccinia virus vector, or any hybrid or chimeric vector incorporating advantageous aspects of two or more viral vectors.

[0117] In some embodiments of the compositions and methods disclosed herein, the vector is a viral vector. In some embodiments, the viral vector comprises a sequence isolated from or derived from a retrovirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from a lentivirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from an adenovirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from adeno-associated virus (AAV). In some embodiments, the viral vector is non-replicating. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary.

[0118] In some embodiments, the vector further comprises one or more expression control elements operatively linked to a polynucleotide. In some embodiments, the vector further comprises one or more selectivity markers. In some embodiments, the vector exhibits low toxicity. In some embodiments, the vector does not integrate into the host genome, thereby having a low probability of inducing insertional mutagenesis.

[0119] Adeno-associated virus vector As used herein, "AAV vector" refers to a vector that contains one or more nucleic acid molecules and one or more AAV inverted terminal repeat (ITR) sequences, substantially composed of or composed of them. In some aspects, the nucleic acid molecules encode the esnRNA disclosed herein. When present in a host cell that provides the product of the rep and cap genes (e.g., through transfection of host cells), such an AAV vector can replicate and be packaged into an infectious viral particle. In some aspects, the AAV vector contains a promoter, at least one nucleic acid encoding at least one protein or RNA, and / or an enhancer and / or a terminator within its flanking ITR, which is then packaged into an infectious AAV particle. The capsidated nucleic acid portion may be referred to as the AAV vector genome. Plasmids containing AAV vectors may also contain elements for manufacturing purposes, such as antibiotic resistance genes, origin of replication sequences, etc., but these are not capsidated and therefore do not constitute part of the AAV particle.

[0120] In some aspects, the AAV vector may contain at least one nucleic acid encoding the snRNA or esnRNA composition of this disclosure. In some aspects, the AAV vector may contain at least one regulatory sequence. In some aspects, the AAV vector may contain at least one AAV inverted terminal (ITR) sequence. In some aspects, the AAV vector may contain a first ITR sequence and a second ITR sequence. In some aspects, the AAV vector may contain at least one promoter sequence. In some aspects, the AAV vector may contain at least one enhancer sequence. In some aspects, the AAV vector may contain at least one terminator sequence. In some aspects, the AAV vector may contain at least one polyA sequence. In some aspects, the AAV vector may contain at least one adapter sequence. In some aspects, the AAV vector of this disclosure may contain at least one nuclear localization signal or nuclear output signal and / or both.

[0121] In some aspects, the AAV vector may contain a first AAV ITR sequence, a promoter sequence, a snRNA sequence and / or an esnRNA sequence, a terminator sequence, and a second AAV ITR sequence. In some aspects, the AAV vector may contain a first AAV ITR sequence, a promoter sequence, an esnRNA sequence, a terminator sequence, and a second AAV ITR sequence in the 5' to 3' orientation. In some aspects, the AAV vector may contain a first AAV ITR sequence, a promoter sequence, a snRNA sequence, a terminator sequence, and a second AAV ITR sequence in the 5' to 3' orientation.

[0122] In some aspects, an AAV vector may contain a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, and a second AAV ITR sequence. In some aspects, an AAV vector may contain a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA sequence, a third termination sequence, and a second AAV ITR sequence. In some aspects, an AAV vector may contain a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, and a second AAV ITR sequence. In some respects, an AAV vector may contain a first AAVITR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA sequence, a third termination sequence, a fourth promoter sequence, a fourth snRNA sequence, a fourth termination sequence, and a second AAV ITR sequence.

[0123] As used in this article, the term "adeno-associated virus" or "AAV" refers to a member of the genus *Dependoparvovirus* within the family Parvoviridae. AAVs are single-stranded DNA viruses that grow in cells where some functions are provided by co-infected helper viruses. General information and reviews of AAVs can be found, for example, Carter, 1989, *Handbook of Parvoviruses*, Vol. 1, pp. 169–228, and Berns, 1990, *Virusology*, pp. 1743–1764, Raven Press (New York). It is entirely expected that the same principles described in these reviews will apply to other AAV serotypes characterized after the publication date of these reviews, as it is well known that the various serotypes are very closely related structurally and functionally, and even at the genetic level (see, for example, Blacklowe, 1988, Parvoviruses and Human Disease, pp. 165–174, edited by JR Pattison; and Rose, Comprehensive Virology 3: 1–61 (1974)). For example, all AAV serotypes exhibit remarkably similar replication characteristics mediated by homologous rep genes; and all carry three associated capsid proteins, such as those expressed in AAV2. Heteroduplex analysis further demonstrates the degree of correlation, revealing extensive cross-hybridization along the genome length between serotypes; and similar self-annealing segments at the ends corresponding to “inverted terminal repeats” (ITRs). Similar patterns of infectivity also suggest that replication function in each serotype is under similar regulatory control. Multiple serotypes of this virus are known to be adapted for gene delivery; all known serotypes can infect cells from a wide variety of tissue types.

[0124] AAV possesses unique characteristics that make it attractive, for example, as a vector for delivering exogenous DNA into cells in gene therapy. AAV infection of cultured cells is non-cytopathic, and natural infection in humans and other animals is silent and asymptomatic. Furthermore, AAV infects many mammalian cells, enabling targeting of many different tissues in vivo. Additionally, AAV transduces slow-dividing and non-dividing cells and can persist essentially throughout the lifetime of these cells as a transcriptionally active nuclear appendage (extrachromosomal element). Inserting the AAV proviral genome as cloned DNA into plasmids allows for the construction of recombinant genomes. Moreover, because the signals guiding AAV replication and genome capsidation are contained within the ITR of the AAV genome, approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) can be replaced with exogenous DNA to generate AAV vectors. The rep and cap proteins can be provided in trans form. Another important characteristic of AAV is its extreme stability and resilience. It readily withstands conditions used for inactivating adenoviruses (56°C to 65°C for several hours), making cryopreservation of AAV less critical. AAV can even be freeze-dried. Finally, AAV-infected cells are not resistant to repeated infection.

[0125] The recombinant AAV (rAAV) genome of the present invention comprises a nucleic acid molecule encoding at least one esnRNA and one or more AAV ITRs located flanking the nucleic acid molecule, substantially consisting of or consisting of therein. For example, the generation of pseudotyped rAAV is disclosed in WO2001083692. Other types of rAAV variants are also envisioned, such as rAAV with capsid mutations. See, for example, Marsic et al., Molecular Therapy, 22 (11): 1900-1909 (2014). The nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0126] In some embodiments of the compositions and methods disclosed herein, the viral vector comprises a sequence isolated from or derived from adeno-associated virus (AAV). In some embodiments, the viral vector comprises an inverted terminal repeat sequence or capsid sequence of an AAV serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh10, AAV11, or AAV12. In some embodiments, the AAV serotype is AAVrh.74. In one embodiment, the AAV vector comprises a modified capsid. In one embodiment, the AAV vector is an AAV2-Tyr mutant vector. In one embodiment, the AAV vector comprises a capsid containing non-tyrosine amino acids at the positions of surface-exposed tyrosine residues corresponding to wild-type AAV2 positions Tyr252, Tyr272, Tyr275, Tyr281, Tyr508, Tyr612, Tyr704, Tyr720, Tyr730, or Tyr673. See also WO 2008 / 124724, which is incorporated herein by reference in its entirety. In some embodiments, the AAV vector comprises an engineered capsid. AAV vectors comprising engineered capsids include, but are not limited to, AAV2.7m8, AAV9.7m8, AAV2 2tYF, and AAV8 Y733F. In some embodiments, the capsid is an anti-ubiquitination capsid. In another embodiment, the ubiquitination capsid is an AAV2 capsid containing mutations in both tyrosine (Y) and serine (S). In another embodiment, the AAV2 capsid contains mutations in the Y, S, and threonine (T) residues. In yet another embodiment, the AAV2 capsid includes, but is not limited to, AAV2 capsid mutants such as T455V, T491V, T550V, T659V, Y444+500+730F, and Y444+500+730F+T491V. In some embodiments, the viral vector is replication-defective. In some embodiments, the viral vector is isolated or recombinant (rAAV). In some embodiments, the viral vector is self-complementary (scAAV). In some embodiments, the viral vector is single-stranded (ssAAV).

