AAV capsid retargeting for central nervous system targeting

Abstract

This disclosure relates to a targeting portion (e.g., a CNS targeting portion) of a peptide that can be inserted into the capsid of a recombinant adeno-associated virus (rAAV) vector. Compositions comprising the CNS targeting portions disclosed herein are also disclosed, as well as methods for their preparation and use.

Description

[0001] Cross-references to related applications This application claims priority and benefit to U.S. Provisional Patent Application No. 63 / 547,054, filed November 2, 2023; U.S. Provisional Patent Application No. 63 / 547,667, filed November 7, 2023; and U.S. Provisional Patent Application No. 63 / 570,546, filed March 27, 2024, the entire contents of which are incorporated herein by reference. Background Technology

[0002] Targeted delivery of payloads (e.g., using recombinant adeno-associated viruses) to cells or tissues to treat and / or prevent disease remains a challenge. Summary of the Invention

[0003] This disclosure identifies certain challenges in existing targeted delivery of payloads. For example, this disclosure identifies the lack of a targeting portion that enables specific delivery of the payload to target cells or tissues while reducing non-specific delivery to other cells or tissues is a key challenge. Another challenge identified in this disclosure is the poor potency associated with the delivery vector (e.g., a recombinant adeno-associated virus vector). In some embodiments, improving the potency of the delivery vector can be beneficial in achieving clinically relevant outcomes.

[0004] This disclosure provides, in particular, techniques that can address certain limitations identified in existing targeted delivery of payloads. The techniques provided herein are particularly suitable for specifically delivering payloads to target cells or tissues (e.g., central nervous system (CNS) cells and / or tissues). In some embodiments, the techniques provided herein can also increase payload potency by specifically delivering the payload to target cells or tissues.

[0005] This disclosure covers peptides comprising a CNS-targeting portion (e.g., a portion targeting CNS cells and / or tissues). Recombinant adeno-associated virus (rAAV) particles comprising a variant AAV capsid containing a targeting portion, such as the CNS-targeting portion disclosed herein, are also disclosed herein. In some embodiments, the targeting portion (e.g., the CNS-targeting portion) in the variant AAV capsid is also referred to as a “peptide insert.” In some embodiments, the targeting portion (e.g., the CNS-targeting portion (e.g., in the variant AAV capsid)) provides CNS cell and / or tissue tropism. In some embodiments, rAAV particles comprising a variant capsid having the peptide insert disclosed herein bind to and / or recognize targets on cells (e.g., cells in CNS cells and / or CNS tissues). Compositions comprising the rAAV particles disclosed herein and their uses are also disclosed herein.

[0006] In some embodiments, this disclosure provides recombinant adeno-associated virus (rAAV) particles comprising: (a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insert relative to a corresponding parental AAV capsid protein, wherein: (i) the peptide insert comprises the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3, and X4 are independently any amino acids, and X5 is Y, W, or F; and (ii) the peptide insert site is located in the variable region (VR) of the parental AAV capsid protein (e.g., AAV9 capsid protein); and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload. In some embodiments, the peptide insert comprises the sequences provided in Table 2 or Table 4. In some embodiments, the peptide insert in the variant AAV capsid protein disclosed herein comprises the sequence SEQ ID NO: 14 (IPQGVYI). In some embodiments, the peptide insert in the variant AAV capsid protein disclosed herein comprises the sequence SEQ ID NO: 18 (KGGQVYI). In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence of SEQ ID NO: 24 (NNQGVYI). In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence of SEQ ID NO: 44 (TNHGVYI). In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence of SEQ ID NO: 47 (TQHGVYI). In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence of TTMGVYI (SEQ ID NO: 75).

[0007] In some embodiments, this disclosure provides recombinant adeno-associated virus (rAAV) particles comprising: (a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: (i) the peptide insertion consists of the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3, and X4 are independently any amino acids, and X5 is Y, W, or F; and (ii) the peptide insertion site is located in the variable region (VR) of the parental AAV capsid protein (e.g., AAV9 capsid protein); and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload. In some embodiments, the peptide insertion consists of sequences provided in Table 2 or Table 4. In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence SEQ ID NO: 14 (IPQGVYI). In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 18 (KGGQVYI). In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 24 (NNQGVYI). In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 44 (TNHGVYI). In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 47 (TQHGVYI). In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of TTMGVYI (SEQ ID NO: 75).

[0008] In some embodiments, this disclosure provides recombinant adeno-associated virus (rAAV) particles comprising: (a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insert relative to a corresponding parental AAV capsid protein, wherein: (i) the peptide insert comprises a sequence provided in Table 1 or Table 3; and (ii) the peptide insert site is located in the variable region (VR) of the parental AAV capsid protein (e.g., AAV9 capsid protein); and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload. In some embodiments, the peptide insert comprises a sequence provided in Table 1. In some embodiments, the peptide insert comprises a sequence provided in Table 3. In some embodiments, the peptide insert in the variant AAV capsid protein disclosed herein comprises the sequence of SEQ ID NO: 4 (AYALPKG). In some embodiments, the peptide insert in the variant AAV capsid protein disclosed herein comprises the sequence of TTMGVYI (SEQ ID NO: 75).

[0009] In some embodiments, this disclosure provides recombinant adeno-associated virus (rAAV) particles comprising: (a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insert relative to a corresponding parental AAV capsid protein, wherein: (i) the peptide insert consists of sequences provided in Table 1 or Table 3; and (ii) the peptide insert site is located in a variable region of the parental AAV capsid protein (e.g., AAV9 capsid protein); and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload. In some embodiments, the peptide insert consists of sequences provided in Table 1. In some embodiments, the peptide insert consists of sequences provided in Table 3. In some embodiments, the peptide insert in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 4 (AYALPKG). In some embodiments, the peptide insert in the variant AAV capsid protein disclosed herein consists of the sequence of TTMGVYI (SEQ ID NO: 75).

[0010] In some embodiments, this disclosure provides recombinant adeno-associated virus (rAAV) particles comprising: (a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: (i) the peptide insertion comprises at least four, at least five, or at least six consecutive amino acids of the sequences provided in any one of Tables 1, 2, 3, or 4; and (ii) the peptide insertion site is located in a variable region of the parental AAV capsid protein (e.g., AAV9 capsid protein); and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload. In some embodiments, the peptide insertion comprises at least four, at least five, or at least six consecutive amino acids of the sequences provided in Table 1. In some embodiments, the peptide insertion comprises at least four, at least five, or at least six consecutive amino acids of the sequences provided in Table 2. In some embodiments, the peptide insertion comprises at least four, at least five, or at least six consecutive amino acids of the sequences provided in Table 3. In some embodiments, the peptide insertion comprises at least four, at least five, or at least six consecutive amino acids of the sequences provided in Table 4.

[0011] In some embodiments of the rAAV particles or variant AAV capsid proteins disclosed herein, the peptide insertion site is located between two adjacent amino acids in the variable region of the parental AAV capsid protein (e.g., AAV9 capsid protein).

[0012] In some embodiments of the rAAV particles disclosed herein or the variant AAV capsid proteins disclosed herein, the peptide insertion site is located between two non-adjacent amino acids in the variable region of the parental AAV capsid protein (e.g., AAV9 capsid protein).

[0013] In some embodiments, the parental AAV capsid protein includes AAV9 capsid protein, AAV1 capsid protein, AAV2 capsid protein, AAV3B capsid protein, AAV4 capsid protein, AAV5 capsid protein, AAV6 capsid protein, AAV7 capsid protein, AAV8 capsid protein, AAV10 capsid protein, AAV11 capsid protein, AAV12 capsid protein, AAV13 capsid protein, AAVhu68 capsid protein, or AAVrh10 capsid protein.

[0014] In some embodiments of the rAAV particles or variant AAV capsid proteins disclosed herein, the peptide is inserted into VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII, or VR-IX of the parental AAV capsid protein (e.g., AAV9 capsid protein).

[0015] In some embodiments, the peptide is inserted into VR-VIII of the parental AAV capsid protein (e.g., AAV9 capsid protein). In some embodiments, the parental AAV capsid protein is selected from AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10 capsid protein, and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position of the capsid protein (e.g., VP1, VP2, or VP3) of another parental AAV capsid protein (e.g., AAV1, AAV2, or VP3 of AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10 capsid protein).

[0016] In some embodiments, the parental AAV capsid protein is the AAV9 capsid protein, and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the peptide insertion site is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0017] In some embodiments of the rAAV particles disclosed herein or the variant AAV capsid proteins disclosed herein, the variant AAV capsid protein comprises: (1) a peptide insertion comprising the common sequence of SEQ ID NO: 1, and (2) one or more sequences of the VP (e.g., VP1, VP2, or VP3) of the AAV9 capsid protein.

[0018] In some embodiments of the rAAV particles disclosed herein or the variant AAV capsid proteins disclosed herein, the variant AAV capsid proteins comprise: (1) a peptide insertion comprising the sequences provided in Table 1, and (2) one or more sequences of the VP (e.g., VP1, VP2, or VP3) of the AAV9 capsid protein.

[0019] In some embodiments of the rAAV particles disclosed herein or the variant AAV capsid proteins disclosed herein, the variant AAV capsid proteins comprise: (1) a peptide insertion comprising the sequences provided in Table 2, and (2) one or more sequences of the VP (e.g., VP1, VP2, or VP3) of the AAV9 capsid protein.

[0020] In some embodiments of the rAAV particles disclosed herein or the variant AAV capsid proteins disclosed herein, the variant AAV capsid proteins comprise: (1) a peptide insertion comprising the sequences provided in Table 3, and (2) one or more sequences of the VP (e.g., VP1, VP2, or VP3) of the AAV9 capsid protein.

[0021] In some embodiments of the rAAV particles disclosed herein or the variant AAV capsid proteins disclosed herein, the variant AAV capsid proteins comprise: (1) a peptide insertion comprising the sequences provided in Table 4, and (2) one or more sequences of the VP (e.g., VP1, VP2, or VP3) of the AAV9 capsid protein.

[0022] In some embodiments, the peptide is inserted into VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the peptide insertion site is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the peptide insertion comprises the sequence TTMGVYI (SEQ ID NO: 75) and is inserted between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the peptide insertion is the sequence TTMGVYI (SEQ ID NO: 75) and is inserted between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0023] In some embodiments of the rAAV particles or variant AAV capsid proteins disclosed herein, a peptide insertion of a heteropeptide replaces a consecutive amino acid segment of the parental AAV capsid protein (e.g., AAV9 capsid protein).

[0024] In some embodiments of the rAAV particles or variant AAV capsid proteins disclosed herein, the peptide insertion of the heteropeptide does not replace consecutive amino acid segments of the parental AAV capsid protein (e.g., AAV9 capsid protein).

[0025] This disclosure also provides targeting portions, such as CNS targeting portions, that are conjugated or fused with a payload. In some embodiments, the targeting portion (e.g., the CNS targeting portion) comprises a peptide sequence provided in any of Tables 1 through 4. In some embodiments, the targeting portion (e.g., the CNS targeting portion) is part of (e.g., incorporated therein) a vector (e.g., a viral vector or a non-viral vector). In some embodiments, the targeting portion (e.g., the CNS targeting portion) encapsulates a payload, as described herein. In some embodiments, the targeting portion (e.g., the CNS targeting portion) is tethered to a payload, as described herein. In some embodiments, the peptide insert in the targeting portion disclosed herein comprises a sequence containing TTMGVYI (SEQ ID NO:75).

[0026] This paper also discloses an isolated nucleic acid containing a nucleotide sequence encoding a variant AAV capsid protein or targeting portion (e.g., a CNS targeting portion) fused with a payload as disclosed herein.

[0027] This paper also discloses isolated cells transduced with the rAAV particles disclosed herein. It further discloses cells containing isolated nucleic acids that encode a nucleotide sequence encoding a variant AAV capsid protein as disclosed herein.

[0028] This disclosure also provides compositions comprising a targeting portion (e.g., a CNS-targeting portion) and a payload, wherein the targeting portion (e.g., a CNS-targeting portion) comprises a peptide sequence provided in any of Tables 1 to 4.

[0029] This article also provides a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to the corresponding parental AAV capsid protein, and wherein: (i) the peptide insertion comprises the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acids, and X5 is Y, W or F; (ii) the peptide insertion site is in the variable region (VR) of the parental AAV capsid protein (e.g., AAV9 capsid protein).

[0030] This disclosure provides a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to the corresponding parental AAV capsid protein, and wherein: (i) the peptide insertion comprises a sequence provided in any of Tables 1 to 4; and (ii) the peptide insertion site is located in the variable region (VR) of the parental AAV capsid protein (e.g., AAV9 capsid protein). In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence TTMGVYI (SEQ ID NO: 75).

[0031] This disclosure provides a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to the corresponding parental AAV capsid protein, and wherein: (i) the peptide insertion comprises a sequence of at least four, at least five, or at least six consecutive amino acids of the sequence provided in any one of Tables 1, 2, 3, or 4; and (ii) the peptide insertion site is located in the variable region (VR) of the parental AAV capsid protein (e.g., AAV9 capsid protein).

[0032] In some embodiments, the peptide is inserted into VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII, or VR-IX of the parental AAV capsid protein (e.g., AAV9 capsid protein). In some embodiments, the peptide is inserted into VR-VIII of the parental AAV capsid protein (e.g., AAV9 capsid protein).

[0033] In some embodiments, the parental AAV capsid protein is the AAV9 capsid protein, and VR-VIII contains amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0034] This document also provides compositions comprising a targeting portion (e.g., a CNS-targeting portion) and a payload, wherein the targeting portion (e.g., a CNS-targeting portion) comprises the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3, and X4 are independently any amino acid, and X5 is Y, W, or F. In some embodiments, the targeting portion (e.g., a CNS-targeting portion) comprises the sequence provided in Table 2 or Table 4. In some embodiments, the targeting portion (e.g., a CNS-targeting portion) comprises the sequence SEQ ID NO: 14 (IPQGVYI). In some embodiments, the targeting portion (e.g., a CNS-targeting portion) comprises the sequence SEQ ID NO: 18 (KGGQVYI). In some embodiments, the targeting portion (e.g., a CNS-targeting portion) comprises the sequence SEQ ID NO: 24 (NNQGVYI). In some embodiments, the targeting portion (e.g., a CNS-targeting portion) comprises the sequence SEQ ID NO: 44 (TNHGVYI). In some implementations, the targeting portion (e.g., the CNS targeting portion) contains the sequence of SEQ ID NO: 47 (TQHGVYI).

[0035] This document also provides compositions comprising a targeting portion (e.g., a CNS-targeting portion) and a payload, wherein the targeting portion (e.g., a CNS-targeting portion) comprises a peptide containing a sequence provided in any of Tables 1 to 4. In some embodiments, the peptide in the targeting portion (e.g., the CNS-targeting portion) is inserted with a sequence containing TTMGVYI (SEQ ID NO: 75).

[0036] This document also provides compositions comprising a targeting portion (e.g., a CNS-targeting portion) and a payload, wherein the targeting portion (e.g., a CNS-targeting portion) comprises a peptide comprising a sequence of at least four, at least five, or at least six consecutive amino acids of the sequences provided in any one of Tables 1, 2, 3, or 4.

[0037] In some implementations, the target portion (e.g., the CNS target portion) is coupled to or fused with the payload.

[0038] In some implementations, the targeting portion (e.g., the CNS targeting portion) is inserted into a viral protein (e.g., the AAV capsid protein).

[0039] In some implementations, the targeting portion (e.g., the CNS targeting portion) is part of the vector, for example, incorporated therein.

[0040] In some implementations, the targeting portion (e.g., the CNS targeting portion) is not part of the vector.

[0041] This disclosure also provides a pharmaceutical composition comprising: (a) the rAAV particles disclosed herein; and (b) a pharmaceutically acceptable excipient.

[0042] This document also provides a method for delivering a payload to CNS cells and / or tissues, comprising applying the pharmaceutical composition disclosed herein to CNS cells and / or tissues.

[0043] In some implementations, CNS cells and / or tissues are in vitro.

[0044] In some implementations, CNS cells and / or tissues are in vivo.

[0045] In some implementations, CNS cells and / or tissues are derived from subjects who have or have been diagnosed with CNS conditions.

[0046] In some embodiments, the CNS cells or tissues are selected from: CNS epithelial cells, nerve cells, CNS connective tissue cells, stem cells, progenitor cells, CNS immune cells, spinal cord cells, cells lining one or more ventricles, neural support cells, glial cells, adipocytes, meningeal cells, or combinations thereof.

[0047] In some embodiments, CNS cells include CNS epithelial cells. In some embodiments, CNS epithelial cells include cells lining one or more ventricles.

[0048] In some embodiments, CNS cells include nerve cells (neurons). In some embodiments, neurons include unipolar neurons, bipolar neurons, pseudounipolar neurons, multipolar neurons, or combinations thereof. In some embodiments, neurons are motor neurons, sensory neurons, interneurons, excitatory neurons, inhibitory neurons, sympathetic neurons, parasympathetic neurons, or combinations thereof. In some embodiments, neurons include pyramidal neurons, dopaminergic neurons, cholinergic neurons, adrenergic neurons, GABAergic neurons, glutamatergic neurons, serotonergic neurons, purinergic neurons, histaminergic neurons, lower motor neurons, or combinations thereof.