[0127] In some embodiments, the snRNA provided herein is contained within a single-stranded AAV (ssAAV). In some embodiments, the snRNA provided herein is contained within a self-complementary AAV (scAAV). The single-stranded nature of the parvovirus genome necessitates the use of cellular mechanisms to provide a complementary strand for gene expression. This cellular recruitment activity is considered a rate-limiting factor for transduction and gene expression efficiency in parvoviruses and parvovirus particles. The use of scAAV relative to ssAAV remedies this known problem by packaging the two strands into a single duplex DNA molecule (or inverted repeat genome) that is capable of folding into dsDNA due to its self-complementary viral genome sequence. In this respect, the requirement for DNA synthesis or base pairing between multiple viral genomes is eliminated.

[0128] AAV ITR sequence In some embodiments of the compositions and methods disclosed herein, the AAV inverted terminal repeat sequence may comprise any AAV ITR sequence known in the art. In some aspects, the AAV ITR sequence may comprise or consist of the AAV1 ITR sequence, AAV2 ITR sequence, AAV3 ITR sequence, AAV4 ITR sequence, AAV5 ITR sequence, AAV6 ITR sequence, AAV7 ITR sequence, AAV8 ITR sequence, AAV9 ITR sequence, AAV10 ITR sequence, AAVrh10 ITR sequence, AAV11 ITR sequence, AAV12 ITR sequence, AAV13 ITR sequence, or AAVrh74 ITR sequence.

[0129] In some respects, ITR sequences can contain modified AAV ITR sequences.

[0130] In some respects, the AAV ITR sequence may contain a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therein) identity with SEQ ID NO: 119 or SEQ ID NO: 166, and substantially consist of or be composed of.

[0131] In some aspects, the first AAV ITR sequence may comprise, substantially constitute, or consist of a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage between thereof) identity with SEQ ID NO: 119 or SEQ ID NO: 166, and the second AAV ITR sequence may comprise, substantially constitute, or consist of, a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage between thereof) identity with SEQ ID NO: 119 or SEQ ID NO: 166. In some aspects, the first AAV ITR sequence is located at the 5' position of the AAV vector. In some aspects, the second AAV ITR sequence is located at the 3' position of the AAV vector.

[0132] In some embodiments of the compositions and methods disclosed herein, the viral vector comprises a sequence isolated from or derived from adeno-associated virus (AAV).

[0133] In some embodiments of the compositions and methods disclosed herein, the vectors are non-viral vectors. In some embodiments, the vector comprises, or is composed of, nanoparticles, micelles, liposomes or lipoplexes, polymer vesicles, polymer complexes, or dendritic polymers. In some embodiments, the vector is an expression vector or a recombinant expression system. As used herein, the term "recombinant expression system" refers to a genetic construct formed through recombination for expressing certain genetic material.

[0134] Lentiviral vector In some embodiments, the vector is a lentiviral vector. In some embodiments, the lentiviral vector may encode a total polynucleotide range of 8kb to 10kb. In some embodiments, exemplary lentiviral vectors that can be used in any of the compositions, systems, methods, and kits described herein may include human immunodeficiency virus (HIV) 1 vectors, modified human immunodeficiency virus (HIV) 1 vectors, human immunodeficiency virus (HIV) 2 vectors, modified human immunodeficiency virus (HIV) 2 vectors, and simian immunodeficiency virus (SIV). SM Vector, modified white-necked white-browed monkey simian immunodeficiency virus (SIV) SM ) vector, African green monkey simian immunodeficiency virus (SIV) AGM ) vector, modified African green monkey simian immunodeficiency virus (SIV) AGMThe lentiviral vector may include vectors such as equine infectious anemia virus (EIAV) vectors, modified equine infectious anemia virus (EIAV) vectors, feline immunodeficiency virus (FIV) vectors, modified feline immunodeficiency virus (FIV) vectors, Vesner / Medy virus (VNV / VMV) vectors, modified Vesner / Medy virus (VNV / VMV) vectors, caprine arthritis-encephalitis virus (CAEV) vectors, modified caprine arthritis-encephalitis virus (CAEV) vectors, bovine immunodeficiency virus (BIV), or modified bovine immunodeficiency virus (BIV), and any combination or equivalent thereof. In some embodiments, the lentiviral vector is an integrase-containing lentiviral vector (ICLV). In some embodiments, the lentiviral vector may refer to a transgenic plasmid vector and a transgenic plasmid vector bound to an associated plasmid (e.g., a packaging plasmid, a rev expression plasmid, an envelope plasmid), as well as lentiviral-based particles capable of introducing exogenous nucleic acids into cells via a virus or virus-like entry mechanism. In some embodiments, the viral vector comprises a sequence isolated from or derived from a retrovirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from lentivirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from adenovirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from adeno-associated virus (AAV). In some embodiments, the viral vector is non-replicating. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary.

[0135] Lentiviral vectors are well known in the art (see, for example, Trono D. (2002) Lentiviral vectors, New York: Spring-Verlag Berlin; Heidelberg and Durand et al. (2011)). Viruses 3(2):132-159 doi: 10.3390 / v3020132).

[0136] The lentiviral vectors described herein may comprise, or consist of, one or more nucleic acid molecules and one or more lentiviral LTRs, substantially composed of or composed of them. In some aspects, the nucleic acid molecules encode the snRNA and / or esnRNA disclosed herein. When present in a host cell that provides the product of the rep and cap genes (e.g., by transfection of host cells), such lentiviral vectors may replicate and be packaged into infectious viral particles. In some aspects, the lentiviral vector contains within its flanking ITR a promoter, at least one nucleic acid encoding at least one protein or RNA, and / or an enhancer and / or a terminator, which are packaged into infectious AAV particles. The capsidated nucleic acid portion may be referred to as the lentiviral vector genome. Plasmids containing lentiviral vectors may also contain elements for manufacturing purposes, such as antibiotic resistance genes, origin of replication sequences, etc., but these are not capsidated and therefore do not constitute part of the lentiviral particle.

[0137] In some aspects, the lentiviral vector may contain at least one nucleic acid encoding the snRNA and / or esnRNA of this disclosure. In some aspects, the lentiviral vector may contain at least one regulatory sequence. In some aspects, the lentiviral vector may contain at least one lentiviral long terminal repeat (LTR) sequence. In some aspects, the lentiviral vector may contain a first LTR sequence and a second LTR sequence. In some aspects, the lentiviral vector may contain at least one promoter sequence. In some aspects, the lentiviral vector may contain at least one enhancer sequence. In some aspects, the lentiviral vector may contain at least one terminator sequence. In some aspects, the lentiviral vector may contain at least one polyA sequence. In some aspects, the lentiviral vector may contain at least one adapter sequence. In some aspects, the lentiviral vector of this disclosure may contain at least one nuclear localization signal or nuclear output signal and / or both.

[0138] In some aspects, the lentiviral vector may contain a first lentiviral LTR sequence, a promoter sequence, a snRNA and / or esnRNA sequence, a terminator sequence, and a second lentiviral LTR sequence. In some aspects, the lentiviral vector may contain the first lentiviral LTR sequence, a promoter sequence, a snRNA sequence, a terminator sequence, and a second lentiviral LTR sequence in the 5' to 3' direction. In some aspects, the lentiviral vector may contain the first lentiviral LTR sequence, a promoter sequence, an esnRNA sequence, a terminator sequence, and a second lentiviral LTR sequence in the 5' to 3' direction.