[0049] In some embodiments, nerve cells (neurons) include neural supporting cells. In some embodiments, neural supporting cells include glial cells. In some embodiments, glial cells include astrocytes, microglia, ependymal cells, oligodendrocytes, Schwann cells, or combinations thereof.

[0050] In some embodiments, CNS cells include CNS connective tissue cells. In some embodiments, CNS connective tissue cells include adipocytes or meningeal cells, or both.

[0051] In some implementations, CNS cells include stem cells or progenitor cells. In some implementations, stem cells include neural stem cells.

[0052] In some implementations, CNS cells include cells lining one or more ventricles of the brain.

[0053] In some implementations, CNS cells include meningeal cells.

[0054] In some implementations, CNS cells include adipocytes.

[0055] In some implementations, CNS tissue includes tissues found in the following: cortex, thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, deep cerebellar nuclei, or other parts of the brain and / or spinal cord.

[0056] In some implementations, the CNS tissue includes tissues found in the following: frontal cortex, parietal cortex, occipital cortex, temporal cortex, or combinations thereof.

[0057] In some embodiments of any of the AAV particles containing a variant AAV capsid, compositions containing rAAV particles, or methods of using thereof disclosed herein, the variant AAV capsid confers increased infectivity and / or transduction to central nervous system (CNS) cells and / or tissues compared to the infectivity and / or transduction to central nervous system (CNS) cells and / or tissues of control AAV particles containing the corresponding parental AAV capsid protein.

[0058] In some implementations, rAAV particles containing variant AAV capsid proteins confer at least 1.5-fold, at least 2-fold, 2.5-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, or at least 70-fold increased infectivity and / or transduction in CNS cells compared to control AAV particles containing the corresponding parental AAV capsid protein.

[0059] In some implementations, rAAV particles containing variant AAV capsid proteins confer approximately 1.5-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, 60-fold, or 70-fold increased infectivity and / or transduction in CNS cells or tissues compared to control AAV particles containing the corresponding parental AAV capsid protein.

[0060] In some embodiments of any of the variant AAV capsid, AAV particles comprising the variant AAV capsid, compositions comprising the variant AAV capsid, or methods of using the variant AAV capsid, the variant AAV capsid comprises one or more modifications to the amino acid sequence flanking the peptide insertion site. In some embodiments, the one or more modifications are located within about 10 amino acids upstream or downstream of the peptide insertion site, for example, within about 5 amino acids upstream or downstream of the peptide insertion site.

[0061] In some implementations, one or more modifications include insertions, deletions, mutations, or combinations thereof.

[0062] In some embodiments of the rAAV particles, variant AAV capsid proteins, compositions, or methods disclosed herein, one or more modifications are located in the variable region of the parental AAV capsid protein. In some embodiments, the parental AAV capsid protein includes the AAV9 capsid protein. In some embodiments, one or more modifications are located in the variable region of the AAV9 capsid protein, such as VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII, or VR-IX, or any combination thereof.

[0063] In some implementations, one or more modifications are located in VR-VIII of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0064] In some embodiments, the variant AAV capsid protein further comprises one or more modifications to the amino acid sequence at or near the glycan-binding region. In some embodiments, one or more modifications reduce glycan binding. In some embodiments, the glycan is galactose. For example, the glycan-binding residues of the AAV9 capsid protein include, but are not limited to: (a) amino acids 271 and 272 of VP1, VP2, or VP3; (b) amino acid 446 of VP1, VP2, or VP3; (c) amino acid 470 of VP1, VP2, or VP3; (d) amino acids 501 to 505 of VP1, VP2, or VP3 (e.g., at any one or all of residues 501, 502, 503, 504, or 505, or a combination thereof); or (e) amino acids 489 and 545 of VP1, VP2, or VP3. Based on the exemplary glycan-binding domains and / or residues of the AAV9 capsid protein provided herein, those skilled in the art will be able to readily identify the corresponding glycan-binding domains and / or residues in different parental AAV capsid proteins.

[0065] In some embodiments of the rAAV particles, variant AAV capsid proteins, compositions, or methods disclosed herein, one or more modifications are made at the glycan-binding domain of the parental AAV capsid protein. In some embodiments, the parental AAV capsid protein is AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10 capsid protein. In some embodiments, the parental AAV capsid protein is AAV9 capsid protein.

[0066] In some embodiments, one or more modifications are made at or between the following amino acids: (a) 271 and 272 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (b) 446 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (c) 470 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (d) 501 and 505 of VP1, VP2, or VP3 of the AAV9 capsid protein (e.g., at any one or all of residues 501, 502, 503, 504, or 505, or a combination thereof) or the corresponding position in the capsid protein of another parent AAV capsid protein; (e) (a) The corresponding positions of VP1, VP2, or VP3 of the AAV9 capsid protein at positions 489 and 545 or the capsid protein of another parent AAV capsid protein; (f) The corresponding positions of VP1, VP2, or VP3 of the AAV9 capsid protein at positions 591 and 621 or the capsid protein of another parent AAV capsid protein; or (g) Any combination or all of (a)-(f) In some embodiments of the rAAV particles, variant AAV capsid proteins, compositions, or methods disclosed herein, one or more modifications are made at or between the following amino acids: (a) 271 and 272 of VP1, VP2, or VP3 of the AAV9 capsid protein; (b) 446 of VP1, VP2, or VP3 of the AAV9 capsid protein; (c) 470 of VP1, VP2, or VP3 of the AAV9 capsid protein; (d) 501 and 505 of VP1, VP2, or VP3 of the AAV9 capsid protein (e.g., at any or all of residues 501, 502, 503, 504, or 505, or a combination thereof); (e) 489 and 545 of VP1 of VP1, VP2, or VP3 of the AAV9 capsid protein; (f) 591 and 621 of VP1, VP2, or VP3 of the AAV9 capsid protein; or (g) any combination or all of (a)-(f).

[0067] In some embodiments of any of the variant AAV capsid, AAV particles containing the variant AAV capsid, compositions containing the variant AAV capsid, or methods of using the variant AAV capsid, the variant AAV capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the parental AAV capsid protein.

[0068] In some implementations, the identity percentage is determined by comparing the sequence of the peptide-free variant AAV capsid protein with that of the parent AAV capsid protein.

[0069] In some embodiments, the variant AAV capsid protein and the parental AAV capsid protein are 100% identical if (a) peptide insertions in the variant AAV capsid protein are not considered in sequence comparisons; and (b) the variant AAV capsid protein does not have one or more modifications other than peptide insertions.

[0070] In some embodiments, the variant AAV capsid protein and the parental AAV capsid protein have less than 100% identity if: (a) peptide insertions in the variant AAV capsid protein are not considered in sequence comparisons; and (b) the variant AAV capsid protein contains one or more modifications other than peptide insertions.

[0071] In some implementations, the parental AAV capsid protein is the AAV9 capsid protein of SEQ ID NO: 2001.

[0072] In some implementations, the parental AAV capsid protein is the AAV1 capsid protein of SEQ ID NO: 2002.

[0073] In some implementations, the parental AAV capsid protein is the AAV2 capsid protein of SEQ ID NO: 2003.

[0074] In some implementations, the parental AAV capsid protein is the AAV3B capsid protein of SEQ ID NO: 2010.

[0075] In some implementations, the parental AAV capsid protein is the AAV4 capsid protein of SEQ ID NO: 2051.

[0076] In some implementations, the parental AAV capsid protein is the AAV5 capsid protein of SEQ ID NO: 2004.

[0077] In some implementations, the parental AAV capsid protein is the AAV6 capsid protein of SEQ ID NO: 2005.

[0078] In some implementations, the parental AAV capsid protein is the AAV8 capsid protein of SEQ ID NO: 2006.

[0079] In some implementations, the parental AAV capsid protein is the AAV7 capsid protein of SEQ ID NO: 2052.

[0080] In some implementations, the parental AAV capsid protein is the AAV8 capsid protein of SEQ ID NO: 2006.

[0081] In some implementations, the parental AAV capsid protein is the AAV10 capsid protein of SEQ ID NO: 2053.

[0082] In some implementations, the parental AAV capsid protein is the AAV11 capsid protein of SEQ ID NO: 2054.

[0083] In some implementations, the parental AAV capsid protein is the AAV12 capsid protein of SEQ ID NO: 2055.

[0084] In some implementations, the parental AAV capsid protein is the AAV13 capsid protein of SEQ ID NO: 2056.

[0085] In some implementations, the parental AAV capsid protein is the AAVhu68 capsid protein of SEQ ID NO: 2057.

[0086] In some implementations, the parental AAV capsid protein is the AAVrh10 capsid protein of SEQ ID NO: 2057.

[0087] In some embodiments of the AAV particles comprising a variant AAV capsid, compositions comprising rAAV particles, or methods of using thereof disclosed herein, the payload is or comprises a polypeptide encoded by a nucleic acid sequence within the rAAV particle.

[0088] In some embodiments, the polypeptide is or comprises a CRISPR-Cas protein, or a variant or fragment thereof. In some embodiments, the CRISPR-Cas protein is selected from: type II, type V, or type VI CRISPR-Cas proteins (e.g., Cas9 protein), Cas12a protein, Cas12b protein, Cas12c protein, Cas12d protein, Cas12e protein, Cas12f protein, Cas12g protein, Cas12h protein, Cas12i protein, Cas13a protein, Cas13b protein, or a variant or fragment thereof. In some embodiments, the payload further comprises a guide RNA, gRNA, sgRNA, or crRNA / tracrRNA that interacts with the CRISPR-Cas protein. In some embodiments, the CRISPR-Cas protein is fused to one or more domains (e.g., an activation domain and / or a repression domain). In some embodiments, the CRISPR-Cas protein is a nuclease. In some embodiments, the CRISPR-Cas protein is a cleavage enzyme and cleaves only one strand of the target nucleic acid molecule. In some implementations, the CRISPR-Cas protein is inactivated and binds to but does not cleave the target nucleic acid molecule.

[0089] In some embodiments, the polypeptide is or comprises a zinc finger protein, or a variant or fragment thereof. In some embodiments, the zinc finger protein is selected from: zinc finger nucleases, artificial restriction enzyme fusion proteins, zinc finger DNA binding units optionally fused to a nuclease domain (e.g., the Fok1 nuclease domain), or variants or fragments of any of the foregoing, or any combination thereof. In some embodiments, the zinc finger protein is fused to one or more domains (e.g., an activation domain and / or a repression domain).

[0090] In some embodiments, the polypeptide is or comprises a transcription activator-like effector (TAL) protein, or a variant or fragment thereof. In some embodiments, the TAL comprises: a TAL effector DNA-binding domain (e.g., a TAL effector DNA-binding domain isolated from Xanthomonas species), a transcription activator-like effector nuclease (TALEN), such as a TAL effector DNA-binding domain fused to a nuclease domain (e.g., the Fok1 nuclease domain), or a variant or fragment of either of the foregoing, or any combination thereof. In some embodiments, the TAL protein is fused to one or more domains (e.g., an activation domain and / or a repression domain).

[0091] In some embodiments, the polypeptide is or contains a base editor, or a variant or fragment thereof. In some embodiments, the base editor contains a deaminase, adenosine deaminase (ABE), cytosine deaminase (CBE), APOBEC1, APOBEC3A, APOBEC3G, evoAPOBEC, BE4-YE1, CDA1, activation-induced cytidine deaminase (AID), mutant TadA, adenosine deaminase (TadA*), *E. coli* tRNA-specific adenosine deaminase (TadA), a deaminase associated with a DNA-binding domain monomer, RNA-directed base editing enzyme, or DNA... The payload may include a glycosylation enzyme inhibitor, one or more DNA glycosylation enzyme inhibitor domains, a 5-methylcytosine deaminase, a cytidine deaminase domain, an adenine deaminase domain, an adenosine base editor (ABE), Target-ACEmax, a synchronously programmable adenine and cytosine editor (SPACE), A&C-BEmax, a cyclic substitution base editor, adenosine deaminase (ADAR), RNA editing for programmable adenosine-to-inosine substitution (REPAIR), a lever endogenous ADAR for programmable RNA editing (LEAPER), or a variant or fragment of any of the foregoing, or a combination thereof. In some embodiments, the payload may also include a guide RNA, gRNA, sgRNA, or crRNA / tracrNA that interacts with the base editor.

[0092] In some embodiments, the polypeptide is or contains a lead editor or a variant or fragment thereof, or a system containing the lead editor. In some embodiments, the lead editor and / or the system containing the lead editor includes: reverse transcriptase, lead editing enzyme, editing enzyme including a reverse transcriptase domain, avian myeloblastosis virus (AMV) reverse transcriptase, murine leukemia virus (MLV) reverse transcriptase, HIV-1 reverse transcriptase, bacterial reverse transcriptase, reverse transcriptase associated with a DNA-binding domain and / or protein, reverse transcriptase fused to a DNA-binding domain as a catalytically impaired nuclease domain (e.g., a nickase), lead editing system 1 (PE1), lead editing system 2 (PE2), lead editing system 3 (PE3), lead editing system 3b (PE3b), or variants or fragments of any of the foregoing, or any combination thereof. In some embodiments, the payload also contains a lead editing gRNA (pegRNA) or extended sgRNA that interacts with the lead editor.

[0093] In some embodiments, the polypeptide is or comprises a meganuclease, or a variant or fragment thereof. In some embodiments, the meganuclease is selected from: homing endonucleases, LAGLIDADG family meganucleases, GIYYIG family meganucleases, His-Cyst box family meganucleases, or HNH family endonucleases, I-SeeI, I-CeuI, PI-PspI, PI-SceI, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII, I-TevIII, or variants or fragments of any of the foregoing, or any combination thereof.

[0094] In some implementations, the peptide is associated with CNS symptoms.

[0095] In some implementations, CNS disorders are the result of genetic abnormalities.

[0096] In some implementation schemes, CNS disorders are not the result of genetic abnormalities.

[0097] In some implementations, the CNS condition is selected from: Friedreich's Ataxia, Dravet Syndrome, Spinocerebellar Ataxia Type 3, Niemann-Pick Type C, Huntington's Disease, Pompe Disease, Myotonic Dystrophy Type 1, De Vivo Syndrome (Glucose Transporter 1 Defect Syndrome), Tay-Sachs Disease, Spinal Muscular Atrophy, Alzheimer's Disease, Amyotrophic Lateral Sclerosis (ALS), Danon's Disease, Rett Syndrome, Angelman's Syndrome, Parkinson's Disease, tau proteinosis, hereditary epilepsy (e.g., STXBP1 hereditary epilepsy or CDKL5 hereditary epilepsy), or combinations thereof.

[0098] In some implementations, the polypeptide is an enzyme.

[0099] In some implementations, the polypeptide is an antibody.

[0100] In some implementations, the polypeptide is a secreted protein.

[0101] In some embodiments of the rAAV particles comprising a variant AAV capsid, compositions comprising rAAV particles, or methods of using thereof disclosed herein, the payload is or comprises an RNA molecule encoded by a nucleic acid sequence within the rAAV particle. In some embodiments, the RNA molecule is or comprises siRNA, miRNA, gRNA, antisense RNA, circular RNA, snRNA, or aptamer.

[0102] In some implementations, RNA molecules target nucleic acid molecules that encode peptides associated with CNS conditions.

[0103] In some embodiments of the rAAV particles comprising a variant AAV capsid, compositions comprising rAAV particles, or methods of using thereof disclosed herein, the payload is or comprises a DNA molecule. In some embodiments, the DNA molecule is or comprises a nucleic acid sequence of up to about 5,100 nt in length, such as up to about 5,000 nt, up to about 4,900 nt, up to about 4,800 nt, up to about 4,700 nt, up to about 4,600 nt, up to about 4,500 nt, up to about 4,400 nt, etc.

[0104] In some implementations, the CNS condition is selected from: Friedreich ataxia, Drave syndrome, spinocerebellar ataxia type 3, Niemann-Pick type C, Huntington's disease, Pompe disease, myotonic dystrophy type 1, glucose transporter 1 deficiency syndrome (Devivo syndrome), Ty-Sachs disease, spinal muscular atrophy, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Danon disease, Rett syndrome, Angelman syndrome, Parkinson's disease, tau protein disease, hereditary epilepsy (e.g., STXBP1 hereditary epilepsy or CDKL5 hereditary epilepsy) or combinations thereof.

[0105] In some embodiments of the rAAV particles containing a variant AAV capsid, compositions containing rAAV particles, or methods of using thereof disclosed herein, the nucleotide sequence encoding the payload is operatively linked to a promoter.

[0106] In some embodiments, the promoter is a CNS promoter, or a variant or fragment thereof. In some embodiments, the CNS promoter is selected from: GFAP promoter, SYN1 promoter, NSE / RU5' promoter, cholecystokinin (CCK) promoter, myelin basic promoter (MBP), human myelin-associated glycoprotein promoter, phosphate-activated glutaminase (PAG) promoter, vesicle glutamate transporter (vGLUT) promoter, glutamate decarboxylase (GAD) promoter, Camk2a promoter, TH (tyrosine hydroxylase) promoter, Hb9 promoter, CNP promoter, NES (nestin) promoter, Tub1a promoter, SST (somatostatin) promoter, MeCP2 promoter, or combinations thereof.

[0107] In some implementations, the promoter is or contains a chicken β-actin heterozygous (CBh) promoter or a variant or fragment thereof.