[0139] In some aspects, a lentiviral vector may contain a first lentiviral LTR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, and a second lentiviral LTR sequence. In some aspects, a lentiviral vector may contain a first lentiviral LTR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA sequence, a third termination sequence, and a second lentiviral LTR sequence. In some aspects, a lentiviral vector may contain a first lentiviral LTR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA sequence, a third termination sequence, a fourth promoter sequence, a fourth snRNA sequence, a fourth termination sequence, and a second lentiviral LTR sequence.

[0140] Lentiviral LTR sequence In some embodiments of the compositions and methods disclosed herein, the lentiviral long terminal repeat sequence may comprise any lentiviral LTR sequence known in the art. In some aspects, the lentiviral LTR sequence may comprise a human immunodeficiency virus (HIV) 1 LTR sequence, a modified human immunodeficiency virus (HIV) 1 LTR sequence, a human immunodeficiency virus (HIV) 2 LTR sequence, a modified human immunodeficiency virus (HIV) 2 LTR sequence, or a simian immunodeficiency virus (SIV). SM LTR sequence, modified white-necked white-browed monkey simian immunodeficiency virus (SIV) SM LTR sequence, African green monkey simian immunodeficiency virus (SIV) AGM LTR sequence, modified African green monkey simian immunodeficiency virus (SIV) AGM LTR sequence, equine infectious anemia virus (EIAV) LTR sequence, modified equine infectious anemia virus (EIAV) LTR sequence, feline immunodeficiency virus (FIV) LTR sequence, modified feline immunodeficiency virus (FIV) LTR sequence, Vesner / Medy virus (VNV / VMV) LTR sequence, modified Vesner / Medy virus (VNV / VMV) LTR sequence, caprine arthritis-encephalitis virus (CAEV) LTR sequence, modified caprine arthritis-encephalitis virus (CAEV) LTR sequence, bovine immunodeficiency virus (BIV) LTR sequence, or modified bovine immunodeficiency virus (BIV) LTR sequence, or composed thereof.

[0141] In some respects, LTR sequences can contain modified lentiviral LTR sequences.

[0142] In some respects, the lentiviral LTR sequence may contain a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therein) identity with SEQ ID NO: 170 or SEQ ID NO: 171, and is substantially composed of or constitutes thereof.

[0143] In some embodiments, the lentiviral vector provided herein comprises first and second lentiviral LTR sequences. In some aspects, the first lentiviral LTR sequence may comprise, substantially constitute, or consist of a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with SEQ ID NO: 170 or SEQ ID NO: 171, and the second lentiviral LTR sequence may comprise, substantially constitute, or consist of a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with SEQ ID NO: 170 or SEQ ID NO: 171. In some aspects, the first lentiviral LTR sequence is located at the 5' position of the lentiviral vector. In some aspects, the second lentiviral LTR sequence is located at the 3' position of the lentiviral vector.

[0144] In some aspects, the first lentiviral LTR sequence comprises the sequence shown in SEQ ID NO: 173 or SEQ ID NO: 174. In some aspects, the second lentiviral LTR sequence comprises the sequence shown in SEQ ID NO: 173 or SEQ ID NO: 174. In some embodiments, the lentiviral vector provided herein comprises a first lentiviral LTR sequence comprising the sequence shown in SEQ ID NO: 173 and a second lentiviral LTR sequence comprising the sequence shown in SEQ ID NO: 174. In some aspects, the first lentiviral LTR sequence is located at the 5' position of the lentiviral vector. In some aspects, the second lentiviral LTR sequence is located at the 3' position of the lentiviral vector.

[0145] In some embodiments of the compositions and methods disclosed herein, the viral vector comprises a sequence isolated from or derived from a lentivirus.

[0146] In some embodiments of the compositions and methods disclosed herein, the vectors are non-viral vectors. In some embodiments, the vector comprises, or is composed of, nanoparticles, micelles, liposomes or liposome complexes, polymer vesicles, polymer complexes or dendritic polymers. In some embodiments, the vector is an expression vector or a recombinant expression system. As used herein, the term "recombinant expression system" refers to a genetic construct formed through recombination for expressing certain genetic material.

[0147] snRNA vector construct This article also provides vector constructs for targeting DMD, which contain the snRNA constructs described herein.

[0148] An exemplary AAV vector of this disclosure is A05014 targeting DMD exon 53. The elements of A05014 are shown in Table 8. In some aspects, the nucleic acid sequence encoding the AAV vector A05014 (which encodes the snRNA sequence of DMD exon 53) comprises, is substantially composed of, or is composed of, a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with SEQ ID NO: 133.

[0149] Table 8: A05014 nucleotide sequence of plasmid elements in sequence 5' to 3' A05014 nucleotide sequence (the entire transgene from ITR to ITR):

[0150] Table 9: A05211: Nucleotide sequences of plasmid elements in the 5' to 3' sequence A05211 nucleotide sequence (the entire transgene from ITR to ITR): An exemplary AAV vector of this disclosure is A05374 targeting DMD exon 44. The elements of A05374 are shown in Table 10. In some aspects, the nucleic acid sequence encoding the AAV vector A05374 (which encodes an snRNA sequence targeting DMD exon 44) comprises, substantially constitutes, or is composed of, a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with SEQ ID NO: 135.

[0151] Table 10: A05374: Nucleotide sequences of plasmid elements in the 5' to 3' order. A05374 ITR to ITR sequence

[0152] An exemplary AAV vector of this disclosure is A05375 targeting DMD exon 44. The elements of A05375 are shown in Table 11. In some aspects, the nucleic acid sequence encoding the AAV vector A05375 (which encodes an snRNA sequence targeting DMD exon 44) comprises, substantially constitutes, or is composed of, a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with SEQ ID NO: 136.

[0153] Table 11: A05375: Nucleotide sequences of plasmid elements in the 5' to 3' sequence A05375 ITR to ITR sequence An exemplary AAV vector of this disclosure is A05190 targeting DMD exon 45. The elements of A05190 are shown in Table 12. In some aspects, the nucleic acid sequence encoding the AAV vector A05190 (which encodes an snRNA sequence targeting DMD exon 45) comprises, substantially constitutes, or is composed of, a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with SEQ ID NO: 137.

[0154] Table 12: A05190: Stuffer-scAAV-2x_mU7prom-Z45-8 / 10-mU7term_mU1prom-Z45-8 / 10-mU1term; mouseloop with 5' ISD and eSL; derivative of A04376 A05190 nucleotide sequence (the entire transgene from ITR to ITR): An exemplary AAV vector of this disclosure is A05189 targeting DMD exon 45. The elements of A05189 are shown in Table 13. In some aspects, the nucleic acid sequence encoding the AAV vector A05189 (which encodes an snRNA sequence targeting DMD exon 45) comprises, substantially constitutes, or is composed of, a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with SEQ ID NO: 138.

[0155] Table 13: A05189: Stuffer-scAAV-2x_mU7prom-Z45-8 / 9-mU7term_mU1prom-Z45-8 / 9-mU1term; mouseloop with 5' ISD and eSL; derivative of A04376 A05189 nucleotide sequence (the entire transgene from ITR to ITR):

[0156] The exemplary AAV vector of this disclosure is A05178, designed for multi-exon skipping of exons 50 to 53, comprising snRNA sequences targeting exons 50, 51, 52, and 53 of the DMD. The elements of A05178 are shown in Table 14. In some aspects, the nucleic acid sequence encoding the AAV vector A05178 comprises, substantially constitutes, or is composed of, a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with SEQ ID NO: 130.