[0108] In some implementations, the promoter is or includes the hSyn1 promoter or a variant or fragment thereof.

[0109] In some implementations, the promoter is or contains a GFAP promoter or a variant or fragment thereof.

[0110] In some embodiments of the method of using a pharmaceutical composition comprising rAAV particles containing the variant AAV capsid protein disclosed herein, the pharmaceutical composition is administered via an administration route selected from: intravenous, intra-arterial, intracoronary, intraparenchymal, subpiaural, intrathecal, intraocular, intraventricular (ICV), intracerebellomedullary cistern (ICM), or intramuscular.

[0111] In some implementations, the subjects are humans.

[0112] This article also provides a method for treating a subject with CNS conditions and / or improving the symptoms of CNS conditions in a subject, the method comprising administering the pharmaceutical composition disclosed herein to the subject.

[0113] In some implementations, the CNS condition is selected from: Friedreich ataxia, Drave syndrome, spinocerebellar ataxia type 3, Niemann-Pick type C, Huntington's disease, Pompe disease, myotonic dystrophy type 1, glucose transporter 1 deficiency syndrome (Devivo syndrome), Ty-Sachs disease, spinal muscular atrophy, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Danon disease, Rett syndrome, Angelman syndrome, Parkinson's disease, tau protein disease, hereditary epilepsy (e.g., STXBP1 hereditary epilepsy or CDKL5 hereditary epilepsy) or combinations thereof.

[0114] As those skilled in the art will understand, the peptide sequences disclosed herein (e.g., peptides disclosed in any of Tables 1 through 3) can be used as targeting moieties (e.g., CNS targeting moieties) to deliver payloads. In some embodiments, the targeting moieties (e.g., CNS targeting moieties) may be conjugated or fused with the payload. In some embodiments, the targeting moieties (e.g., CNS targeting moieties) are inserted into viral proteins (e.g., AAV capsids).

[0115] Other features, objects, and advantages of the invention will become apparent from the following detailed description. However, it should be understood that while embodiments of the invention are shown, the detailed description is given by way of illustration only and not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the detailed description. Attached Figure Description

[0116] This patent or application document contains at least one color drawing. A copy of this patent or application disclosure with color drawings will be provided by the Patent Office upon request and payment of the necessary fees.

[0117] The figures described below (which together constitute the accompanying figures) are for illustrative purposes only and are not intended to limit the scope of the invention. Figure 1 This is a dot plot showing the results of the second round of in vivo screening, which aimed to identify variant AAV capsid proteins with an insertion of AAV9 at VR-VIII that exhibited enhanced CNS transduction in non-human primates (NHPs) compared to WT AAV9.

[0118] Figures 2A-2D The results of the third round of screening are shown, using capsid pools recovered from the second round of screening, which have either a universal expression promoter (CBh) or a CNS-specific promoter (GFAP or hSyn1). Figure 2A Compare CNS transduction results between the variant AAV capsid proteins identified in rounds 2 and 3. Figures 2B-2D This shows enhanced CNS transduction results for the variant AAV capsid protein identified in round 3 compared to WT AAV9, where expression is mediated by the CBh promoter ( Figure 2B hSyn1 promoter ( Figure 2C ) and GFAP promoter ( Figure 2D )drive. Figures 2B-2D The “X” mark in the text has a capsid containing the motif X1X2X3X4VX5I (SEQ ID NO: 1) inserted between positions 588 and 589 of VP1.

[0119] Figure 3 This demonstrates CNS transduction and transgenic expression in non-human primates via intravenous administration of AAV9 particles or AAV particles containing either an exemplary variant of AAV9 capsid protein (SEQ ID NO: 75; capsid variant 1) with the TTMGVYI peptide inserted between positions 588 and 589 of VP1, or an exemplary variant of AAV9 capsid protein (SEQ ID NO: 67; capsid variant 2) with the PQPGTMR peptide inserted between positions 588 and 589 of VP1. Each capsid is packaged with a CAG-driven FLAG-tagged mCherry transgenic package. Figure 3 This is a dot plot showing the mRNA expression of the mCherry transgene in the frontal cortex of animals administered the corresponding AAV particles.

[0120] Figures 4A-4F This demonstrates CNS transduction and transgenic expression in nonhuman primates after intravenous administration of AAV9 particles or AAV particles containing an exemplary variant of the AAV9 capsid protein (SEQ ID NO: 75; capsid variant 1) with an insertion of the TTMGVYI peptide between positions 588 and 589 of VP1. Each capsid was packaged with a CAG-driven FLAG-tagged mCherry transgenic package. Figure 4A It is a dot map showing the distribution of the vector genome in the CNS tissues and liver of animals that have been administered the corresponding AAV particles. Figure 4B This is a dot plot showing the mRNA expression of the mCherry transgene in the CNS tissues and liver of animals administered the corresponding AAV particles. LH represents the left hemisphere. SC represents the spinal cord. Figures 4C-4D Black and white images of mCherry in the CNS tissues of animals that were administered the corresponding AAV particles. Figure 4D ) and grayscale ( Figure 4C The results of immunohistochemical (IHC) staining. Figures 4E-4F Black and white images of mCherry cells in the frontal cortex and thalamus of animals administered the corresponding AAV particles. Figure 4F ) and grayscale ( Figure 4E The results of immunohistochemical (IHC) staining.

[0121] Figures 5A-5E CNS transduction and transgenic expression in nonhuman primates, as measured by immunofluorescence (IF) assay, are shown in nonhuman primates that have been intravenously administered AAV9 particles or AAV particles containing an exemplary variant of the AAV9 capsid protein (SEQ ID NO: 75; capsid variant 1) with an insertion of the TTMGVYI peptide between positions 588 and 589 of VP1. Each capsid is packaged with CAG-driven FLAG-labeled mCherry transgenic material. Figure 5A This shows the results of immunofluorescence assays on cerebral cortex sections. Figure 5B This shows the results of immunofluorescence assays on thalamic sections. Figure 5C This shows the results of immunofluorescence assays on cerebellar slices. Figure 5D It is a bar graph that shows the quantitative efficiency of neuronal transduction based on double IF staining as described above. Figure 5E It is a bar graph showing the quantitative efficiency of non-neuronal transduction based on IF staining as described above.

[0122] Figures 6A-6C The diagram shows AAV particles containing an exemplary variant of the AAV9 capsid protein, having a TTMGVYI peptide (SEQ ID NO: 75; capsid variant 1) inserted between positions 588 and 589 of VP1, as well as the manufacturing process yield and purity of the AAV9 particles. Figure 6A Display volumetric yield; Figure 6B Displays the yield of each downstream manufacturing process; and Figure 6C The purity of the manufacturing process yield of AAV9 capsid protein (SEQ ID NO: 75; capsid variant 1) and AAV9 particles with TTMGVYI peptide is shown, as measured by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS PAGE) of VP1, VP2 and VP3 proteins.

[0123] definition In this application, unless the context clearly specifies otherwise, (i) the term “a / an” may be understood to mean “at least one / an”; (ii) the term “or” may be understood to mean “and / or”; (iii) the terms “comprising” and “including” may be understood to cover the listed components or steps, whether presented alone or together with one or more other components or steps; and (iv) the terms “about” and “approximately” may be understood to allow standard deviations as understood by one of ordinary skill in the art; and (v) where a scope is provided, endpoints are included.

[0124] 5' and 3': The terms "5'" and "3'" are relative terms defining the spatial relationship or directionality between two or more segments of a nucleic acid sequence. Therefore, the 3' of a nucleic acid indicates a segment downstream of another segment, while the 5' indicates a segment upstream of another segment. For example, 3' can indicate a segment in the 3' half of a nucleic acid sequence or even at the 3' end of the sequence. Similarly, 5' can indicate a segment in the 5' half of a nucleic acid sequence or even at the 5' end of the sequence. Unless otherwise specified, the directionality of the nucleic acid will be in the 5' to 3' direction of translation.

[0125] Approximately or about: As used herein, the terms “approximately” or “about” with respect to numbers are generally used to include numbers that fall within the range of 5%, 10%, 15%, or 20% in either direction (greater than or less than), unless otherwise stated or clearly indicated from the context (unless such numbers would be less than 0% or more than 100% of the possible value).

[0126] Adeno-associated virus (AAV): As used in this article, the terms "adeno-associated virus" and "AAV" refer to all or part of the parvovirus (AAV). Parvoviridae ) family and dependent parvovirus ( Dependoparvovirus AAV (Anaerobic Av) is a small, replication-defective, non-enveloped virus. AAV includes, but is not limited to, AAV serotypes 1, 2, 3 (including serotypes 3A and 3B), 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, snake AAV, avian AAV, bovine AAV, canine AAV, horse AAV, sheep AAV, goat AAV, shrimp AAV, non-human primate AAV (e.g., from rhesus monkeys), and any variants of the foregoing. Wild-type AAV is replication-defective and requires co-infection of cells with helper viruses (e.g., adenovirus, herpesvirus, or vaccinia virus, such as Ad2 or Ad5 virus) or supplementation with helper virus genes for replication.

[0127] Ad2 Support:As used herein, the term "Ad2 helper" refers to adenovirus serotype 2 (Ad2) helper viruses (e.g., wild-type or recombinant engineered Ad2 helper viruses) and various Ad2 helper genes and / or Ad2 helper peptides or nucleic acids, including but not limited to E1a, E1b, E2a, E4Orf6, VA RNA, and any variants or fragments of any of the foregoing. In some embodiments, the Ad2 helper vector (e.g., plasmid) encodes an Ad2 helper peptide or nucleic acid (e.g., one, two, three, or four of E1 (e.g., E1a and / or E1b), E2a, E4, or VA RNA) necessary for the generation of functional rAAV particles. In some embodiments, the Ad2 helper vector is transfected into an E1 complementary cell line (e.g., HEK293). The nucleotide sequences of the Ad2 helper vector and the Ad2 helper virus genes may be derived from the adenovirus 2 genome (GenBank accession number J01917.1).

[0128] Ad5 Support: As used herein, the term "Ad5 helper" refers to adenovirus serotype 5 (Ad5) helper viruses (e.g., wild-type or recombinant engineered Ad5 helper viruses) and various Ad5 helper genes and / or Ad5 helper peptides or nucleic acids, including but not limited to E1a, E1b, E2a, E4Orf6, and / or VA RNA. In some embodiments, the Ad5 helper vector (e.g., plasmid) encodes an Ad5 helper peptide or nucleic acid (e.g., one, two, three, or four of E1 (e.g., E1a and / or E1b), E2a, E4, or VA RNA) necessary for the generation of functional rAAV particles. In some embodiments, the Ad5 helper vector is transfected into an E1 complementary cell line (e.g., HEK293). The nucleotide sequences of the Ad5 helper vector and Ad5 helper genes may be derived from the adenovirus 5 genome (GenBank accession number AY601635).

[0129] Application: As used herein, the term "administration" refers to administering a composition comprising rAAV particles as described herein to a subject. Administration can be performed via any suitable route. For example, in some embodiments, administration can be local or systemic (e.g., administration to mammals, such as humans, such as patients). The compositions of this disclosure can be administered via injection or infusion via any route. For example, the compositions can be administered via retinal, subretinal, intravitreal, suprachoroidal, intraspinal, intracerebellomedullary cistern, or intrathecal injection or infusion. Other exemplary routes of administration may include, but are not limited to, bronchial (e.g., bronchial infusion), oral cavity, enterum, intradermal, intraarterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intravenous, intraventricular, mucosal, nasal, oral, rectal, subcutaneous, sublingual, local, tracheal (e.g., intratracheal infusion), transdermal, vaginal, and intravitreal.

[0130] bioreactor As used herein, the term "bioreactor" refers to any container used for the growth of cell cultures (e.g., mammalian cell cultures). A bioreactor can be of any size and / or any shape, as long as it is suitable for culturing cell cultures (e.g., mammalian cell cultures).

[0131] Cap peptides: As used herein, the term "Cap polypeptide" refers to a structural protein that forms a functional AAV capsid, which sequentially packages DNA and infects or transduces target cells. In some embodiments, the Cap polypeptide comprises a variant AAV capsid as disclosed herein. In some embodiments, the Cap polypeptide will comprise all AAV capsid subunits, but fewer than all capsid subunits may be present as long as a functional capsid is produced. In some embodiments, the nucleic acid sequence encoding the Cap polypeptide will be present on a single vector (e.g., a plasmid). In some embodiments, the Cap polypeptide comprises AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10 Cap polypeptide, or a variant of any of the foregoing. AAV capsid genes and proteins have been described, for example, by Knipe DM. et al., (2001). Fields Virology 6(1), the references are incorporated herein by way of citation.

[0132] Cell density As used herein, the term "cell density" refers to the number of cells present in a given volume of culture medium or in a given surface area. For example, cell density can be expressed as viable cells (vc) / cm³. 2 Culture medium or vc / mL.

[0133] Corresponding toAs used herein, the term "corresponds to" can be used to designate the position or identity of a structural element in a compound or composition by comparison with a suitable reference compound or composition. For example, in some embodiments, monomeric residues in a polymer (e.g., amino acid residues in a polypeptide or nucleic acid residues in a polynucleotide) may be identified as "corresponding to" residues in a suitable reference polymer. For example, those skilled in the art will understand that residues in a provided polypeptide or polynucleotide sequence are typically designated according to a scheme of reference sequence (e.g., numbered or labeled) (even if such designation does not, for example, reflect the literal numbering of the provided sequence). To illustrate, if a reference sequence includes a specific amino acid motif at positions 100-110, and a second related sequence includes the same motif at positions 110-120, then the motif position of the second related sequence may be said to "correspond to" positions 100-110 of the reference sequence. Those skilled in the art will understand that corresponding positions can be easily identified, for example, by sequence alignment, and such alignments are typically performed using any of a variety of known tools, strategies, and / or algorithms, including but not limited to software programs such as BLAST, CS-BLAST, CUDASW++, DIAMOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, Hhpred / Hhsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM, or SWIPE. Two sequences can be identified as corresponding if they are identical or if they share substantial identity (e.g., at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 or more) units (e.g., nucleotides or amino acids) in length.

[0134] Culture: As used herein, the terms “culture” and “cell culture” refer to a population of cells (e.g., a population of eukaryotic cells) suspended in or covered by a culture medium under conditions suitable for the survival and / or growth of the cell population. As will be apparent to those skilled in the art, these terms may also refer to a combination comprising a cell population and a culture medium.

[0135] Excerpt: As used herein, the terms "fragment" or "part" refer to a structure that includes a discrete portion of the whole but lacks one or more parts present in the whole structure. In some embodiments, a fragment consists of such discrete portions. In some embodiments, a fragment consists of or contains characteristic structural elements or parts present in the whole. In some embodiments, the nucleotide fragment comprises or is composed of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more monomeric units (e.g., nucleic acids) present in the whole nucleotide. In some embodiments, the nucleotide fragment comprises or is composed of at least about 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of monomeric units (e.g., residues) present in the whole nucleotide. In some embodiments, the entire material or entity may be referred to as the whole “parent”.

[0136] Gene: As used herein, the term "gene" refers to a DNA sequence that encodes a product (e.g., an RNA product and / or a polypeptide product). In some embodiments, a gene includes a coding sequence (i.e., a sequence that encodes a specific product). In some embodiments, a gene includes a non-coding sequence. In some specific embodiments, a gene may include both coding sequences (e.g., exons) and non-coding sequences (e.g., introns). In some embodiments, a gene may include one or more regulatory elements that, for example, control or enable one or more aspects of gene expression (e.g., inducible expression, etc.).

[0137] Gene therapyAs used herein, the term "gene therapy" refers to the insertion or deletion of a specific genomic DNA sequence to treat or prevent a condition or disease for which such therapy is sought. In some embodiments, the insertion or deletion of the genomic DNA sequence occurs in specific cells (e.g., target cells). Target cells may be derived from mammals and / or may be cells of a mammalian subject. Mammals include, but are not limited to, humans, dogs, cats, cattle, sheep, pigs, llamas, etc. In some embodiments, heterologous DNA is transferred to the target cells. The heterologous DNA may be introduced into the selected target cells in a manner that allows the heterologous DNA to be expressed and to produce a therapeutic product encoded therefrom. In addition to or alternatively, the heterologous DNA may mediate the expression of DNA encoding a therapeutic product in some way, or it may encode a product, such as a polypeptide or RNA, that directly or indirectly mediates or regulates the expression of the therapeutic product in some way. Gene therapy may also be used to deliver nucleic acids encoding gene products that replace defective genes or supplement gene products produced by the mammal or cell to which they are introduced. The heterologous DNA encoding a therapeutic product may be modified prior to introduction into diseased host cells to enhance or otherwise alter the product or its expression. Gene therapy may also include the delivery of repressors or inhibitors or other regulators of gene expression. Such repressors or inhibitors or other regulators may be polypeptides, peptides, or nucleic acids (e.g., DNA or RNA). Gene therapy may include in vivo or ex vivo techniques. In some embodiments, viral and nonviral gene transfer methods may be used to introduce nucleic acids encoding polypeptides of interest or to introduce therapeutic nucleic acids into mammalian cells or target tissues. Nonviral vector delivery systems include DNA plasmids, naked nucleic acids, and nucleic acids complexed with delivery media such as poloxamer or liposomes. Viral vector delivery systems include DNA and RNA viruses that have an appended or integrated genome after delivery to cells. For a review of gene therapy procedures, see Anderson WF., (1992). Science 256(5058): pp. 808-813; Miller AD., (1992) Nature 357(6378): pp. 455-460; Feuerbach FJ et al., (1996) Kidney Int. 49(6): pp. 1791-1794; Urnov FD. et al., (2010) Nat. Rev Genet. 11(9): pp. 636-646; and Collins M. et al., (2015) Proc Biol Sci. 282(1821), each of the references is incorporated herein by reference in its entirety.

[0138] Host cell:As used herein, the term "host cell" refers to a cell in which exogenous DNA (recombinant or otherwise) has been introduced. Those skilled in the art will understand upon reading this disclosure that such a term refers not only to a specific test cell but also to its offspring. Because certain modifications may occur in offspring due to mutations or environmental influences, these offspring may actually differ from the parent cell but are still included within the scope of the term "host cell" as used herein. In some embodiments, the host cell includes prokaryotic and eukaryotic cells selected from any living organism suitable for expressing exogenous DNA (e.g., recombinant nucleic acid sequences).

[0139] Identity: As used herein, the term "identity" refers to the overall relevance between polymer molecules (e.g., between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules)) and / or polypeptide molecules. In some embodiments, polymer molecules are considered "substantially identical" to each other if their sequences are at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. For example, the percentage of identity between two nucleic acid or polypeptide sequences can be calculated by aligning the two sequences for optimal comparison purposes (e.g., vacancies can be introduced in one or both of the first and second sequences for optimal alignment, and dissimilar sequences can be ignored for comparison purposes). In some embodiments, the sequence length aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the reference sequence length. Nucleotides at corresponding positions are then compared. The molecules are identical at that position when a position in the first sequence is occupied by the same residue (e.g., a nucleotide or amino acid) as the corresponding position in the second sequence. The percentage of identity between two sequences is a function of the number of common positions in the sequences, taking into account the number of vacancies and the length of each vacancy, which needs to be incorporated for optimal alignment of the two sequences. Sequence comparison and determination of the percentage of identity between two sequences can be accomplished using mathematical algorithms. For example, the Meyers and Miller algorithm (CABIOS, 1989, 4: 11-17) can be used to determine the percentage of identity between two nucleotide sequences, which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons performed using the ALIGN program use a PAM120 weighted residue table, a 12-vacancy length penalty, and a 4-vacancy penalty. Alternatively, the GAP program in the GCG software package can be used, employing the NWSgapdna.CMP matrix to determine the percentage of identity between two nucleotide sequences.

[0140] improve , Increase, inhibit or reduce: As used herein, the terms “improvement,” “increase,” “inhibit,” “reduction,” or their grammatical equivalents indicate a value relative to a baseline or other reference measurement. In some embodiments, an appropriate reference measurement may be or include a measurement in a particular system (e.g., in a single sample, such as a culture medium) under conditions where a particular agent or treatment is absent (e.g., before and / or after) or in the presence of an appropriate comparable reference agent. In some embodiments, an appropriate reference measurement may be or include a measurement in a comparable system known or expected to respond in a particular manner in the presence of a relevant agent or treatment.

[0141] Culture medium: As used herein, the terms “medium,” “culture medium,” and “growth medium” refer to solutions containing nutrients to nourish cells (e.g., growing cells, such as eukaryotic cells). Typically, these solutions provide essential and non-essential amino acids, vitamins, energy, lipids, and trace elements required for cell survival and / or minimum growth. Solutions may also contain components that enhance survival and / or growth above the minimum rate, including hormones and growth factors. Solutions may be formulated to provide the optimal pI and concentration of one or more salts for cell survival and / or proliferation. For example, a culture medium may also be a “component-defined medium” or a “chemically defined medium,” such as a serum-free medium that does not contain proteins, hydrolysates, or components of unknown composition. Component-defined media do not contain animal-derived components, and all components have known chemical structures. Those skilled in the art will understand that component-defined media may contain recombinant peptides, such as, but not limited to, hormones, cytokines, interleukins, and / or other signaling molecules.

[0142] CNS-targeted components:As used herein, the phrase “CNS-targeting fraction” refers to a peptide that effectively targets central nervous system (CNS) cells and / or tissues (e.g., cells or tissues present in the brain, spinal cord, or CNS system). In some embodiments, the CNS-targeting fraction can target CNS cells or tissues by: (i) contacting CNS cells or tissues (e.g., binding to one or more receptors expressed on CNS cells or tissues); (ii) contacting cells that have contacted CNS cells or tissues (e.g., binding to one or more receptors expressed on cells that have contacted CNS cells or tissues); (iii) delivering a payload to CNS cells or tissues; or (iv) any combination of (i)-(iii). In some embodiments, CNS cells or tissues include: CNS epithelial cells, nerve cells, CNS connective tissue cells, stem cells, progenitor cells, CNS immune cells, spinal cord cells, cells lining one or more ventricles, neural support cells, glial cells, adipocytes, meningeal cells, or combinations thereof. In some embodiments, the CNS tissue includes tissues found in the following: cortex, thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, deep cerebellar nuclei, or other parts of the brain and / or spinal cord. In some embodiments, the CNS targeting portion may be conjugated or fused with a payload. In some embodiments, the CNS targeting portion may be incorporated into a vector, such as a viral or non-viral vector. In some embodiments, the CNS targeting portion may be inserted into an AAV capsid to form a variant AAV capsid as disclosed. Nucleic acid:The term “nucleic acid” includes any nucleotide, its analogues, and their polymers. As used herein, the term “polynucleotide” refers to a polymer of nucleotides of any length, ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of a molecule and therefore include double-stranded and single-stranded DNA as well as double-stranded and single-stranded RNA. These terms include RNA or DNA analogues made from nucleotide analogues and modified polynucleotides (such as, but not limited to, methylated, protected, and / or capped nucleotides or polynucleotides) as equivalents. The term covers polynucleotides or oligonucleotides (RNA) and polydeoxynucleotides or oligodeoxynucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleotides and / or modified nucleotides; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified phosphorus bridges (also referred to herein as “nucleotide internucleotide bonds”). This term encompasses nucleic acids containing any combination of nucleotides, modified nucleotides, sugars, modified sugars, phosphate bridges, or modified phosphorus bridges. Examples include, but are not limited to, nucleic acids containing a ribose moiety, nucleic acids containing a deoxyribose moiety, nucleic acids containing both a ribose and a deoxyribose moiety, and nucleic acids containing a ribose and a modified ribose moiety. In some embodiments, the prefix "poly" refers to nucleic acids containing 2 to about 10,000, 2 to about 50,000, or 2 to about 100,000 nucleotide monomer units. In some embodiments, the prefix "oligo" refers to nucleic acids containing 2 to about 200 nucleotide monomer units. According to the methods and compositions described herein, in some embodiments, the RNA includes short hairpin RNA (shRNA), small interfering RNA (siRNA), mRNA, snRNA, CRISPR / Cas guide RNA, microRNA (miRNA), and / or its precursors.

[0143] Payload:As used herein, the term "payload" refers to a target nucleic acid sequence (e.g., a sequence encoding a target payload, such as a target peptide or RNA) intended to be introduced into cells, tissues, organs, organisms, and / or systems containing cells. The target payload can be a heterologous protein with therapeutic purposes, such as an enzyme or antibody. The target payload can also be a heterologous nucleic acid with therapeutic purposes, such as miRNA, siRNA, shRNA, mRNA, snRNA, or CRISPR / Cas guide RNA or a precursor thereof. Those skilled in the art will recognize that the target payload can be selected from any heterologous protein or nucleic acid of interest. As used herein, "encodes" means to guide expression or processing. For example, as used herein, if a nucleic acid guides the expression of a peptide sequence, then the nucleic acid encodes that peptide sequence. Similarly, as used herein, if a nucleic acid precursor (e.g., pri-miRNA or pre-miRNA) is processed into a further processed form, then it encodes a further processed form of the nucleic acid (e.g., mature miRNA).

[0144] Pharmaceutical composition:As used herein, the term "pharmaceutical composition" refers to a composition comprising rAAV particles suitable for administration to human or animal subjects. In some embodiments, the pharmaceutical composition comprises an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose suitable for administration in a treatment regimen. In some embodiments, the treatment regimen comprises one or more doses administered according to a schedule determined to achieve the desired therapeutic effect (e.g., by statistically significant probability) when administered to subjects or populations in need. The pharmaceutical composition may be specifically formulated for administration in solid or liquid form. In some embodiments, the pharmaceutical composition is formulated for administration via parenteral administration, such as by subcutaneous, intramuscular, intravenous, or epidural injection. In some embodiments, the pharmaceutical composition is formulated as a sterile solution or suspension, such as in a sustained-release formulation. The pharmaceutical compositions of this disclosure may be formulated for administration by injection or infusion (e.g., subcutaneous, intramuscular, intravenous, or epidural injection or infusion). For example, the composition may be formulated for administration via retinal, subretinal, intravitreal, suprachoroidal, intraspinal, intracerebellomedullary cistern, or intrathecal injection or infusion. In some embodiments, the pharmaceutical composition is intended and suitable for administration to human subjects. In some embodiments, the pharmaceutical composition is substantially free of contaminants (e.g., sterile and substantially pyrogen-free). Formulations of the pharmaceutical composition may include, but are not limited to, formulations for the following applications: oral administration, such as infusions (aqueous or non-aqueous solutions or suspensions), tablets (e.g., targeted for oral, sublingual, and systemic absorption), pills, powders, granules, pastes for administration to the tongue; topical applications, such as creams, ointments, or controlled-release patches or sprays applied to the skin, lungs, or mouth; intravaginal or rectal, such as as vaginal suppositories, creams, or foams; sublingual; ocular; transdermal; or nasal, lung, and other mucosal surfaces.

[0145] polypeptide:As used herein, the term "peptide" generally has its recognized meaning in the art as a polymer of at least three amino acids. Those skilled in the art will understand that the term "peptide" is intended to be sufficiently general to encompass not only peptides having the complete sequence described herein, but also peptides representing functional fragments of such complete peptides (e.g., fragments retaining at least one active component). Furthermore, those skilled in the art will understand that protein sequences generally tolerate some substitutions without destroying activity. Therefore, any peptide that retains activity and shares at least about 30%-40% total sequence identity with another peptide of the same class, typically greater than about 50%, 60%, 70%, or 80%, and further typically includes at least one region with much higher identity, typically greater than 90% or even 95%, 96%, 97%, 98%, or 99%, typically encompassing at least 3-4 amino acids and typically up to 20 or more amino acids, is covered by the relevant term "peptide" as used herein. Peptides may contain L-amino acids, D-amino acids, or both, and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, and methylation. In some embodiments, the protein may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof. The term "peptide" is generally used to refer to polypeptides with a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids.

[0146] Recombinant: As used herein, the term "recombinant" means a polypeptide designed, engineered, prepared, expressed, produced, manufactured, and / or isolated by recombinant means, such as a polypeptide expressed using a recombinant expression vector transfected into a host cell; a polypeptide isolated from a recombinant, combined human polypeptide library; a polypeptide isolated from an animal (e.g., a mouse, rabbit, sheep, fish, etc.) that is transgenic or otherwise manipulated to express one or more genes or genomic molecules encoding and / or directing the expression of the polypeptide or one or more components, portions, elements, or domains thereof; and / or a polypeptide prepared, expressed, produced, or isolated by any other means involving splicing or linking selected nucleic acid sequence elements to each other, chemically synthesizing the selected sequence elements, and / or otherwise generating nucleic acids encoding and / or directing the expression of the polypeptide or one or more components, portions, elements, or domains thereof. In some embodiments, one or more of such selected sequence elements are present in nature. In some embodiments, one or more of such selected sequence elements are designed in a computer. In some embodiments, one or more such selected sequence elements are generated by mutagenesis (e.g., in vivo or in vitro) of a known sequence element, such as from a natural or synthetic source, such as in a lineage of the source organism of interest (e.g., human, mouse, etc.).

[0147] Recombinant AAV (rAAV) particles: As used herein, “recombinant AAV particle” or “rAAV particle” refers to an infectious, replication-defective viral particle containing an AAV protein shell encapsulating a payload, which is flanked by ITRs. AAV particles are generated in suitable host cells (e.g., HEK293 cells). For example, host cells are transfected with at least one vector encoding one or more helper peptides and nucleic acids (e.g., Ad2 helper peptide and nucleic acid), at least one Rep peptide, at least one Cap peptide, and at least one payload (e.g., for peptide expression or therapeutic nucleic acid), enabling the host cells to produce the Rep and Cap peptides necessary for packaging rAAV particles. rAAV particles can be used for subsequent gene delivery.

[0148] Rep peptide: As used herein, the term "Rep polypeptide" refers to a non-structural AAV protein that mediates AAV replication to produce AAV particles. AAV replication genes and proteins have been described, for example, in Knipe 2001, which is incorporated herein by reference in its entirety.

[0149] Vaccination: As used herein, the term "inoculation" refers to the process of providing a cell culture to a container (e.g., a bioreactor or culture flask). For example, the process of providing a cell culture may include proliferating the cells in another bioreactor or container prior to providing them to the bioreactor or other container. Cells may be frozen and thawed just before being provided to the bioreactor or container. The term "inoculation" refers to providing any number of cells, including single cells.

[0150] Subjects:As used herein, the term "subject" refers to an organism, such as a mammal (e.g., human, non-human mammal, non-human primate, primate, laboratory animal, mouse, rat, hamster, gerbil, cat, dog). In some embodiments, the human subject is an adult, adolescent, or pediatric subject. In some embodiments, the subject suffers from a disease, condition, or disorder, such as a disease, condition, or disorder that can be treated as provided herein, such as neurological diseases or conditions, or cancers or tumors listed herein. In some embodiments, the subject is susceptible to a disease, condition, or disorder; in some embodiments, susceptible subjects tend to and / or exhibit an increased risk of developing a disease, condition, or disorder (compared to the average risk observed in a reference subject or population). In some embodiments, the subject exhibits one or more symptoms of a disease, condition, or disorder. In some embodiments, the subject does not exhibit a specific symptom (e.g., clinical manifestations of a disease) or characteristic of a disease, condition, or disorder. In some embodiments, the subject does not exhibit any symptoms or characteristic of a disease, condition, or disorder. In some embodiments, the subject is a patient. In some implementations, the subject is an individual to whom and / or to whom a diagnosis and / or therapy has been administered.

[0151] Titer: As used herein, the term "titer" refers to the amount of virus in a given volume. For example, titer may be expressed as viral genome copies (vg) per given volume or plaque-forming units (pfu) per given volume. In some embodiments, titer may be expressed as the number of capsids per given volume.

[0152] Transfection: As used herein, the term "transfection" refers to the introduction of nucleic acid molecules (such as DNA or RNA molecules (e.g., mRNA)) into cells (such as eukaryotic cells (e.g., mammalian cells)). For example, transfection may include vector-based transfection, virus-based transfection, electroporation, lipid transfection (e.g., with cationic lipids and / or liposomes), calcium phosphate precipitation, nanoparticle-based transfection, and / or cationic polymer-based transfection (e.g., DEAE-glucan or polyethyleneimine). In some embodiments, virus-based transfection is also referred to herein as transduction.

[0153] treat:As used herein, the term “treatment” means providing treatment, such as providing any type of medical or surgical management to a subject. Treatment may be provided to reverse, alleviate, or inhibit the progression of a disease, condition, or disorder, prevent or reduce the likelihood of a disease, condition, or disorder, or to reverse, alleviate, inhibit, or prevent the progression of one or more symptoms or manifestations of a disease, condition, or disorder, or to prevent or reduce the likelihood of one or more symptoms or manifestations of a disease, condition, or disorder. “Prevention” means preventing the occurrence of a disease, condition, disorder, or symptom or manifestation of it in at least some individuals for at least a period of time. Treatment may include administering an agent to a subject after the development of one or more symptoms or manifestations of a disorder, disease, or condition, for example, to reverse, alleviate, or reduce the severity of the disorder and / or inhibit or prevent the progression of the disorder and / or reverse, alleviate, or reduce the severity of one or more symptoms or manifestations of the disorder and / or inhibit one or more symptoms or manifestations of the disorder. Compositions comprising rAAV particles of this disclosure may be administered to subjects who have already developed a disease or who have an increased risk of developing such a disease relative to members of the general population. Compositions of this disclosure may be administered prophylactically or prior to the development of any symptoms or manifestations of a disease. Typically, in such cases, the subject would be at risk of developing a disease.