[0157] Table 14: A05178: Multi-exon targeting vector containing snRNA sequences targeting exons 50, 51, 52, and 53 A05178 nucleotide sequence (the entire transgene from ITR to ITR):

[0158] The exemplary AAV vector of this disclosure is A06107, designed for multi-exon skipping of exons 44 and 45, which contains snRNA sequences targeting DMD exons 44 and 45. The elements of A06107 are shown in Table 15. In some aspects, the nucleic acid sequence encoding the AAV vector A06107 comprises, substantially constitutes, or is composed of, a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with SEQ ID NO: 131.

[0159] Table 15: A06107: Nucleotide sequences of plasmid elements in the 5' to 3' sequence A06107 nucleotide sequence (the entire transgene from ITR to ITR):

[0160] The exemplary AAV vector of this disclosure is A06108, designed for multi-exon skipping of exons 44 and 45, which contains snRNA sequences targeting DMD exons 44 and 45. The elements of A06108 are shown in Table 16. In some aspects, the nucleic acid sequence encoding the AAV vector A06108 comprises, substantially constitutes, or is composed of, a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with SEQ ID NO: 132.

[0161] Table 16: A06108: Nucleotide sequences of plasmid elements in the 5' to 3' sequence

[0162] promoter sequence The gene therapy and snRNA gene therapy composition disclosed herein contains a promoter sequence derived from snRNA.

[0163] A promoter is a regulatory sequence, a region in a polynucleotide sequence that controls the initiation and rate of transcription. It may contain genetic elements that regulate the binding of proteins and molecules, such as RNA polymerases and other transcription factors.

[0164] In some embodiments of the compositions and methods disclosed herein, the expression vectors, viral vectors, or non-viral vectors provided herein include, but are not limited to, expression control elements. As used herein, “expression control element” refers to any sequence that regulates the expression of a coding sequence (e.g., a gene). Exemplary expression control elements include, but are not limited to, promoters, enhancers, microRNAs, posttranscriptional regulatory elements, polyadenylation signal sequences, and introns. For example, expression control elements can be constitutive, inducible, repressive, or tissue-specific. A “promoter” is a control sequence, which is a region of a polynucleotide sequence that controls the initiation and rate of transcription. It may contain genetic elements that regulate the binding of proteins and molecules, such as RNA polymerases and other transcription factors. An “enhancer” is a region of DNA that can be activated by proteins to increase the likelihood or frequency of transcription.

[0165] In some embodiments of the compositions and methods disclosed herein, the expression vectors, viral vectors or non-viral vectors provided herein include, but are not limited to, vector elements, such as buffer sequences derived from human genome sequences downstream of snRNAs, and will therefore have the ability to encode multiple snRNAs from a single construct.

[0166] In some implementations, the snRNA constructs disclosed herein include bidirectional snRNA promoters for snRNA expression.

[0167] In another embodiment, the carrier configuration may include a connector, a signal sequence, and / or a tag.

[0168] In some implementations, the vector is a viral vector. In some implementations, the vector is an adenovirus vector, an adeno-associated virus (AAV) vector, or a lentiviral vector.

[0169] Nucleic acid NOI (target nucleotide sequence) includes, but is not limited to, any nucleotide sequence or transgene capable of being delivered via a vector. NOI can be synthetic, derived from naturally occurring DNA or RNA, codon-optimized, recombinant RNA / DNA, cDNA, partial genomic DNA, and / or combinations thereof. NOI can be a coding region or a partial coding region, but not necessarily a coding region. NOI can be sense or antisense oriented RNA / DNA. NOI can be snRNA. NOI is also referred to herein as a transgene, heterologous sequence, gene, therapeutic gene, but is not limited thereto. NOI can also encode RNA (ribonucleoprotein complex), POI (target protein), partial POI, mutant forms or variants of POI. POI can be similar to or correspond to a wild-type protein. POI can also be a fusion protein or ribonucleoprotein complex, such as snRNP. In some aspects, the RNA sequences disclosed herein can be represented as DNA sequences, and those skilled in the art can deduce the RNA sequence sequence from the DNA sequence. For example, the spacer region sequences disclosed herein can represent uracil bases as U or T. Those skilled in the art will readily understand that T or U can be used interchangeably to represent uracil in RNA sequences.

[0170] Codon optimization In some embodiments, the NOI or transgenic or GOI (e.g., the nucleic acid sequence disclosed herein) is a codon-optimized nucleic acid sequence. In some embodiments, the codon-optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% improvement in transcription or translation in human subjects compared to wild-type or non-codon-optimized nucleic acid sequences.

[0171] In some aspects, codon-optimized nucleic acid sequences exhibit enhanced stability. In some aspects, codon-optimized nucleic acid sequences exhibit enhanced stability through improved resistance to hydrolysis. In some embodiments, codon-optimized sequences exhibit at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% improved stability compared to wild-type or non-codon-optimized nucleic acid sequences. In some embodiments, codon-optimized sequences exhibit at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% improved resistance to hydrolysis in human subjects compared to wild-type or non-codon-optimized nucleic acid sequences.

[0172] In some respects, codon-optimized nucleic acid sequences may not contain donor splicing sites. In some respects, codon-optimized nucleic acid sequences may contain no more than about one, or about two, or about three, or about four, or about five, or about six, or about seven, or about eight, or about nine, or about ten donor splicing sites. In some respects, codon-optimized nucleic acid sequences contain at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten fewer donor splicing sites compared to non-codon-optimized nucleic acid sequences.

[0173] Without being bound by theory, removing donor splicing sites from codon-optimized nucleic acid sequences can unexpectedly and unpredictably increase the expression of target proteins in vivo because cryptic splicing is blocked. Furthermore, cryptic splicing can vary among different subjects, meaning that the expression levels of proteins containing donor splicing sites can unpredictably differ between subjects. Such unpredictability is unacceptable in the context of human therapy. Therefore, codon-optimized nucleic acid sequences lacking donor splicing sites unexpectedly and surprisingly enable increased protein expression in human subjects and modulated protein expression across different human subjects.

[0174] In some respects, codon-optimized nucleic acid sequences may have different GC contents than non-codon-optimized nucleic acid sequences. In other respects, the GC content of codon-optimized nucleic acid sequences is more uniformly distributed across the entire nucleic acid sequence compared to non-codon-optimized sequences.

[0175] Without being bound by theory, codon-optimized nucleic acid sequences exhibit a more uniform melting temperature (“Tm”) across the entire length of the transcript by distributing GC content more evenly throughout the nucleic acid sequence. This uniformity of melting temperature unexpectedly led to increased expression of the codon-optimized nucleic acid in human subjects, as transcription and / or translation of the nucleic acid sequence occurred with less stagnation of polymerases and / or ribosomes.

[0176] In some respects, codon-optimized nucleic acid sequences may have fewer repressive microRNA target binding sites compared to non-codon-optimized nucleic acid sequences. In other respects, codon-optimized nucleic acid sequences may have at least one, two, three, four, five, six, seven, eight, nine, ten, or more fewer repressive microRNA target binding sites compared to non-codon-optimized nucleic acid sequences.

[0177] Unwilling to be bound by theory, codon-optimized nucleic acid sequences with fewer repressive microRNA target binding sites unexpectedly showed increased expression in human subjects.