[0154] Variants:As used herein, in the context of molecules (e.g., nucleic acids or peptides), the term "variant" refers to a molecule that exhibits significant structural identity with a reference molecule but differs structurally from the reference molecule, for example, in the presence or absence or level of one or more chemical motifs compared to the reference entity. In some embodiments, the variant is also functionally different from its reference molecule. Generally, whether a particular molecule is properly considered a "variant" of a reference molecule is based on the degree of its structural identity with the reference molecule. As those skilled in the art will understand, any biological or chemical reference molecule has certain characteristic structural elements. By definition, a variant is a different molecule that shares one or more such characteristic structural elements but differs from the reference molecule in at least one respect. To name just a few examples, a peptide may have characteristic sequence elements comprising a plurality of amino acids that are positioned relative to each other in linear or three-dimensional space and / or contribute to a particular structural motif and / or biological function; a nucleic acid may have characteristic sequence elements comprising a plurality of nucleotide residues that are positioned relative to each other in linear or three-dimensional space. In some embodiments, variant peptides or nucleic acids may differ from reference peptides or nucleic acids due to one or more differences in the amino acid or nucleotide sequence and / or one or more differences in the chemical portions (e.g., carbohydrates, lipids, phosphate groups) that are covalent components of the peptide or nucleic acid (e.g., attached to the peptide or nucleic acid backbone). In some embodiments, variant peptides or nucleic acids exhibit at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99% overall sequence identity with reference peptides or nucleic acids. In some embodiments, variant peptides or nucleic acids do not share at least one characteristic sequence element with reference peptides or nucleic acids. In some embodiments, reference peptides or nucleic acids have one or more biological activities. In some embodiments, variant peptides or nucleic acids share one or more biological activities of reference peptides or nucleic acids. In some embodiments, variant peptides or nucleic acids lack one or more biological activities of reference peptides or nucleic acids. In some embodiments, variant peptides or nucleic acids exhibit reduced levels of one or more biological activities compared to reference peptides or nucleic acids. In some embodiments, a polypeptide or nucleic acid of interest is considered a “variant” of a reference polypeptide or nucleic acid if it has the same amino acid or nucleotide sequence as a reference polypeptide or nucleic acid, but with minor sequence changes at specific positions. Typically, compared to the reference, the variant has fewer than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of residues substituted, inserted, or deleted. In some embodiments, the variant polypeptide or nucleic acid contains about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 substituted residue compared to the reference.Typically, compared to a reference, the variant polypeptide or nucleic acid contains a very small number (e.g., less than about 5, about 4, about 3, about 2, or about 1) of substituted, inserted, or deleted functional residues (i.e., residues involved in a specific biological activity). In some embodiments, the variant polypeptide or nucleic acid contains no more than about 5, about 4, about 3, about 2, or about 1 addition or deletion compared to the reference, and in some embodiments, no addition or deletion is included. In some embodiments, compared to the reference, the variant polypeptide or nucleic acid contains less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, or about 6 additions or deletions, and typically less than about 5, about 4, about 3, or about 2 additions or deletions. In some embodiments, the reference polypeptide or nucleic acid is a polypeptide or nucleic acid found in nature.

[0155] Carrier: As used herein, the term "vector" refers to a molecule containing nucleic acid molecules, wherein the vector is capable of transporting the nucleic acid molecules into a cell. As a non-limiting example, one type of vector is a "plasmid," which refers to a circular double-stranded DNA loop capable of linking to an additional DNA segment. Another type of vector is a viral vector, wherein an additional DNA segment can be packaged into a viral capsid and transferred to another cell and / or organism. Some vectors are capable of autonomous replication in the host cell to which they are introduced (e.g., bacterial vectors with bacterial origins of replication and attached mammalian vectors). Other vectors (e.g., non-attached mammalian vectors) can integrate into the host cell's genome upon introduction and thereby replicate along with the host genome. Furthermore, some vectors are capable of directing the expression of genes operatively linked to them. Such vectors are referred to herein as "expression vectors."

[0156] Standard techniques can be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipid transfection). Enzymatic reactions and purification techniques can be performed according to the manufacturer's instructions or as commonly practiced in the art or as described herein. The foregoing techniques and procedures can generally be performed according to conventional methods well known in the art and as described in the various general and more specific references cited and discussed throughout this specification. See, for example, Sambrook J. et al., (1989) Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory Press In the second edition, the cited references are incorporated herein by reference in their entirety.

[0157] VPAs used herein, the term "VP" refers to a variant or fragment of the AAV VP1 capsid protein, the AAV VP2 capsid protein, the AAV VP3 capsid protein, or any of the foregoing, or a combination thereof. The term "capsid protein" is used interchangeably with VP herein. The numbering used herein to describe exemplary positions of peptide insertions in VP1, VP2, or VP3 is relative to the AAV VP1 number. For example, VP1, VP2, and VP3 of the AAV9 capsid protein correspond to amino acids 1 to 736, 138 to 736, and 203 to 736 of VP1, respectively. Therefore, reference to a peptide insertion between positions 588 and 589 in an AAV capsid variant refers to positions 588 and 589 in VP1, VP2, or VP3 relative to the VP1 number. Those skilled in the art will be able to readily determine the corresponding positions in VP2 and VP3, for example, by comparing the sequences of parental AAV capsid proteins VP1, VP2, and VP3 using methods known in the art, such as sequence alignment. In some embodiments, the VP capsid protein is the VP1 capsid protein. In some embodiments, the VP capsid protein is the VP2 capsid protein. In some embodiments, the VP capsid protein is the VP3 capsid protein. In some embodiments, the VP protein includes the peptide insertions disclosed herein.

[0158] Variant AAV capsid protein As used herein, the term “variant AAV capsid protein” refers to a VP capsid protein (e.g., VP1, VP2, or VP3) that includes a peptide insertion relative to the corresponding parental AAV capsid protein (e.g., parental VP1, VP2, or VP3). Detailed Implementation

[0159] This disclosure specifically provides improved recombinant adeno-associated virus (rAAV) particles that can be used to target cells or tissues, such as CNS cells and / or tissues. Delivering safe and effective therapeutic payloads to CNS cells and / or tissues remains a major challenge in gene therapy. Recombinant adeno-associated virus (rAAV) has emerged as one of the most promising vectors for in vivo gene therapy and is currently undergoing clinical evaluation for many conditions, including CNS disorders. However, naturally occurring AAV capsids suboptimally target CNS cells or tissues and require extremely high doses to achieve minimally effective transgene expression. This presents significant manufacturing challenges and safety concerns.

[0160] This disclosure is based in part on the finding that AAV CNS cell and / or tissue tropism can be achieved by inserting a short peptide into an AAV capsid to guide the AAV capsid to CNS cells and / or tissues. In some embodiments, rAAV particles comprising a variant capsid having the peptide insert disclosed herein bind to and / or recognize targets on CNS cells and / or tissues. Without wishing to be bound by any particular theory, in some embodiments, rAAV particles comprising a variant capsid containing the peptide insert disclosed herein can enhance carrier attachment, internalization, and / or payload expression in CNS cells and / or tissues.

[0161] AAV9 Adeno-associated virus (AAV) belongs to Parvovirus A small, non-enveloped, single-stranded DNA (ssDNA) virus. At least twelve different AAV serotypes have been identified from human and non-human primate sources (see DiMattia MA et al., (2012)). J. Virology 86(12): Pages 6947-6958, the entire contents of which are incorporated herein by reference (hereinafter referred to as "DiMattia 2012"). AAV9 is one of the human AAV serotypes, which has enhanced transduction efficiency in cardiac and skeletal muscle, liver tissue, pancreatic tissue and eye compared with other serotypes (DiMattia 2012).

[0162] The wild-type AAV genome contains at least three genes: rep , cap and X (Büning H. et al., (2019)) Molecular Therapy: Methods & Clinical Development (Volume 12, pp. 248-265). cap The gene encodes viral proteins VP1, VP2, and VP3, as well as assembly activation protein (AAP). All three VP proteins are capsid monomers.

[0163] cap Gene transcription produces two types of messenger RNA: a messenger RNA encoding VP1 and messenger RNA encoding VP2 and VP3 (e.g., Warrington KH et al., (2004)). Journal of Virology (As described in Volume 78 (12), pp. 6595-6609). VP1, VP2 and VP3 exist in a ratio of 1:1:10. The VP3 region has been observed in all capsid structures of the AAV serotypes studied (DiMattia 2012).

[0164] VP proteins comprise a β-chain, an α-helical region, and a structurally variable region (VR) in a surface loop connecting the β-chain. Without wishing to be bound by any particular theory, it is believed that differences in the sequence and / or conformation of the VR contribute to variability in cell tropism, differences in tissue transduction efficiency, and / or antigen reactivity among different AAV serotypes. In some embodiments, differences in the VR sequence and / or structure between different AAV serotypes allow for differential recognition of cell surface glycans and / or tissue-specific protein or lipid receptor interactions for internalization.

[0165] Wild-type AAV9 (WT AAV9) has nine variable regions: VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII, and VR-IX (DiMattia 2012, see also Table 3 therein). AAV9 VR-I covers amino acid positions 262-269. AAV VR-II covers amino acid positions 327-332 and plays a role, for example, in genome packaging. AAV9 VR-III covers amino acid positions 382-386. AAV9 VR-IV covers amino acid positions 452-460 and plays a role, for example, in liver transduction and / or delayed blood clearance phenotypes. AAV9 VR-V covers amino acid positions 488-505 and plays a role, for example, in LamR receptor binding, liver and / or muscle-specific transduction, and / or delayed blood clearance phenotypes. AAV9 VR-VI covers amino acid positions 527-539 and has effects, for example, in LamR receptor binding and / or delayed blood clearance phenotypes. AAV9 VR-VII covers amino acid positions 545-558 and has effects, for example, in hepatic transduction and / or delayed blood clearance phenotypes. AAV9 VR-VIII covers amino acid positions 581-593 and has effects, for example, in LamR receptor binding and / or transduction. AAV9 VR-IX covers amino acid positions 704-714 and has effects, for example, in cardiac tropism, melanoma tropism, and / or altered tropism.

[0166] In some embodiments, the rAAV particles disclosed herein are recombinant AAV (rAAV) particles. In some embodiments, the rAAV particles comprise a variant AAV9 capsid protein containing the peptide insertion disclosed herein. In some embodiments, the peptide insertion is at any one or all of, or a combination thereof, of the parental AAV capsid protein VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII, and VR-IX.

[0167] In some embodiments, the parental AAV capsid protein comprises the sequence of the wild-type AAV capsid protein, or a sequence having at least 95% identity with the wild-type AAV capsid protein sequence, or a sequence having no more than 20 mutations (e.g., substitutions) compared to the wild-type AAV capsid protein sequence. In some embodiments, the parental AAV capsid protein comprises a sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with the wild-type AAV capsid protein sequence. In some embodiments, the parental AAV capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) compared to the wild-type AAV capsid protein sequence.

[0168] In some embodiments, the parental AAV capsid protein comprises a sequence having at least 95% identity with the wild-type AAV capsid protein (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity) and one or more mutations (e.g., as disclosed herein).

[0169] In some embodiments, one or more mutations include mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, one or more mutations that alter the binding spectrum of the parental AAV capsid protein include mutations that reduce binding to one or more tissues (such as liver tissue), such as liver detargeting mutations. In some embodiments, one or more mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at positions 503, 595, 457, 574, 592, 498, 602, 468, or 500 of the AAV9 capsid protein in VP1 or at corresponding positions in VP2 or VP3, or any combination thereof. In some embodiments, mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include the W503R mutation.

[0170] In some embodiments, the parental AAV capsid protein is different from the AAV9 capsid protein, and contains one or more mutations (e.g., liver detargeting mutations) at positions 503, 595, 457, 574, 592, 498, 602, 468, or 500 of the VP1 of the AAV9 capsid protein, which alter the binding profile of the parental AAV capsid protein.

[0171] In some embodiments, one or more mutations include mutations in the amino acid sequence at or near the glycan-binding region. In some embodiments, one or more mutations reduce glycan binding. In some embodiments, the glycan is galactose.

[0172] In some embodiments, one or more modifications are made at or between the following amino acids: (a) 271 and 272 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (b) 446 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (c) 470 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (d) 501 and 505 of VP1, VP2, or VP3 of the AAV9 capsid protein (e.g., at any one or all of residues 501, 502, 503, 504, or 505, or a combination thereof) or the corresponding position in the capsid protein of another parent AAV capsid protein; (e) (a) VP1, VP2, or VP3 of AAV9 capsid protein at positions 489 and 545 or the corresponding position in the capsid protein of another parent AAV capsid protein; (f) VP1, VP2, or VP3 of AAV9 capsid protein at positions 591 and 621 or the corresponding position in the capsid protein of another parent AAV capsid protein; or (g) any combination or all of (a)-(f).

[0173] In some embodiments, one or more mutations include mutations at the following locations: (a) 271 and 272 of VP1, VP2, or VP3 of the AAV9 capsid protein; (b) 446 of VP1, VP2, or VP3 of the AAV9 capsid protein; (c) 470 of VP1, VP2, or VP3 of the AAV9 capsid protein; (d) 501 and 505 of VP1, VP2, or VP3 of the AAV9 capsid protein (e.g., at any or all of residues 501, 502, 503, 504, or 505, or a combination thereof); (e) 489 and 545 of VP1, VP2, or VP3 of the AAV9 capsid protein; (f) 591 and 621 of VP1, VP2, or VP3 of the AAV9 capsid protein; or (g) any combination or all of (a)-(f).

[0174] In some embodiments, the parental AAV capsid protein includes AAV9 capsid protein, AAV1 capsid protein, AAV2 capsid protein, AAV3B capsid protein, AAV4 capsid protein, AAV5 capsid protein, AAV6 capsid protein, AAV7 capsid protein, AAV8 capsid protein, AAV10 capsid protein, AAV11 capsid protein, AAV12 capsid protein, AAV13 capsid protein, AAVhu68 capsid protein, or AAVrh10 capsid protein.

[0175] In some embodiments, the parental AAV capsid protein includes the AAV9 capsid protein. In some embodiments, the AAV9 capsid protein comprises: the sequence of the wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity with SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some implementations, the AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001.

[0176] In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95% identity with SEQ ID NO: 2001 (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity) and, for example, one or more mutations as disclosed herein.

[0177] In some embodiments, one or more mutations include mutations that alter the binding profile of the parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, one or more mutations that alter the binding profile of the parental AAV capsid protein include mutations that reduce binding to one or more tissues (such as liver tissue), such as liver detargeting mutations. Exemplary mutations including liver detargeting mutations are disclosed in Pulicherla N. et al., (2011). Molecular Therapy Volume 19, pp. 1070-1078, the entire contents of which are cited are incorporated herein by reference.

[0178] In some embodiments, one or more mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at positions 503, 595, 457, 574, 592, 498, 602, 468, or 500 of the AAV9 capsid protein in VP1of, or at corresponding positions in VP2 or VP3, or any combination thereof. In some embodiments, mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at position 503, such as the W503R mutation. In some embodiments, mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at position 595, such as the W595C mutation. In some embodiments, mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at position 457, such as the N457H mutation. In some embodiments, mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at position 574, such as the T574S mutation. In some embodiments, mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at position 592, such as the Q592L mutation. In some embodiments, mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at position 498, such as the N498Y or N498I mutation. In some embodiments, mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at position 602, such as the L602F mutation. In some embodiments, mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at position 468, such as the P468T mutation. In some implementations, mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at position 500, such as the E500D mutation.

[0179] In some embodiments, one or more mutations include mutations in the amino acid sequence at or near the glycan-binding region. In some embodiments, one or more mutations reduce glycan binding. In some embodiments, the glycan is galactose.

[0180] In some embodiments, one or more modifications are made at or between the following amino acids: (a) 271 and 272 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (b) 446 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (c) 470 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (d) 501 and 505 of VP1, VP2, or VP3 of the AAV9 capsid protein (e.g., at any one or all of residues 501, 502, 503, 504, or 505, or a combination thereof) or the corresponding position in the capsid protein of another parent AAV capsid protein; (e) (a) VP1, VP2, or VP3 of AAV9 capsid protein at positions 489 and 545 or the corresponding position in the capsid protein of another parent AAV capsid protein; (f) VP1, VP2, or VP3 of AAV9 capsid protein at positions 591 and 621 or the corresponding position in the capsid protein of another parent AAV capsid protein; or (g) any combination or all of (a)-(f).

[0181] In some embodiments, one or more mutations include mutations at the following locations: (a) 271 and 272 of VP1, VP2, or VP3 of the AAV9 capsid protein; (b) 446 of VP1, VP2, or VP3 of the AAV9 capsid protein; (c) 470 of VP1, VP2, or VP3 of the AAV9 capsid protein; (d) 501 and 505 of VP1, VP2, or VP3 of the AAV9 capsid protein (e.g., at any or all of residues 501, 502, 503, 504, or 505, or a combination thereof); (e) 489 and 545 of VP1, VP2, or VP3 of the AAV9 capsid protein; (f) 591 and 621 of VP1, VP2, or VP3 of the AAV9 capsid protein; or (g) any combination or all of (a)-(f).

[0182] In some embodiments, the parental AAV capsid protein includes the AAV1 capsid protein. In some embodiments, the AAV1 capsid protein sequence is provided in SEQ ID NO: 2002.

[0183] In some embodiments, the parental AAV capsid protein includes the AAV2 capsid protein. In some embodiments, the AAV2 capsid protein sequence is provided in SEQ ID NO: 2003.

[0184] In some embodiments, the parental AAV capsid protein includes the AAV3B capsid protein. In some embodiments, the AAV3B capsid protein sequence is provided in SEQ ID NO: 2010.

[0185] In some embodiments, the parental AAV capsid protein includes the AAV4 capsid protein. In some embodiments, the AAV4 capsid protein sequence is provided in SEQ ID NO: 2051.

[0186] In some embodiments, the parental AAV capsid protein includes the AAV5 capsid protein. In some embodiments, the AAV5 capsid protein sequence is provided in SEQ ID NO: 2004.

[0187] In some embodiments, the parental AAV capsid protein includes the AAV6 capsid protein. In some embodiments, the AAV6 capsid protein sequence is provided in SEQ ID NO: 2005.