[0178] This document provides nucleic acid sequences encoding gene therapy compositions for use in the gene transfer and expression technologies described herein. It should be understood that, although not always explicitly stated, the sequences provided herein can be used to provide expression products as well as substantially the same sequences encoding RNA or expressed to produce proteins having the same biological properties. These “biologically equivalent” or “biologically active” or “equivalent” polypeptides are encoded by equivalent polynucleotides as described herein. When compared using sequence identity methods operated under default conditions, they may have a primary amino acid sequence with at least 60%, or alternatively at least 65%, or alternatively at least 70%, or alternatively at least 75%, or alternatively at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95%, or alternatively at least 98% identity to a reference polypeptide. Specific polypeptide sequences are provided as examples of specific embodiments. Modifications to the amino acid sequences using substituted amino acids with similar charges are also discussed. Furthermore, an equivalent polynucleotide is a polynucleotide that hybridizes with a reference polynucleotide or its complement under stringent conditions, or, in the case of a polypeptide, a polypeptide encoded by a polynucleotide that hybridizes with a reference coding polynucleotide or its complementary strand under stringent conditions. Alternatively, an equivalent polypeptide or protein is a polypeptide or protein expressed by an equivalent polynucleotide.

[0179] The NOI or nucleic acid sequences (e.g., polynucleotide sequences) disclosed herein can be codon-optimized, a technique well-known in the art. Codon optimization refers to the fact that different cells differ in their use of specific codons. This codon bias corresponds to a bias in the relative abundance of a particular tRNA in a cell type. Expression can be increased by changing codons in the sequence to match the relative abundance of the corresponding tRNA. Expression can also be reduced by intentionally selecting codons known to be rare in a particular cell type for the corresponding tRNA. Codon usage tables are known in the art for mammalian cells and various other organisms. Nucleic acid sequences can be generated based on the genetic code. In some embodiments, such sequences are optimized for expression in a host or target cell, such as a host cell for expressing snRNA or a cell in which the disclosed methods are implemented (e.g., in mammalian cells, such as human cells). Species-specific codon preferences and codon usage tables can be used to engineer isolated nucleic acid molecules that encode snRNAs utilizing the species-specific codon usage preferences. For example, the snRNAs disclosed herein can be engineered to have codons preferentially used by a specific target organism. In one example, a nucleic acid sequence is optimized for expression in human cells, for example, having at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity with its corresponding wild-type or starting nucleic acid sequence. In some embodiments, the isolated nucleic acid molecule (which may be part of a vector) includes at least one coding sequence codon-optimized for expression in eukaryotic cells, or at least one coding sequence codon-optimized for expression in human cells. In one embodiment, such a codon-optimized coding sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with its corresponding wild-type or starting sequence. In another embodiment, the eukaryotic cell codon-optimized nucleic acid sequence encodes snRNA having at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with its corresponding wild-type or starting sequence. In another implementation, multiple clones containing functionally equivalent nucleic acids can be routinely generated, for example, nucleic acids with different sequences but encoding the same sequence. Silent mutations in the coding sequence are due to the degeneracy (i.e., redundancy) of the genetic code, whereby more than one codon can encode the same amino acid residues.Thus, for example, leucine can be encoded by CTT, CTC, CTA, CTG, TTA, or TTG; serine by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine by AAT or AAC; aspartic acid by GAT or GAC; cysteine ​​by TGT or TGC; alanine by GCT, GCC, GCA, or GCG; glutamine by CAA or CAG; tyrosine by TAT or TAC; and isoleucine by ATT, ATC, or ATA. Tables showing the standard genetic code can be found in various sources (see, for example, Stryer, 1988, Biochemistry, 3rd edition, WH 5 Freeman and Co., NY).

[0180] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonds between the bases of the nucleotide residues. Hydrogen bonds can occur through Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific mechanism. The complex can comprise two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination thereof. Hybridization reactions can constitute steps in broader processes, such as the initiation of a PC reaction or the enzymatic cleavage of polynucleotides by ribozymes.

[0181] Examples of stringent hybridization conditions include: incubation temperatures of approximately 25°C to approximately 37°C; hybridization buffer concentrations of approximately 6×SSC to approximately 10×SSC; formamide concentrations of approximately 0% to approximately 25%; and wash solutions of approximately 4×SSC to approximately 8×SSC. Examples of moderate hybridization conditions include: incubation temperatures of approximately 40°C to approximately 50°C; buffer concentrations of approximately 9×SSC to approximately 2×SSC; formamide concentrations of approximately 30% to approximately 50%; and wash solutions of approximately 5×SSC to approximately 2×SSC. Examples of highly stringent conditions include: incubation temperatures of approximately 55°C to approximately 68°C; buffer concentrations of approximately 1×SSC to approximately 0.1×SSC; formamide concentrations of approximately 55% to approximately 75%; and wash solutions of approximately 1×SSC, 0.1×SSC, or deionized water. Typically, hybridization incubation times range from 5 minutes to 24 hours, with one, two, or more wash steps, and wash incubation times of approximately 1, 2, or 15 minutes. SSC is a 0.15 M NaCl and 15 mM citrate buffer. It should be understood that equivalents of SSC using other buffer systems can be used.

[0182] "Homology," "identity," or "similarity" refers to the sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing positions in each sequence that can be aligned for comparison purposes. Molecules are homologous at positions when the positions in the compared sequences are occupied by the same bases or amino acids. The degree of homology between sequences varies with the number of common matching or homologous positions. An "irrelevant" or "non-homologous" sequence has less than 40% identity with one of the sequences of this invention, or alternatively, less than 25% identity.

[0183] cell In some embodiments of the compositions and methods disclosed herein, the cells disclosed are prokaryotic cells.

[0184] In some embodiments of the compositions and methods disclosed herein, the cells are eukaryotic cells. In some embodiments, the cells are mammalian cells. In some embodiments, the cells are bovine, mouse, cat, horse, pig, dog, ape, or human cells. In some embodiments, the cells are non-human mammalian cells, such as non-human primate cells.

[0185] In some embodiments, the cells disclosed herein are somatic cells. In some embodiments, the cells disclosed herein are germ cells. In some embodiments, the germ cells disclosed herein are not human cells.

[0186] In some embodiments of the compositions and methods disclosed herein, the cells disclosed are stem cells. In some embodiments, the cells disclosed herein are embryonic stem cells. In some embodiments, the embryonic stem cells disclosed herein are not human cells. In some embodiments, the cells disclosed herein are pluripotent stem cells or multipotent stem cells. In some embodiments, the cells disclosed herein are adult stem cells. In some embodiments, the cells disclosed herein are induced pluripotent stem cells (iPSCs). In some embodiments, the cells disclosed herein are hematopoietic stem cells (HSCs).

[0187] In some embodiments of the compositions and methods disclosed herein, the somatic cells are muscle cells. In some embodiments, the muscle cells are myoblasts or myocytes. In some embodiments, the muscle cells are cardiomyocytes, skeletal muscle cells, or smooth muscle cells. In some embodiments, the muscle cells are striated cells. In one embodiment, one or more cells of a patient treated with the compositions disclosed herein include, but are not limited to, skeletal muscle (developing and maturing muscle fibers and satellite cells), neuromuscular junctions, cardiomyocytes, smooth muscle cells, peripheral nervous system (neurons), peripheral motor neurons, and / or sensory neurons.

[0188] In some embodiments of the compositions and methods disclosed herein, the somatic cells are neuronal cells. In one embodiment, one or more cells of a patient being treated with the compositions disclosed herein include, but are not limited to, central nervous system (neurons), peripheral nervous system (neurons), peripheral motor neurons, and / or sensory neurons. In one embodiment, the neuronal cells are glial cells.

[0189] In some embodiments of the compositions and methods disclosed herein, the somatic cells are fibroblasts or epithelial cells. In some embodiments, the epithelial cells of this disclosure form squamous cell epithelium, cuboidal cell epithelium, columnar cell epithelium, stratified cell epithelium, pseudostratified columnar cell epithelium, or transitional cell epithelium. In some embodiments, the epithelial cells of this disclosure form glands, including but not limited to the pineal gland, thymus, pituitary gland, thyroid gland, adrenal gland, apocrine gland, holocrine gland, regional gland, serous gland, mucous gland, and sebaceous gland. In some embodiments, the epithelial cells of this disclosure contact the outer surface of an organ, including but not limited to the lung, spleen, stomach, pancreas, bladder, intestine, kidney, gallbladder, liver, larynx, or pharynx. In some embodiments, the epithelial cells of this disclosure contact the outer surface of a blood vessel or vein.

[0190] In some embodiments of this disclosure, the somatic cells are ocular cells. Ocular cells include, but are not limited to, corneal epithelial cells, corneal stromal cells, retinal pigment epithelial (RPE) cells, lens epithelial cells, iris pigment epithelial cells, conjunctival fibroblasts, non-pigmented ciliary epithelial cells, trabecular meshwork cells, choroidal fibroblasts, and conjunctival epithelial cells. In some embodiments, the ocular cells are retinal cells or corneal cells. In one embodiment, the retinal cells are photoreceptor cells or retinal pigment epithelial cells. In another embodiment, the retinal cells are ganglion cells, amacrine cells, bipolar cells, horizontal cells, Miller glial cells, rod cells, or cone cells. In some embodiments of the compositions and methods of this disclosure, the somatic cells of this disclosure are primary cells.

[0191] In some embodiments of the compositions and methods disclosed herein, the somatic cells disclosed herein are cultured cells.

[0192] In some embodiments of the compositions and methods disclosed herein, the somatic cells disclosed herein are in vivo, in vitro, ex vivo, or in situ.

[0193] In some embodiments of the compositions and methods disclosed herein, the somatic cells disclosed herein are autologous or allogeneic.

[0194] How to use This disclosure provides methods for encoding RNA or expressing NOI in cells using the snRNA system disclosed herein. In one embodiment, this disclosure provides a method for modifying the activity of RNA or a protein encoded by an RNA molecule, said method comprising contacting the composition of this disclosure with the target RNA molecule under conditions suitable for binding to the target RNA molecule.

[0195] This disclosure provides a method for altering the expression level of the RNA molecule of this disclosure or the protein encoded by the RNA molecule, the method comprising contacting a composition of this disclosure with a cell containing the RNA molecule under conditions suitable for binding to the RNA molecule. In some embodiments, the cells are in vivo, in vitro, ex vivo, or in situ. In some embodiments, the composition of this disclosure comprises a vector containing a snRNA sequence. In some embodiments, the vector is an AAV.

[0196] This disclosure provides methods for altering the expression level of the RNA molecule of this disclosure or the protein encoded by the RNA molecule, said methods comprising contacting the composition of this disclosure with the RNA molecule under conditions suitable for knockdown, blocking, splicing, multiple targeting, cascade restoration, or editing of the target RNA. In some embodiments, the composition of this disclosure comprises a vector containing a snRNA sequence. In some embodiments, the vector is an AAV.

[0197] This disclosure provides methods for modifying the activity of target RNA or proteins encoded by target RNA molecules, said methods comprising contacting a composition with a cell containing an RNA molecule under conditions suitable for knockdown, blocking, splicing, multiple targeting, cascade restoration, or editing of the target RNA. In some embodiments, the cells are in vivo, in vitro, ex vivo, or in situ. In some embodiments, the composition comprises a vector containing the snRNA sequence disclosed herein. In some embodiments, the vector is an AAV.

[0198] This disclosure provides a method for treating a disease or disorder, the method comprising administering to a subject a therapeutically effective amount of the snRNA composition of this disclosure.

[0199] This disclosure provides a method of treating a disease in a patient requiring such treatment, the method comprising administering to the patient a therapeutically effective amount of the disclosed snRNA composition, wherein the composition comprises a vector containing the snRNA sequence disclosed herein, wherein the composition alters, reduces, disrupts, knocks down, or eliminates the expression level of a targeted RNA (compared to the expression level of the targeted RNA treated with a non-targeted (NT) control or compared to untreated RNA). In another embodiment, the reduction level is 1-fold or higher. In another embodiment, the reduction level is 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold. In another embodiment, the reduction level is 10-fold or higher. In another embodiment, the reduction level is between 10-fold and 20-fold. In another embodiment, the reduction level is 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold. In another embodiment, when administered to a patient, the gene therapy composition disclosed herein results in 20%-100% disruption of the targeted RNA. In one embodiment, the elimination percentage of the targeted RNA is any one of 20-99%, 25%-99%, 50%-99%, 80%-99%, 90%-99%, or 95%-99%. In another embodiment, the elimination percentage is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In yet another embodiment, the elimination percentage is complete elimination or 100% elimination of the targeted RNA.

[0200] This disclosure provides a method for treating a subject’s disease or disorder, the method comprising administering a nucleic acid molecule targeting RNA (i.e., the snRNA of this disclosure) or an AAV vector containing the snRNA of this disclosure.

[0201] In some respects, the disease or disorder is Duchenne muscular dystrophy. In some respects, the nucleic acid molecule or AAV vector targets the RNA sequence encoding dystrophin (DMD). In some respects, the RNA sequence encoding DMD contains intron or exon sequences. In some respects, the exon sequence contains exons 2, 44, 45, 51, 53 of DMD, combinations thereof, or their flanking regions.

[0202] In some embodiments of the methods disclosed herein, the subject of this disclosure has been diagnosed with a disease to be treated. In some embodiments, the subject of this disclosure presents at least one sign or symptom of the disorder or disease to be treated. In some embodiments, the subject of this disclosure presents at least one sign or symptom of the disease.

[0203] In some embodiments of the methods disclosed herein, the subject is female. In some embodiments of the methods disclosed herein, the subject is male. In some embodiments, the subject has two XX or XY chromosomes. In some embodiments, the subject has two XX or XY chromosomes and a third chromosome (X or Y).

[0204] In some embodiments of the methods disclosed herein, the subjects are newborns, infants, children, adults, older adults, or elderly adults. In some embodiments of the methods disclosed herein, the subjects are at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 days old. In some embodiments of the methods disclosed herein, the subjects are at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months old. In some embodiments of the methods disclosed herein, the subjects of this disclosure are at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 years of age or any age or part of age between said ages.

[0205] In some embodiments of the methods disclosed herein, the subjects are mammals. In some embodiments, the subjects are non-human mammals.

[0206] In some embodiments of the methods disclosed herein, the subjects of this disclosure are human beings.

[0207] In some embodiments of the method disclosed herein, a therapeutically effective amount comprises a single dose of the composition disclosed herein. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprising at least one dose of the composition disclosed herein. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprising one or more doses of the composition disclosed herein.

[0208] In some embodiments of the methods disclosed herein, the therapeutically effective dose eliminates the signs or symptoms of the disease or disorder. In some embodiments, the therapeutically effective dose reduces the severity of the signs or symptoms of the disease or disorder.

[0209] In some embodiments of the methods disclosed herein, the effective therapeutic dose eliminates the disease or disorder.

[0210] In some embodiments of the methods disclosed herein, an effective therapeutic dose prevents the onset of disease or disorder. In some embodiments, an effective therapeutic dose delays the onset of disease or disorder. In some embodiments, an effective therapeutic dose reduces the severity of signs or symptoms of disease or disorder. In some embodiments, an effective therapeutic dose improves the prognosis of the subject.

[0211] In some embodiments of the methods disclosed herein, the composition is administered to a subject via intracerebral administration. In some embodiments, the composition is administered to a subject via the striatum. In some embodiments, the composition is administered to a subject via stereotactic injection or infusion. In some embodiments, the composition is administered to skeletal muscle. In some embodiments, the composition is administered to the brain. In some embodiments of the methods disclosed herein, the composition is administered topically to a subject.