[0188] In some embodiments, the parental AAV capsid protein includes the AAV7 capsid protein. In some embodiments, the AAV7 capsid protein sequence is provided in SEQ ID NO: 2052.

[0189] In some embodiments, the parental AAV capsid protein includes the AAV8 capsid protein. In some embodiments, the AAV8 capsid protein sequence is provided in SEQ ID NO: 2006.

[0190] In some embodiments, the parental AAV capsid protein includes the AAV10 capsid protein. In some embodiments, the AAV10 capsid protein sequence is provided in SEQ ID NO: 2053.

[0191] In some embodiments, the parental AAV capsid protein includes the AAV11 capsid protein. In some embodiments, the AAV11 capsid protein sequence is provided in SEQ ID NO: 2054.

[0192] In some embodiments, the parental AAV capsid protein includes the AAV12 capsid protein. In some embodiments, the AAV12 capsid protein sequence is provided in SEQ ID NO: 2055.

[0193] In some embodiments, the parental AAV capsid protein includes the AAV13 capsid protein. In some embodiments, the AAV13 capsid protein sequence is provided in SEQ ID NO: 2056.

[0194] In some embodiments, the parental AAV capsid protein includes the AAVhu68 capsid protein. In some embodiments, the AAVhu68 capsid protein sequence is provided in SEQ ID NO: 2057.

[0195] In some embodiments, the parental AAV capsid protein includes the AAVrh10 capsid protein. In some embodiments, the AAVrh10 capsid protein sequence is provided in SEQ ID NO: 2058.

[0196] In some embodiments, the peptide is inserted into the VR-I of the parental AAV capsid protein (e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10).

[0197] In some embodiments, the peptide is inserted into the VR-II of the parental AAV capsid protein (e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10).

[0198] In some embodiments, the peptide is inserted into the VR-III of the parental AAV capsid protein (e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10).

[0199] In some embodiments, the peptide is inserted into the VR-IV of the parental AAV capsid protein (e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10).

[0200] In some embodiments, the peptide is inserted into the VR-V of the parental AAV capsid protein (e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10).

[0201] In some embodiments, the peptide is inserted into the VR-VI of the parental AAV capsid protein (e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10).

[0202] In some embodiments, the peptide is inserted into VR-VII of the parental AAV capsid protein (e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10).

[0203] In some embodiments, the peptide is inserted into VR-VIII of the parental AAV capsid protein (e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10).

[0204] In some embodiments, the peptide is inserted into the VR-IX of the parental AAV capsid protein (e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10).

[0205] In some embodiments, the parental AAV capsid protein is selected from AAV9, AAV1, AAV2, AAV3B, AAV5, AAV6, or AAV8 capsid proteins, and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parental AAV capsid protein (e.g., AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10 capsid proteins).

[0206] In some embodiments, the parental AAV capsid protein is the AAV9 capsid protein, and VR-VIII contains amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0207] In some embodiments, the peptide is inserted into the VP (e.g., VP1, VP2 and / or VP3) of the parental AAV capsid protein.

[0208] In some embodiments, the peptide insertion site is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the parental AAV capsid protein (e.g., AAV9, AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10).

[0209] In some embodiments, the peptide is inserted between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0210] In some embodiments, the peptide insertion is located between amino acids 588 and 589 of VP1 and VP2 of the AAV9 capsid protein.

[0211] In some embodiments, the peptide insertion is located between amino acids 588 and 589 of VP1 and VP3 of the AAV9 capsid protein.

[0212] In some implementations, the peptide insertion is located between amino acids 588 and 589 of VP2 and VP3 of the AAV9 capsid protein.

[0213] In some embodiments, the peptide is inserted between amino acids 588 and 589 of VP1, VP2 and VP3 of the AAV9 capsid protein.

[0214] In some implementations, the peptide insertion site is located between two adjacent amino acids in VR-VIII of the parental AAV capsid protein.

[0215] In some implementations, the peptide insertion site is located between two non-adjacent amino acids in VR-VIII of the parental AAV capsid protein.

[0216] In some implementations, the insertion of a heteropeptide replaces a series of amino acid segments of the parental AAV capsid protein.

[0217] In some implementations, the insertion of the heteropeptide does not replace consecutive amino acid segments of the parental AAV capsid protein.

[0218] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV9 capsid protein compared to the WT AAV9 capsid protein. In some embodiments, the AAV9 WT capsid protein sequence is provided in SEQ ID NO: 2001. In some embodiments, the variant AAV9 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV9 capsid protein.

[0219] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV1 capsid protein compared to the WT AAV1 capsid protein. In some embodiments, the AAV1 WT capsid protein is provided in SEQ ID NO: 2002. In some embodiments, the variant AAV1 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV1 capsid protein.

[0220] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV2 capsid protein compared to the WT AAV2 capsid protein. In some embodiments, the AAV2 WT capsid protein is provided in SEQ ID NO: 2003. In some embodiments, the variant AAV2 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV2 capsid protein.

[0221] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV3B capsid protein compared to the WT AAV3B capsid protein. In some embodiments, the AAV3B WT capsid protein is provided in SEQ ID NO: 2010. In some embodiments, the variant AAV3B capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV3B capsid protein.

[0222] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV5 capsid protein compared to the WT AAV5 capsid protein. In some embodiments, the AAV5 WT capsid protein is provided in SEQ ID NO: 2004. In some embodiments, the variant AAV5 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV5 capsid protein.

[0223] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV6 capsid protein compared to the WT AAV6 capsid protein. In some embodiments, the AAV6 WT capsid protein is provided in SEQ ID NO: 2005. In some embodiments, the variant AAV6 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV6 capsid protein.

[0224] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV8 capsid protein compared to the WT AAV8 capsid protein. In some embodiments, the AAV8 WT capsid protein is provided in SEQ ID NO: 2006. In some embodiments, the variant AAV8 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV8 capsid protein.

[0225] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV4 capsid protein compared to the WT AAV4 capsid protein. In some embodiments, the AAV4 WT capsid protein is provided in SEQ ID NO: 2051. In some embodiments, the variant AAV4 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV4 capsid protein.

[0226] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV7 capsid protein compared to the WT AAV7 capsid protein. In some embodiments, the AAV7 WT capsid protein is provided in SEQ ID NO: 2052. In some embodiments, the variant AAV7 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV7 capsid protein.

[0227] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV10 capsid protein compared to the WT AAV10 capsid protein. In some embodiments, the AAV10 WT capsid protein is provided in SEQ ID NO: 2053. In some embodiments, the variant AAV10 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV10 capsid protein.

[0228] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV11 capsid protein compared to the WT AAV11 capsid protein. In some embodiments, the AAV11 WT capsid protein is provided in SEQ ID NO: 2054. In some embodiments, the variant AAV11 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV11 capsid protein.

[0229] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV12 capsid protein compared to the WT AAV12 capsid protein. In some embodiments, the AAV12 WT capsid protein is provided in SEQ ID NO: 2055. In some embodiments, the variant AAV12 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV12 capsid protein.

[0230] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAV13 capsid protein compared to the WT AAV13 capsid protein. In some embodiments, the AAV13 WT capsid protein is provided in SEQ ID NO: 2056. In some embodiments, the variant AAV13 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAV13 capsid protein.

[0231] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAVhu68 capsid protein compared to the WT AAVhu68 capsid protein. In some embodiments, the AAVhu68 WT capsid protein is provided in SEQ ID NO: 2057. In some embodiments, the variant AAVhu68 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAVhu68 capsid protein.

[0232] In some embodiments, the rAAV particles disclosed herein include, for example, a variant AAVrh10 capsid protein compared to the WT AAVrh10 capsid protein. In some embodiments, the AAVrh10 WT capsid protein is provided in SEQ ID NO: 2058. In some embodiments, the variant AAVrh10 capsid protein has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the WT AAVrh10 capsid protein.

[0233] Further modifications to the AAV9 capsid protein (excluding the peptide insertions disclosed herein) are possible, including, for example, the variants disclosed in International Patent Application WO 2003 / 052052, filed November 12, 2002, the entire contents of which are incorporated herein by reference. In some embodiments, the rAAV particles disclosed herein comprise variant AAV9 capsids comprising the peptide insertions disclosed herein and one or more AAV9 capsid modifications disclosed in WO 2003 / 052052.

[0234] Several other reports disclose modifications to the AAV9 capsid protein, including: Pulicherla N. et al., (2011). Mol Ther 19(6): pp. 1070–1078; Wang D. et al., (2018) Mol Ther Methods Clin Dev. (9): Pages 234-246; Adachi K. et al., (2014) Nat. Comm. (5): art. 3075; or Bell CL. et al., (2012) J Virol. 86(13): Pages 7326–7333, the entire contents of each of the aforementioned documents are incorporated herein by reference. In some embodiments, the rAAV particles disclosed herein comprise variant AAV9 capsids comprising the peptide inserts disclosed herein and one or more AAV9 capsid modifications disclosed in any of the reports cited herein.

[0235] AAV9 capsid protein variant with peptide insertion This article discloses, in particular, AAV9 capsid protein variants having one or more peptide insertions (e.g., as disclosed herein).

[0236] In some embodiments, the rAAV particles disclosed herein contain a variant AAV9 capsid protein with a peptide insertion disclosed herein.

[0237] In some embodiments, the peptide is inserted at any one or all of, or a combination thereof, of the AAV9 capsid protein VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII, and VR-IX.

[0238] In some implementations, the peptide is inserted into the VR-I of the AAV9 capsid protein.

[0239] In some implementations, the peptide is inserted into the VR-II of the AAV9 capsid protein.

[0240] In some implementations, the peptide is inserted into the VR-III of the AAV9 capsid protein.

[0241] In some implementations, the peptide is inserted into the VR-IV of the AAV9 capsid protein.

[0242] In some implementations, the peptide is inserted into the VR-V of the AAV9 capsid protein.

[0243] In some implementations, the peptide is inserted into the VR-VI of the AAV9 capsid protein.

[0244] In some implementations, the peptide is inserted into VR-VII of the AAV9 capsid protein.

[0245] In some implementations, the peptide is inserted into VR-VIII of the AAV9 capsid protein.

[0246] In some embodiments, VR-VIII of the AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the peptide insertion site is located between amino acids 580 and 601 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the peptide insertion site is located between amino acids 580-585, 585-590, 590-595, or 595-601 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the peptide insertion site is located between amino acids 580 and 581, 581 and 582, 582 and 583, 583 and 584, 584 and 585, 585 and 586, 586 and 587, 587 and 588, 588 and 589, 589 and 590, 590 and 591, 591 and 592, 592 and 593, 593 and 594, 594 and 595, 595 and 596, 596 and 597, 597 and 598, 598 and 599, 599 and 600, or 600 and 601 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the peptide insertion site is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0247] In some embodiments, the peptide insert is located between amino acids 588 and 589 of VP1 of the AAV9 capsid protein. In some embodiments, the peptide insert is located between amino acids 588 and 589 of VP2 of the AAV9 capsid protein. In some embodiments, the peptide insert is located between amino acids 588 and 589 of VP3 of the AAV9 capsid protein.

[0248] In some embodiments, the peptide insert is located between amino acids 588 and 589 of VP1 and VP2 of the AAV9 capsid protein. In some embodiments, the peptide insert is located between amino acids 588 and 589 of VP2 and VP3 of the AAV9 capsid protein. In some embodiments, the peptide insert is located between amino acids 588 and 589 of VP1 and VP3 of the AAV9 capsid protein. In some embodiments, the peptide insert is located between amino acids 588 and 589 of VP1, VP2, and VP3 of the AAV9 capsid protein.

[0249] In some implementations, the peptide insertion site is located between two adjacent amino acids in VR-VIII of the AAV9 capsid protein.

[0250] In some implementations, the peptide insertion site is located between two non-adjacent amino acids in VR-VIII of the AAV9 capsid protein.

[0251] In some implementations, the peptide is inserted into the VR-IX of the AAV9 capsid protein.

[0252] In some embodiments, the peptide is inserted into VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the peptide insertion site is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0253] In some implementations, the insertion of a heteropeptide replaces a continuous amino acid segment of the parental AAV capsid protein (e.g., the AAV9 parental capsid protein).

[0254] In some implementations, the insertion of the heteropeptide does not replace consecutive amino acid segments of the parental AAV capsid protein (e.g., AAV9 parental capsid protein).

[0255] In some embodiments, the recombinant AAV particles (rAAV) disclosed herein comprise a variant AAV9 capsid protein containing one or more sequences of VP1, VP2, or VP3 of the AAV9 capsid protein disclosed herein.

[0256] In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising any of the peptides provided in Tables 1 through 3. In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising any of the peptides provided in Table 1. In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising any of the peptides provided in Table 2. In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising any of the peptides provided in Table 3.

[0257] In some embodiments, the rAAV particles disclosed herein comprise: (1) a variant AAV9 capsid protein comprising any of the peptides provided in any of Tables 1 to 3; and (2) one or more sequences of the VPs (e.g., VP1, VP2, and / or VP3) of the AAV9 capsid protein. In some embodiments, the rAAV particles disclosed herein comprise: (1) a variant AAV9 capsid protein comprising any of the peptides provided in Table 1; and (2) one or more sequences of the VPs (e.g., VP1, VP2, and / or VP3) of the AAV9 capsid protein. In some embodiments, the rAAV particles disclosed herein comprise: (1) a variant AAV9 capsid protein comprising any of the peptides provided in Table 2; and (2) one or more sequences of the VPs (e.g., VP1, VP2, and / or VP3) of the AAV9 capsid protein. In some embodiments, the rAAV particles disclosed herein comprise: (1) a variant AAV9 capsid protein comprising any of the peptides provided in Table 3; and (2) one or more sequences of the VPs (e.g., VP1, VP2 and / or VP3) of the AAV9 capsid protein.

[0258] In some embodiments, the rAAV particles disclosed herein containing a variant AAV (e.g., AAV9) capsid protein containing any of the peptides provided in Tables 1 to 3 have at least 1.5-fold enhanced CNS transduction compared to rAAV particles containing the corresponding parental AAV (e.g., AAV9) capsid protein (e.g., without peptide insertion).

[0259] In some embodiments, the rAAV particles disclosed herein containing a variant AAV (e.g., AAV9) capsid protein containing any of the peptides provided in Tables 1 to 3 can be used for CNS targeting, for example, targeting CNS cells and / or tissues with rAAV particles containing a variant AAV (e.g., AAV9) capsid protein.

[0260] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein does not include an additional sequence at the N-terminus of the peptide sequence provided in any of Tables 1 to 4.

[0261] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein does not include an additional sequence at the C-terminus of the peptide sequence provided in any of Tables 1 to 4.

[0262] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein does not include additional sequences at the N-terminus and C-terminus of the peptide sequences provided in any of Tables 1 to 4.

[0263] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes an additional sequence (e.g., 1, 2, 3, 4, or 5 amino acids) at the N-terminus of the peptide sequence provided in any of Tables 1 to 4.

[0264] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes an additional sequence (e.g., 1, 2, 3, 4, or 5 amino acids) at the C-terminus of the peptide sequence provided in any of Tables 1 to 4.

[0265] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes additional sequences (e.g., 1, 2, 3, 4, or 5 amino acids) at the N-terminus and C-terminus of the peptide sequences provided in any of Tables 1 to 4.

[0266] Table 1: Exemplary peptide insertions in VR-VIII For Tables 1 and 2, "1" in columns 3, 4, and 5 indicates a peptide inserted into AAV9 VR-VIII that, with the specified promoter, exhibits enhanced NHP CNS cell transduction compared to WT AAV9. A "0" indicates no enhanced NHP CNS cell transduction compared to WT AAV9 with the specified promoter. For different promoters, all peptides marked with "1" in Table 1 exhibited a >2.94-fold fold increase in transduction in NHP CNS cells when inserted into AAV9 VR-VIII, compared to transduction with WT AAV9.

[0267] Table 3: Other exemplary peptide insertions in VR-VIII For all peptides provided in Table 3, when inserted into VR-VIII of AAV9, a more than 5-fold enhancement of CNS transduction was observed compared to the parental AAV9.

[0268] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence containing SEQ ID NO: 75 (TTMGVYI).

[0269] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 75 (TTMGVYI).

[0270] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 47 (TQHGVYI).

[0271] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 47 (TQHGVYI).

[0272] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence comprising SEQ ID NO: 72 (RNGAVFI).

[0273] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 72 (RNGAVFI).

[0274] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence SEQ ID NO: 61 (KREGIFI).

[0275] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 61 (KREGIFI).

[0276] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence of SEQ ID NO: 69 (QSLPTVL).

[0277] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 69 (QSLPTVL).

[0278] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein contains the sequence SEQ ID NO: 76 (VITSGLK).

[0279] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 76 (VITSGLK).

[0280] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence SEQ ID NO: 73 (TLVDNMR).

[0281] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 73 (TLVDNMR).

[0282] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence containing SEQ ID NO: 63 (NNAGVYI).

[0283] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 63 (NNAGVYI).

[0284] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes a sequence comprising SEQ ID NO:66 (PPVGVSR).

[0285] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 66 (PPVGVSR).

[0286] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence comprising SEQ ID NO: 65 (PHVVAPV).

[0287] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 65 (PHVVAPV).

[0288] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence of SEQ ID NO: 60 (KQMPPGL).