[0212] In some embodiments, the compositions disclosed herein are formulated as pharmaceutical compositions. In short, pharmaceutical compositions for use as disclosed herein may comprise a protein or polynucleotide encoding a protein optionally contained in an AAV (which may also be immunoorthogonal), and one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may comprise buffers, such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrates such as glucose, mannose, sucrose, or dextran, mannitol; proteins; peptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The compositions disclosed herein may be formulated for routes of administration such as oral, enteral, topical, transdermal, intranasal, and / or inhalation; and for routes of administration via injection or infusion, such as intravenous, intramuscular, subpiacular, intrathecal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and / or parenteral administration. In some embodiments, the compositions of this disclosure are formulated for intracerebral or striatal administration. Example

[0213] Example 1: AAV9 snRNA-mediated exon 53 skipping in vitro and in vivo Materials and methods: Transfection of myotubes: The patient's myoblasts differentiated into myotubes in 4-5 days. Differentiated cells were transfected with synthetic U7 snRNA (IDT) using Lipofectamine 2000 (Invitrogen) at a final dose of 25 nM, 50 nM, or 100 nM. Cells were harvested in 1 ml TRIzol reagent (Invitrogen) 24 hours post-transfection. RNA was extracted using the ZYMO Direct-zol RNA Micropreparation Kit (Zymo Research).

[0214] Transduction in myotubules: Patient myoblasts differentiated into myotubes on day 3 post-differentiation. On day 3 post-differentiation, cells were transduced with AAV9 virus at the designated MOI. Culture medium was replenished 24 hours post-transduction and replaced 48 hours post-transduction. Cells were harvested in 1 ml of TRIzol reagent (Invitrogen) on day 7 post-transduction. RNA was extracted using the ZYMO Direct-zol RNA Micropreparation Kit (ZymoResearch).

[0215] In vivo assessment of AAV9-A05014 and A05211: Six-week-old del52hDMD / mdx mice were administered 1E12 vg / animal of AAV9-A05014 or AAV9-A05211 via the orbital region. After 4 weeks of survival, tissues were collected, homogenized in TRIzol, and extracted using the ZYMO Direct-zol RNA Micropreparation Kit (Zymo Research).

[0216] Splice measurement: Following the manufacturer's recommendations, 50–500 ng of RNA was used for cDNA synthesis using qScript Ultra SuperMix (QuantaBio). PCR was performed on the cDNA using GoTaq Green Master Mix (Promega). The PCR products were run on a 4200 TapeStation (Agilent) with a D1000 ScreenTape (Agilent).

[0217] Immunofluorescence: Seven days after treatment, cells were fixed with PFA and stained with primary antibody (mouse anti-dystrophy protein MANDYS106MABT827 1:100) diluted in 1% BSA containing 0.1% Triton-X 100, and incubated overnight at 4°C. The next day, cells were washed with PBS 3×5 min, then incubated for 1 hour at room temperature in the dark with goat anti-mouse secondary antibody Alexa-Fluor 647 (1:1000) in the same carrier solution as the primary antibody. Cells were washed three times with PBS and then mounted with Prolong Gold anti-quenching solution containing DAPI. After curing, slides were imaged on a vertical fluorescence microscope with a 20× objective lens.

[0218] See Figure 1-3.

[0219] Overview: SnRNAs targeting exon 53 skipping were screened and synthesized in patient myotubes. The optimally selected fusion spacer region was cloned as a 2× snRNA cassette into an AAV vector and packaged into scAAV9. Treatment of patient myotubes with scAAV9 A05014 resulted in the restoration of dystrophin by infusion 7 days post-transduction. Treatment of del52hDMD / mdx mice with scAAV-A05211 resulted in robust exon 53 skipping in multiple skeletal muscle tissues 4 weeks post-IV delivery (see Figures 1–3).

[0220] Example 2: AAV9 snRNA-mediated exon 44 skipping in myotubes of patients with missing exon 45 Materials and methods: Transfection of myotubes: The patient's myoblasts differentiated into myotubes 4-5 days later. Differentiated cells were transfected with synthetic U7 snRNA (IDT) using Lipofectamine 2000 (Invitrogen) at a final dose of 25 nM. Cells were harvested in 1 ml TRIzol reagent (Invitrogen) 24 hours post-transfection. RNA was extracted using the ZYMO Direct-zol RNA Micropreparation Kit (Zymo Research).

[0221] Transduction in myotubules: Patient myoblasts differentiated for 3 days. On day 3 post-differentiation, cells were transduced with a virus at the specified MOI. Culture medium was replenished 24 hours post-transduction and replaced 48 hours post-transduction. Cells were harvested in 1 ml TRIzol reagent (Invitrogen) 7 days post-transduction. RNA was extracted using the ZYMO Direct-zol RNA Micropreparation Kit (Zymo Research).

[0222] Splice measurement: Following the manufacturer's recommendations, 50–500 ng of RNA was used for cDNA synthesis with qScript Ultra SuperMix (QuantaBio). PCR was performed on the cDNA using GoTaq Green Master Mix (Promega). The PCR products were run on a 4200 TapeStation (Agilent) with a D1000 ScreenTape (Agilent).

[0223] Protein analysis: Run the myotubule lysate on Jess Simple Western (ProteinSimple) according to the manufacturer's instructions.

[0224] Overview: SnRNAs targeting exon 44 skipping were screened and synthesized in patient myotubes. The optimally selected fusion spacer region was cloned as a 2× snRNA cassette into an AAV vector and packaged into scAAV9. scAAV9 A05374 and A05375 showed dose-dependent exon 44 skipping and dystrophin recovery in del45 myotubes 7 days post-transduction (see Figures 4–6).

[0225] Example 3: AAV9 snRNA-mediated exon 45 skipping in myotubes of patients with missing exon 44 Materials and methods: U7 snRNA was engineered to bind splicing regulatory sequences (SA, splice acceptor; SD, splice donor; and / or ESE, exon splicing enhancer sequence) to promote exon 45 skipping, which resulted in the restoration of the DMD mRNA reading frame in patients with the Δ44 mutation, as well as the restoration of dystrophin. After transfection of human myotubes with 100 nM synthetic snRNA, RT-PCR was performed using primers in exons 43 and 46 / 47 to determine product size. The predicted size including exon 45 was 487 bp, while the size excluding exon 45 was 311 bp. See also Figure 7A -C.

[0226] Synthetic snRNA screening was performed at a low concentration (25 nM) to identify valid spacer region sequences. RT-PCR was performed after transfection with U7 snRNA to synthesize RNA. The predicted exon 45 skipping sequence was 487 bp, while the predicted exon 45 exclusion sequence was 311 bp. Exon 45 skipping was quantified and compared between human (top) and mouse (bottom) exon 45 sequences. Target sequences contained in the synthetic snRNAs used for screening were mapped. See also Figure 8A -8C.

[0227] This study demonstrates AAV9-mediated exon 45 skipping in human Δ44 (exon 44 deletion) myotubes. Myotubes were transduced using an AAV9 exon 45-targeted construct, and the percentage of skipping was determined 7 days after transduction with A05189 and A05190 at different MOIs. ddPCR was performed to determine the snRNA copy number per nanogram of total RNA expressed by A05189 and A05190.

[0228] Overview: SnRNAs targeting exon 45 skipping were screened and synthesized in patient myotubes. The optimally selected fusion spacer region was cloned as a 2× snRNA cassette into an AAV vector and packaged into scAAV9. scAAV9 A05189 and A05190 showed dose-dependent exon 45 skipping and robust snRNA expression in del44 myotubes 7 days post-transduction (see Figures 7–9).

[0229] Example 4: AAV-mediated multi-exon skipping of DMD exons 50-53 in human myotubules lacking 52 Human del 52 myotubes were transduced with A05178, which carries engineered snRNA targeting exons 50, 51, 52, and 53. After 7 days, RNA was extracted and RT-PCR was performed to identify exon skipping. Exon skipping bands were quantified by dividing the peak molar concentration of the amplicons (representing single or multiple exon skipping) by the signal of all DMD amplicons.

[0230] Overview: Treatment of del52 myotubes with A05178 carrying 4×snRNA targeting exons 50-53 resulted in DMD with single and multiple exon skipping 7 days post-transduction.

[0231] Example 5: Multi-exon skipping strategy for exons 44 and 45 in human wild-type myotubes Healthy human (wild-type, WT) myotubes were co-transfected with a combination of synthetic snRNAs targeting exons 44 and 45. RNA was extracted 24 hours later and RT-PCR was performed to identify exon skipping. To determine the percentage of multiple skipping, the signal of each of the exon 44 and exon 45 skipping bands was divided by the signal of all DMD amplicons.

[0232] Overview: Treatment of WT human myotubes with a combination of synthetic snRNAs targeting exon 44 and exon 45 resulted in the accumulation of DMD amplicon lacking both exon 44 and exon 45, indicating that this strategy can be used for multi-exon skipping of exon 44-45.

[0233] in conclusion These embodiments describe a therapeutic strategy employing engineered U7 snRNA with a unique spacer region for targeting exon splicing enhancers within various DMD single-exon and multi-exon strategies. This work is based on our earlier... DMD Support for exon 51 (LBIO-115) operation. At high doses, delivered intravenously to del52hDMD / mdx After 3 weeks in mice, exon 51 skipping was >95% in the heart and up to 73% in skeletal muscle. Skipping persisted for 12 weeks in both skeletal and cardiac tissues, while DMD protein doubled between weeks 4 and 12. We now describe AAVsnRNA constructs containing novel spacer sequences targeting the splicing regulatory regions of exons 53, 44, and 45. These constructs exhibited remarkably high levels of the full-length genome (90%+). Seven days after transduction of the scAAV9 dual snRNA cassette, patient-derived cells showed robust, dose-dependent expected exon skipping, as well as restoration of dystrophin expression. Intravenous delivery of the scAAV9-exon 53 construct to del52hDMD / mdx mice (which could also be modified for exon 53 skipping) resulted in >95% exon skipping in the heart and up to 75% exon skipping in skeletal muscle after 4 weeks. A total of 35% of DMD patients can be treated with an exon skipping approach targeting exons 51, 53, 45, and 44, and deploying this strategy to skip each disease-related exon can treat up to ~70% of DMD patients.

[0234] Incorporation as cited Unless expressly excluded or otherwise limited, every reference cited herein (including any cross-referenced or related patents or applications) is incorporated herein in its entirety. Any reference to any document is not an admission that it is prior art to any invention disclosed or practiced herein, or that it, alone or in any combination of any other references, teaches, suggests, or discloses any such invention. Furthermore, in the event of any conflict between the meaning or definition of any term in this document and any meaning or definition of the same term in any of the documents incorporated herein by reference, the meaning or definition given to that term in this document shall prevail.

[0235] Other implementation plans While specific embodiments of this disclosure have been described and illustrated, various other changes and modifications may be made without departing from the spirit and scope of this disclosure. The scope of the appended claims includes all such changes and modifications within the scope of this disclosure.

Claims

1. A nucleic acid molecule containing a target RNA of small nuclear RNA (snRNA), wherein the snRNA contains a target sequence that binds to a dystrophin (DMD) RNA sequence, wherein the DMD RNA sequence contains at least one splicing regulatory sequence selected from the group consisting of a splice acceptor sequence, a splice donor sequence, and an exon splicing enhancer sequence.

2. The nucleic acid molecule of the target RNA of claim 1, wherein the DMD RNA sequence is at least one of exon 2, exon 44, exon 45, exon 51 and / or exon 53.

3. The nucleic acid molecule of the target RNA of claim 1, wherein the target sequence comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage therebetween) identity with the nucleic acid sequence shown in any one of SEQ ID NO: 59-118, 126, 206-227 and 237-1344.

4. The nucleic acid molecule of the targeting RNA of claim 1, wherein the snRNA comprises a stem loop (SL), the stem loop (SL) comprising a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity with any one or more nucleic acid sequences shown in any one of SEQ ID NO: 1-SEQ ID NO: 11, SEQ ID NO: 144-SEQ ID NO: 148, SEQ ID NO: 164, SEQ ID NO: 186, SEQ ID NO: 190-SEQ ID NO: 205, SEQ ID NO: 228-SEQ ID NO: 230, SEQ ID NO: 235, or SEQ ID NO:

236.

5. The nucleic acid molecule of the target RNA of claim 1, wherein the stem-loop (eSL) is an engineered stem-loop, the engineered stem-loop comprising a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage therebetween) identity with one or more nucleic acid sequences shown in any one of SEQ ID NO: 1 - SEQ ID NO:

11.

6. The nucleic acid molecule of the target RNA of claim 1, wherein the DMD RNA sequence is a precursor mRNA or an mRNA sequence.

7. The nucleic acid molecule of the target RNA of claim 1, wherein the snRNA comprises two targeting sequences that target two target RNAs.

8. The nucleic acid molecule of the target RNA of claim 7, wherein the two target sequences are fusion sequences.

9. The nucleic acid molecule of the target RNA of claim 1, wherein the snRNA comprises a SmBD selected from U1, U2, U4 and U5 Sm binding domains (SmBD).

10. The nucleic acid molecule of the target RNA of claim 9, wherein the SmBD comprises the nucleic acid sequence shown in any one of SEQ ID NO: 31 - SEQ ID NO:

38.

11. The nucleic acid molecule of the target RNA of claim 1, wherein the snRNA comprises a 5' interaction stabilizer domain (5'ISD) comprising a nucleotide sequence selected from any one of SEQ ID NO: 12 - SEQ ID NO:

23.

12. A vector comprising one or more snRNAs of claim 1.

13. The carrier of claim 12, wherein the carrier is an AAV carrier.

14. The AAV vector of claim 13, wherein the snRNA is operatively linked to a promoter.

15. The AAV vector of claim 13, wherein the snRNA is operatively linked to the U7 promoter or the U1 promoter.

16. The AAV vector of claim 13, wherein the snRNA is operatively linked to a downstream terminator (DT).

17. The AAV vector of claim 13, wherein the snRNA is operatively linked to a U7 downstream terminator or a U1 downstream terminator.

18. The AAV vector of claim 13, wherein the vector comprises at least one, at least two, at least three, at least four, or at least five snRNAs.

19. The AAV vector of claim 18, wherein the at least one, at least two, at least three, at least four, or at least five snRNAs each target the same target RNA sequence.

20. The AAV vector of claim 18, wherein the at least one, at least two, at least three, at least four, or at least five snRNAs target two or more target RNA sequences.

21. The AAV vector of claim 18, wherein each snRNA is separated by a buffer sequence.

22. The AAV vector of claim 21, wherein the buffer sequence comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage therebetween) identity with the nucleic acid sequences shown in any one of SEQ ID NO: 24 - SEQ ID NO:

30.

23. The AAV vector of claim 13, wherein the vector comprises a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage therebetween) identity with the nucleic acid sequence shown in any one of SEQ ID NO: 130 - SEQ ID NO:

138.

24. A method of targeting one or more target RNAs and blocking, knocking down, editing, exon skipping, or splicing the one or more target RNAs, the method comprising contacting the snRNA of claim 1 with a cell containing the one or more target RNAs.

25. A nucleic acid molecule that targets DMD RNA, comprising the target sequence shown in any one of SEQ ID NO: 59-118, 206-227 or 237-333.

26. A method for treating a disease or disorder in a subject, the method comprising administering a nucleic acid molecule of the targeting RNA of claim 1 or the AAV vector of claim 12.

27. The method of claim 26, wherein the disease or disorder is Duchenne muscular dystrophy.

28. The method of claim 26, wherein the administration is intravenous, intramuscular, subpiacular, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and / or parenteral administration.

Images