[0289] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 60 (KQMPPGL).

[0290] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence of SEQ ID NO: 58 (IMVSTVR).

[0291] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 58 (IMVSTVR).

[0292] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence SEQ ID NO: 68 (QLTVEPK).

[0293] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 68 (QLTVEPK).

[0294] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence comprising SEQ ID NO: 67 (PQPGTMR).

[0295] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 67 (PQPGTMR).

[0296] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein contains the sequence SEQ ID NO: 71 (RGGVVYI).

[0297] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 71 (RGGVVYI).

[0298] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence comprising SEQ ID NO: 62 (NMHGVYI).

[0299] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 62 (NMHGVYI).

[0300] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence containing SEQ ID NO: 70 (RGGQVFI).

[0301] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 70 (RGGQVFI).

[0302] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence of SEQ ID NO: 64 (NQMGVFI).

[0303] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 64 (NQMGVFI).

[0304] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 18 (KGGQVYI).

[0305] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence of SEQ ID NO: 18 (KGGQVYI).

[0306] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 24 (NNQGVYI).

[0307] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence of SEQ ID NO: 24 (NNQGVYI).

[0308] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 44 (TNHGVYI).

[0309] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence of SEQ ID NO: 44 (TNHGVYI).

[0310] In some embodiments, the peptide is inserted into VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the peptide insertion site is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0311] In some embodiments, the peptide insert contains the sequence TTMGVYI (SEQ ID NO: 75) and is inserted between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0312] In some embodiments, the peptide insert consists of the sequence TTMGVYI (SEQ ID NO: 75) and is inserted between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0313] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3, and X4 are independently any amino acid, and X5 is Y, W, or F. In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77), wherein X1, X2, X3, and X4 are independently any amino acid. In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X1, X2, X3, and X4 are independently any amino acid.

[0314] In some implementations, the peptide insertion includes the sequences provided in Table 2 or Table 4.

[0315] Table 2: Exemplary peptides covered by SEQ ID NO: 1 In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, T or R; and X2, X3 and X4 are independently any amino acid.

[0316] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X2 is P, G, N, Q, M or T; and X1, X3 and X4 are independently any amino acid.

[0317] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X3 is Q, G, H, A or M; and X1, X2 and X4 are independently any amino acid.

[0318] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X4 is G, Q, A or V; and X1, X2 and X3 are independently any amino acid.

[0319] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, T or R; X2 is P, G, N, Q, M or T; and X3 and X4 are independently any amino acid.

[0320] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, T or R; X2 is any amino acid; X3 is Q, G, H, A or M; and X4 is any amino acid.

[0321] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, T or R; X2 and X3 are independently any amino acid; and X4 is G, Q, A or V.

[0322] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is any amino acid; X2 is P, G, N, Q, M or T; X3 is Q, G, H, A or M; and X4 is any amino acid.

[0323] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 and X2 are independently any amino acid; X3 is Q, G, H, A or M; and X4 is G, Q, A or V.

[0324] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, T or R; X2 is P, G, N, Q, M or T; X3 is Q, G, H, A or M; and X4 is any amino acid.

[0325] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, T or R; X2 is P, G, N, Q, M or T; X3 is any amino acid; and X4 is G, Q, A or V.

[0326] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, T or R; X2 is any amino acid; X3 is Q, G, H, A or M; and X4 is G, Q, A or V.

[0327] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is any amino acid; X2 is P, G, N, Q, M or T; X3 is Q, G, H, A or M; and X4 is G, Q, A or V.

[0328] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77) or X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, T or R; X2 is P, G, N, Q, M or T; X3 is Q, G, H, A or M; and X4 is G, Q, A or V.

[0329] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein contains the sequence of SEQ ID NO: 14 (IPQGVYI).

[0330] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 14 (IPQGVYI).

[0331] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 18 (KGGQVYI).

[0332] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence of SEQ ID NO: 18 (KGGQVYI).

[0333] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 24 (NNQGVYI).

[0334] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence of SEQ ID NO: 24 (NNQGVYI).

[0335] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 44 (TNHGVYI).

[0336] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence of SEQ ID NO: 44 (TNHGVYI).

[0337] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 47 (TQHGVYI).

[0338] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: SEQ ID NO: 47 (TQHGVYI).

[0339] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence comprising SEQ ID NO: 72 (RNGAVFI).

[0340] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 72 (RNGAVFI).

[0341] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence containing SEQ ID NO: 63 (NNAGVYI).

[0342] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 63 (NNAGVYI).

[0343] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein contains the sequence SEQ ID NO: 71 (RGGVVYI).

[0344] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 71 (RGGVVYI).

[0345] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence comprising SEQ ID NO: 62 (NMHGVYI).

[0346] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 62 (NMHGVYI).

[0347] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence containing SEQ ID NO: 70 (RGGQVFI).

[0348] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 70 (RGGQVFI).

[0349] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence of SEQ ID NO: 64 (NQMGVFI).

[0350] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 64 (NQMGVFI).

[0351] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence containing SEQ ID NO: 75 (TTMGVYI).

[0352] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 75 (TTMGVYI).

[0353] Table 4: Some exemplary peptides covered by SEQ ID NO: 1 In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, or T; and X2, X3, and X4 are independently any amino acid.

[0354] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X2 is P, G, N, or Q; and X1, X3, and X4 are independently any amino acid.

[0355] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X3 is Q, G, or H; and X1, X2, and X4 are independently any amino acid.

[0356] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X4 is G or Q; and X1, X2, and X3 are independently any amino acid.

[0357] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, or T; X2 is P, G, N, or Q; and X3 and X4 are independently any amino acid.

[0358] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, or T; X2 is any amino acid; X3 is Q, G, or H; and X4 is any amino acid.

[0359] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N, or T; X2 and X3 are independently any amino acid; and X4 is G or Q.

[0360] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is any amino acid; X2 is P, G, N, or Q; X3 is Q, G, or H; and X4 is any amino acid.

[0361] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 and X2 are independently any amino acid; X3 is Q, G, or H; and X4 is G or Q.

[0362] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), where X1 is I, K, N, or T; X2 is P, G, N, or Q; X3 is Q, G, or H; and X4 is any amino acid.

[0363] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), where X1 is I, K, N, or T; X2 is any amino acid; X3 is Q, G, or H; and X4 is G or Q.

[0364] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), where X1 is I, K, N, or T; X2 is P, G, N, or Q; X3 is any amino acid; and X4 is G or Q.

[0365] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is any amino acid; X2 is P, G, N, or Q; X3 is Q, G, or H; and X4 is G or Q.

[0366] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X1 is I, K, N or T; X2 is P, G, N or Q; X3 is Q, G or H; and X4 is G or Q.

[0367] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein includes the sequence containing SEQ ID NO: 4 (AYALPKG).

[0368] In some embodiments, the peptide insertion in the variant AAV capsid protein disclosed herein consists of the sequence of SEQ ID NO: 4 (AYALPKG).

[0369] In some embodiments, the rAAV particles disclosed herein comprise a variant AAV9 capsid containing a peptide insert disclosed in any of Tables 1 to 3 and one or more modifications to the amino acid sequence flanking the peptide insert site. In some embodiments, one or more modifications are located within about 10 (e.g., about 5) amino acids upstream or downstream of the peptide insert site.

[0370] In some implementations, one or more modifications include insertions, deletions, mutations, or combinations thereof.

[0371] In some embodiments, the variant AAV capsid protein further includes one or more modifications to the amino acid sequence at or near the glycan-binding region. In some embodiments, one or more modifications reduce glycan binding. In some embodiments, the glycan is galactose.

[0372] In some embodiments, one or more modifications are made at or between the following amino acids: (a) 271 and 272 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (b) 446 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (c) 470 of VP1, VP2, or VP3 of the AAV9 capsid protein or the corresponding position in the capsid protein of another parent AAV capsid protein; (d) 501 and 505 of VP1, VP2, or VP3 of the AAV9 capsid protein (e.g., at any one or all of residues 501, 502, 503, 504, or 505, or a combination thereof) or the corresponding position in the capsid protein of another parent AAV capsid protein; (e) (a) VP1, VP2, or VP3 of AAV9 capsid protein at positions 489 and 545 or the corresponding position in the capsid protein of another parent AAV capsid protein; (f) VP1, VP2, or VP3 of AAV9 capsid protein at positions 591 and 621 or the corresponding position in the capsid protein of another parent AAV capsid protein; or (g) any combination or all of (a)-(f).

[0373] Exemplary capsid variants with peptide insertion in VR-VIII In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising a peptide insertion relative to the parental AAV capsid protein. In some embodiments, (1) the peptide insertion comprises any of the peptide insertions disclosed herein; (2) the peptide insertion site is in VR-VIII of the parental AAV capsid protein; and (3) the parental AAV capsid protein comprises the AAV9 capsid protein.

[0374] In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising a peptide insertion relative to the parental AAV capsid protein. In some embodiments, (1) the peptide insertion comprises the peptide insertions provided in Table 1; (2) the peptide insertion site is in VR-VIII of the parental AAV capsid protein; and (3) the parental AAV capsid protein comprises the AAV9 capsid protein. In some embodiments, the peptide insertion is in VR-VIII of the AAV9 capsid protein. In some embodiments, VR-VIII of the AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2, or VP3. In some embodiments, the peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the AAV9 capsid protein comprises the sequence of the wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity with SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95% identity with SEQ ID NO: 2001 (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity) and one or more mutations, such as those disclosed herein. In some embodiments, the one or more mutations include mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, the one or more mutations altering the binding spectrum of the parental AAV capsid protein comprise mutations that reduce binding to one or more tissues (such as liver tissue), such as liver detargeting mutations. In some embodiments, the one or more mutations altering the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at positions 503, 595, 457, 574, 592, 498, 602, 468, or 500 in the VP1 region of the AAV9 capsid protein, or at corresponding positions in the VP2 or VP3 proteins, or combinations thereof.In some implementations, mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include the W503R mutation.

[0375] In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising a peptide insertion relative to the parental AAV capsid protein. In some embodiments, (1) the peptide insertion comprises peptide insertions provided in Table 2; (2) the peptide insertion site is in VR-VIII of the parental AAV capsid protein; and (3) the parental AAV capsid protein comprises the AAV9 capsid protein. In some embodiments, the peptide insertion is in VR-VIII of the AAV9 capsid protein. In some embodiments, VR-VIII of the AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2, or VP3. In some embodiments, the peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the AAV9 capsid protein comprises the sequence of the wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity with SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95% identity with SEQ ID NO: 2001 (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity) and one or more mutations, such as those disclosed herein. In some embodiments, the one or more mutations include mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, the one or more mutations altering the binding spectrum of the parental AAV capsid protein comprise mutations that reduce binding to one or more tissues (such as liver tissue), such as liver detargeting mutations. In some embodiments, the one or more mutations altering the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at positions 503, 595, 457, 574, 592, 498, 602, 468, or 500 in the VP1 region of the AAV9 capsid protein, or at corresponding positions in the VP2 or VP3 proteins, or combinations thereof.In some implementations, mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include the W503R mutation.

[0376] In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising a peptide insertion relative to the parental AAV capsid protein. In some embodiments, (1) the peptide insertion comprises the peptide insertions provided in Table 3; (2) the peptide insertion site is in VR-VIII of the parental AAV capsid protein; and (3) the parental AAV capsid protein comprises the AAV9 capsid protein. In some embodiments, the peptide insertion is in VR-VIII of the AAV9 capsid protein. In some embodiments, VR-VIII of the AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2, or VP3. In some embodiments, the peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the AAV9 capsid protein comprises the sequence of the wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity with SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95% identity with SEQ ID NO: 2001 (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity) and one or more mutations, such as those disclosed herein. In some embodiments, the one or more mutations include mutations that alter the binding spectrum of the parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, the one or more mutations altering the binding spectrum of the parental AAV capsid protein comprise mutations that reduce binding to one or more tissues (such as liver tissue), such as liver detargeting mutations. In some embodiments, the one or more mutations altering the binding spectrum of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at positions 503, 595, 457, 574, 592, 498, 602, 468, or 500 in the VP1 region of the AAV9 capsid protein, or at corresponding positions in the VP2 or VP3 proteins, or combinations thereof.In some implementations, mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include the W503R mutation.

[0377] In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising a peptide insertion relative to the parental AAV capsid protein. In some embodiments, (1) the peptide insertion comprises the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3, and X4 are independently any amino acids, and X5 is Y, W, or F; (2) the peptide insertion site is in VR-VIII of the parental AAV capsid protein; and (3) the parental AAV capsid protein comprises the AAV9 capsid protein. In some embodiments, the peptide insertion is in VR-VIII of the AAV9 capsid protein. In some embodiments, VR-VIII of the AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2, or VP3. In some embodiments, the peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the AAV9 capsid protein comprises the sequence of the wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity with SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95% identity with SEQ ID NO: 2001 (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity) and one or more mutations, such as those disclosed herein. In some embodiments, the one or more mutations include mutations that alter the binding profile of the parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, the one or more mutations that alter the binding profile of the parental AAV capsid protein include mutations that reduce binding to one or more tissues (such as liver tissue), such as liver detargeting mutations.In some embodiments, one or more mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at positions 503, 595, 457, 574, 592, 498, 602, 468, or 500 in the AAV9 capsid protein at the corresponding positions in the VP2 or VP3 proteins, or combinations thereof. In some embodiments, mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include the W503R mutation.

[0378] In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising a peptide insertion relative to the parental AAV capsid protein. In some embodiments, (1) the peptide insertion comprises the sequence X1X2X3X4V[Y / F]I (SEQ ID NO: 77), wherein X1, X2, X3, and X4 are independently any amino acids; (2) the peptide insertion site is in VR-VIII of the parental AAV capsid protein; and (3) the parental AAV capsid protein comprises the AAV9 capsid protein. In some embodiments, the peptide insertion is in VR-VIII of the AAV9 capsid protein. In some embodiments, VR-VIII of the AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2, or VP3. In some embodiments, the peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the AAV9 capsid protein comprises the sequence of the wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity with SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95% identity with SEQ ID NO:2001 (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity) and one or more mutations, such as those disclosed herein. In some embodiments, the one or more mutations include mutations that alter the binding profile of the parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, the one or more mutations that alter the binding profile of the parental AAV capsid protein include mutations that reduce binding to one or more tissues (such as liver tissue), such as liver detargeting mutations.In some embodiments, one or more mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at positions 503, 595, 457, 574, 592, 498, 602, 468, or 500 in the AAV9 capsid protein at the corresponding positions in the VP2 or VP3 proteins, or combinations thereof. In some embodiments, mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include the W503R mutation.

[0379] In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising a peptide insertion relative to the parental AAV capsid protein. In some embodiments, (1) the peptide insertion comprises the sequence X1X2X3X4VYI (SEQ ID NO: 78), wherein X1, X2, X3, and X4 are independently any amino acids; (2) the peptide insertion site is in VR-VIII of the parental AAV capsid protein; and (3) the parental AAV capsid protein comprises the AAV9 capsid protein. In some embodiments, the peptide insertion is in VR-VIII of the AAV9 capsid protein. In some embodiments, VR-VIII of the AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2, or VP3. In some embodiments, the peptide insertion is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the AAV9 capsid protein comprises the sequence of the wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity with SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95% identity with SEQ ID NO:2001 (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity) and one or more mutations, such as those disclosed herein. In some embodiments, the one or more mutations include mutations that alter the binding profile of the parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, the one or more mutations that alter the binding profile of the parental AAV capsid protein include mutations that reduce binding to one or more tissues (such as liver tissue), such as liver detargeting mutations.In some embodiments, one or more mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at positions 503, 595, 457, 574, 592, 498, 602, 468, or 500 in the AAV9 capsid protein at the corresponding positions in the VP2 or VP3 proteins, or combinations thereof. In some embodiments, mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include the W503R mutation.

[0380] In some embodiments, the rAAV particles disclosed herein comprise a variant AAV capsid protein comprising a peptide insert relative to the parental AAV capsid protein. In some embodiments, (1) the peptide insert comprises the sequence TTMGVYI (SEQ ID NO: 1551); (2) the peptide insert site is located in VR-VIII of the parental AAV capsid protein; and (3) the parental AAV capsid protein comprises the AAV9 capsid protein. In some embodiments, the peptide insert consists of the sequence TTMGVYI (SEQ ID NO: 1551). In some embodiments, the peptide insert is located in VR-VIII of the AAV9 capsid protein. In some embodiments, VR-VIII of the AAV9 capsid protein comprises amino acids 580 to 601 of VP1, VP2, or VP3. In some embodiments, the peptide insert is located between amino acids 588 and 589 of VP1, VP2, or VP3 of the AAV9 capsid protein. In some embodiments, the AAV9 capsid protein comprises the sequence of the wild-type AAV9 capsid protein provided in SEQ ID NO: 2001; or a sequence having at least 95% identity with SEQ ID NO: 2001; or a sequence having no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity with SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having no more than 1, no more than 2, no more than 5, no more than 10, or no more than 20 mutations (e.g., substitutions) compared to SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises the sequence provided in SEQ ID NO: 2001. In some embodiments, the AAV9 capsid protein comprises a sequence having at least 95% identity with SEQ ID NO: 2001 (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identity) and one or more mutations, such as those disclosed herein. In some embodiments, the one or more mutations include mutations that alter the binding profile of the parental AAV capsid protein (e.g., binding to one or more tissues). In some embodiments, the one or more mutations that alter the binding profile of the parental AAV capsid protein include mutations that reduce binding to one or more tissues (such as liver tissue), such as liver detargeting mutations.In some embodiments, one or more mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include mutations at positions 503, 595, 457, 574, 592, 498, 602, 468, or 500 in the AAV9 capsid protein at the corresponding positions in the VP2 or VP3 proteins, or combinations thereof. In some embodiments, mutations that alter the binding profile of the parental AAV capsid protein (e.g., liver detargeting mutations) include the W503R mutation.

[0381] Characterization of variant AAV capsid protein The variant AAV capsid protein disclosed herein may have enhanced CNS tropism. In some embodiments, the variant AAV capsid protein may be present in rAAV particles. In some embodiments, rAAV particles containing the variant AAV capsid protein disclosed herein are characterized in that, when administered to cells or tissues or subjects, the variant AAV capsid protein confers increased infectivity and / or transduction to CNS cells or tissues compared to control AAV particles containing the corresponding parental AAV capsid protein.

[0382] In some embodiments, CNS cells comprise CNS connective tissue cells. In some embodiments, CNS connective tissue cells comprise adipocytes or meningeal cells, or both. In some embodiments, CNS cells comprise stem cells or progenitor cells. In some embodiments, stem cells comprise neural stem cells. In some embodiments, CNS cells comprise cells lining one or more ventricles. In some embodiments, CNS cells comprise meningeal cells. In some embodiments, CNS cells comprise adipocytes.

[0383] In some embodiments, the CNS tissue includes tissues found in the following: cortex, thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, deep cerebellar nuclei, or other parts of the brain and / or spinal cord. In some embodiments, the CNS tissue includes tissues found in the following: frontal cortex, parietal cortex, occipital cortex, temporal cortex, or combinations thereof.

[0384] In some implementations, rAAV particles containing variant AAV capsid proteins confer at least 1.5-fold, at least 2-fold, 2.5-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, or at least 70-fold increased infectivity and / or transduction in CNS cells or tissues compared to control AAV particles containing the corresponding parental AAV capsid protein.

[0385] In some implementations, rAAV particles containing variant AAV capsid proteins confer approximately 1.5-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 40-fold, 50-fold, 60-fold, or 70-fold increased infectivity and / or transduction in CNS cells or tissues compared to control AAV particles containing the corresponding parental AAV capsid protein.

[0386] In some implementations, the variant AAV capsid protein is the AAV9 variant capsid protein.

[0387] In some implementations, rAAV particles comprising the variant AAV capsid protein disclosed herein and a heterologous nucleic acid containing a nucleotide sequence encoding the payload are characterized in that, when applied to cells or tissues or subjects, payload delivery to CNS cells or tissues is enhanced compared to delivery of similar payloads using other similar AAV particles that do not have the variant AAV capsid protein disclosed herein.

[0388] In some embodiments, CNS cells comprise CNS connective tissue cells. In some embodiments, CNS connective tissue cells comprise adipocytes or meningeal cells, or both. In some embodiments, CNS cells comprise stem cells or progenitor cells. In some embodiments, stem cells comprise neural stem cells. In some embodiments, CNS cells comprise cells lining one or more ventricles. In some embodiments, CNS cells comprise meningeal cells. In some embodiments, CNS cells comprise adipocytes.

[0389] In some embodiments, the CNS tissue includes tissues found in the following: cortex, thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, deep cerebellar nuclei, or other parts of the brain and / or spinal cord. In some embodiments, the CNS tissue includes tissues found in the following: frontal cortex, parietal cortex, occipital cortex, temporal cortex, or combinations thereof.

[0390] In some embodiments, rAAV particles comprising the variant AAV capsid protein disclosed herein are characterized in that, when administered to cells or tissues or subjects, an increase in payload expression is observed compared to the expression of similar payloads having other aspects similar to AAV particles that do not have the variant AAV capsid protein disclosed herein. In some embodiments, the increase in payload expression is at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, or at least 100-fold.

[0391] In some implementations, the expression of the payload is increased by approximately 1.5 times, approximately 2 times, approximately 2.5 times, approximately 3 times, approximately 4 times, approximately 5 times, approximately 6 times, approximately 7 times, approximately 8 times, approximately 9 times, approximately 10 times, approximately 15 times, approximately 20 times, approximately 30 times, approximately 40 times, approximately 50 times, approximately 60 times, approximately 70 times, approximately 80 times, approximately 90 times, or approximately 100 times.

[0392] In some embodiments, the expression of the payload increases by approximately 1.5 times to approximately 100 times, approximately 1.5 times to approximately 90 times, approximately 1.5 times to approximately 80 times, approximately 1.5 times to approximately 70 times, approximately 1.5 times to approximately 60 times, approximately 1.5 times to approximately 50 times, approximately 1.5 times to approximately 40 times, approximately 1.5 times to approximately 30 times, approximately 1.5 times to approximately 20 times, approximately 1.5 times to approximately 15 times, approximately 1.5 times to approximately 10 times, approximately 1.5 times to approximately 9 times, approximately 1.5 times to approximately 8 times, approximately 1.5 times to approximately 7 times, approximately 1.5 times to approximately 6 times, approximately 1.5 times to approximately 5 times, approximately 1.5 times to approximately 4 times, and approximately 1.5 times. From about 3 times, from about 1.5 times to about 2 times, from about 2 times to about 100 times, from about 3 times to about 100 times, from about 4 times to about 100 times, from about 5 times to about 100 times, from about 6 times to about 100 times, from about 7 times to about 100 times, from about 8 times to about 100 times, from about 9 times to about 100 times, from about 10 times to about 100 times, from about 15 times to about 100 times, from about 20 times to about 100 times, from about 30 times to about 100 times, from about 40 times to about 100 times, from about 50 times to about 100 times, from about 60 times to about 100 times, from about 70 times to about 100 times, from about 80 times to about 100 times, from about 90 times to about 100 times.

[0393] CNS cells and / or tissues for delivery of AAV particles containing variant AAV capsid proteins This document discloses variant AAV capsid proteins that exhibit enhanced tropism for CNS cells and / or tissues. In some embodiments, the disclosed variant AAV capsid proteins can be used to target CNS cells and / or tissues. In some embodiments, the CNS cells or tissues are selected from: CNS epithelial cells, nerve cells, CNS connective tissue cells, stem cells, progenitor cells, CNS immune cells, spinal cord cells, cells lining one or more ventricles, neural supporting cells, glial cells, adipocytes, meningeal cells, or combinations thereof.

[0394] In some embodiments, CNS cells include CNS epithelial cells. In some embodiments, CNS epithelial cells include cells lining one or more ventricles.

[0395] In some embodiments, CNS cells include nerve cells (neurons). In some embodiments, neurons include unipolar neurons, bipolar neurons, pseudounipolar neurons, multipolar neurons, or combinations thereof. In some embodiments, neurons are motor neurons, sensory neurons, interneurons, excitatory neurons, inhibitory neurons, sympathetic neurons, parasympathetic neurons, or combinations thereof. In some embodiments, neurons include pyramidal neurons, dopaminergic neurons, cholinergic neurons, adrenergic neurons, GABAergic neurons, glutamatergic neurons, serotonergic neurons, purinergic neurons, histaminergic neurons, lower motor neurons, or combinations thereof.

[0396] In some embodiments, nerve cells (neurons) include neural supporting cells. In some embodiments, neural supporting cells include glial cells. In some embodiments, glial cells include astrocytes, microglia, ependymal cells, oligodendrocytes, Schwann cells, or combinations thereof.

[0397] In some embodiments, CNS cells include CNS connective tissue cells. In some embodiments, CNS connective tissue cells include adipocytes or meningeal cells, or both.

[0398] In some implementations, CNS cells include stem cells or progenitor cells. In some implementations, stem cells include neural stem cells.

[0399] In some implementations, CNS cells include cells lining one or more ventricles of the brain.

[0400] In some implementations, CNS cells include meningeal cells.

[0401] In some implementations, CNS cells include adipocytes.

[0402] In some implementations, CNS tissue includes tissues found in the following: cortex, thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, deep cerebellar nuclei, or other parts of the brain and / or spinal cord.

[0403] In some implementations, the CNS tissue includes tissues found in the following: frontal cortex, parietal cortex, occipital cortex, temporal cortex, or combinations thereof.

[0404] Payload for AAV particles containing variant AAV capsid proteins rAAV particles containing the variant AAV capsid protein disclosed herein may also contain a heterologous nucleic acid sequence encoding a nucleotide sequence that encodes the payload.

[0405] In some embodiments, the payload is or comprises a polypeptide, such as one encoded by a nucleic acid sequence within the rAAV particle. In some embodiments, the payload polypeptide is selected from: CRISPR-Cas proteins, zinc finger proteins, TAL, base editors, leader editors, meganucleases, or any combination thereof.

[0406] In some embodiments, the polypeptide is or comprises a CRISPR-Cas protein. In some embodiments, the CRISPR-Cas protein is selected from type II, V, or VI CRISPR-Cas proteins, such as Cas9, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas13a, Cas13b, or variants or fragments of any of the foregoing. In some embodiments, the CRISPR-Cas protein is fused to one or more domains (e.g., activation and / or repression domains). In some embodiments, the CRISPR-Cas protein is a nuclease. In some embodiments, the CRISPR-Cas protein is a cleavage enzyme and cleaves only one strand of the target nucleic acid molecule. In some embodiments, the CRISPR-Cas protein is inactivated and binds to but does not cleave the target nucleic acid molecule.

[0407] In some embodiments, the polypeptide is or comprises a zinc finger protein, or a variant or fragment thereof. In some embodiments, the zinc finger protein is selected from: zinc finger nucleases, artificial restriction enzyme fusion proteins, zinc finger DNA binding units optionally fused to a nuclease domain (e.g., the Fok1 nuclease domain), or variants or fragments of any of the foregoing, or combinations thereof. In some embodiments, the zinc finger protein is fused to one or more domains (e.g., an activation domain and / or a repression domain).

[0408] In some embodiments, the polypeptide is or comprises a transcription activator-like effector (TAL) protein, or a variant or fragment thereof. In some embodiments, the TAL comprises: a TAL effector DNA-binding domain (e.g., a TAL effector DNA-binding domain isolated from Xanthomonas species), a transcription activator-like effector nuclease (TALEN), such as a TAL effector DNA-binding domain fused to a nuclease domain (e.g., the Fok1 nuclease domain), or a variant or fragment thereof, or a combination thereof. In some embodiments, the TAL protein is fused to one or more domains (e.g., an activation domain and / or a repression domain).

[0409] In some embodiments, the polypeptide is or contains a base editor, or a variant or fragment thereof. In some embodiments, the base editor contains a deaminase, adenosine deaminase (ABE), cytosine deaminase (CBE), APOBEC1, APOBEC3A, APOBEC3G, evoAPOBEC, BE4-YE1, CDA1, activation-induced cytidine deaminase (AID), mutant TadA, adenosine deaminase (TadA*), *E. coli* tRNA-specific adenosine deaminase (TadA), a deaminase associated with a DNA-binding domain monomer, RNA-directed base editing enzyme, or DNA... The payload may include a glycosylation enzyme inhibitor, one or more DNA glycosylation enzyme inhibitor domains, a 5-methylcytosine deaminase, a cytidine deaminase domain, an adenine deaminase domain, an adenosine base editor (ABE), Target-ACEmax, a synchronously programmable adenine and cytosine editor (SPACE), A&C-BEmax, a cyclic substitution base editor, adenosine deaminase (ADAR), RNA editing for programmable adenosine-to-inosine substitution (REPAIR), a lever endogenous ADAR for programmable RNA editing (LEAPER), or a variant or fragment of any of the foregoing, or a combination thereof. In some embodiments, the payload may also include a guide RNA, gRNA, sgRNA, or crRNA / tracrNA that interacts with the base editor.

[0410] In some embodiments, the polypeptide is or contains a lead editor or a variant or fragment thereof, or a system containing the lead editor. In some embodiments, the lead editor and / or the system containing the lead editor includes: reverse transcriptase, lead editing enzyme, editing enzyme including a reverse transcriptase domain, avian myeloma virus (AMV) reverse transcriptase, murine leukemia virus (MLV) reverse transcriptase, HIV-1 reverse transcriptase, bacterial reverse transcriptase, reverse transcriptase associated with a DNA-binding domain and / or protein, reverse transcriptase fused to a DNA-binding domain as a catalytically impaired nuclease domain (e.g., a nickase), lead editing system 1 (PE1), lead editing system 2 (PE2), lead editing system 3 (PE3), lead editing system 3b (PE3b), or variants or fragments of any of the foregoing, or combinations thereof. In some embodiments, the payload also includes a lead editing gRNA (pegRNA) or an extended sgRNA that interacts with the lead editor.

[0411] In some embodiments, the polypeptide is or comprises a meganuclease, or a variant or fragment thereof. In some embodiments, the meganuclease is selected from: homing endonucleases, LAGLIDADG family meganucleases, GIYYIG family meganucleases, His-Cyst box family meganucleases, or HNH family endonucleases, I-SeeI, I-CeuI, PI-PspI, PI-SceI, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII, I-TevIII, or variants or fragments of any of the foregoing or combinations thereof. In some embodiments, the peptide is associated with a CNS condition. In some embodiments, the CNS condition is the CNS condition disclosed herein. In some embodiments, the CNS condition is selected from: Friedreich ataxia, Drave syndrome, spinocerebellar ataxia type 3, Niemann-Pick type C, Huntington's disease, Pompe disease, myotonic dystrophy type 1, glucose transporter 1 deficiency syndrome (Devivo syndrome), Tay-Sachs disease, spinal muscular atrophy, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Danon disease, Rett syndrome, Angelman syndrome, Parkinson's disease, tau proteinosis, hereditary epilepsy (e.g., STXBP1 hereditary epilepsy or CDKL5 hereditary epilepsy), or any combination thereof.

[0412] In some embodiments, the polypeptide is an enzyme. In some embodiments, the enzyme is a lysosomal enzyme or adenosine deaminase.

[0413] In some implementations, the polypeptide is an antibody.

[0414] In some implementations, the polypeptide is a secreted protein.

[0415] In some embodiments, the payload is or contains an RNA molecule. In some embodiments, the RNA molecule is siRNA, miRNA, gRNA, antisense RNA, circular RNA, snRNA, or an aptamer, or a combination thereof.

[0416] In some embodiments, the payload is or comprises a DNA molecule. In some embodiments, the DNA molecule comprises a nucleic acid sequence of up to 5,100 nt in length, such as up to about 5,000 nt, up to about 4,900 nt, up to about 4,800 nt, up to about 4,700 nt, up to about 4,600 nt, up to about 4,500 nt, up to about 4,400 nt, etc.

[0417] In some embodiments, the RNA molecule targets a nucleic acid molecule encoding a polypeptide associated with a CNS condition. In some embodiments, the CNS condition is the CNS condition disclosed herein. In some embodiments, the CNS condition is selected from: Friedreich ataxia, Drave syndrome, spinocerebellar ataxia type 3, Niemann-Pick type C, Huntington's disease, Pompe disease, myotonic dystrophy type 1, glucose transporter 1 deficiency syndrome (Devivo syndrome), Tay-Sachs disease, spinal muscular atrophy, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Danon disease, Rett syndrome, Angelman syndrome, hereditary epilepsy (e.g., STXBP1 hereditary epilepsy or CDKL5 hereditary epilepsy), or combinations thereof.

[0418] Promoters for AAV particles containing variant AAV capsid proteins rAAV particles containing the variant AAV capsid protein disclosed herein may contain a heterologous nucleotide sequence encoding a payload, which is operatively linked to a promoter or a variant or fragment thereof.

[0419] In some embodiments, the promoter is a CNS cell or tissue-specific promoter, or a variant or fragment thereof. In some embodiments, the CNS promoter is selected from: the glial fibrillary acidic protein (GFAP) promoter or a variant or fragment thereof, the synaptic protein-1 (SYN1) promoter or a variant or fragment thereof, the neuron-specific enolase / RU5' (NSE / RU5') promoter or a variant or fragment thereof, the neuroactive peptide cholecystokinin (CCK) promoter or a variant or fragment thereof, the myelin basic promoter (MBP) or a variant or fragment thereof, the human myelin-associated glycoprotein promoter or a variant or fragment thereof, the phosphate-activated glutaminase (PAG) promoter or a variant or fragment thereof, the vesicular glutamate transporter (vGLUT) promoter or a variant or fragment thereof, the glutamate decarboxylase (GAD) promoter or a variant or fragment thereof, or any combination thereof.

[0420] In some implementations, the CNS promoter is the human SYN1 (hSYN1) promoter or a variant or fragment thereof. An exemplary hSYN1 promoter sequence is provided as SEQ ID NO: 2007.

[0421] AGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGGGGGTGCCTACCTGACGACCGACCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGAGAGGGGGAGGGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGCGGACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCCACCGCCGCCTC AGCACTGAAGGCGCCGCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCCTCCGGCCACCTTGGTCGCGTCCGCGCCGCCGCCGGCCCAGCCGGACCGCACCACGCGAGGCGCGAGATAGGGGGGCACGGGCGCGACCATCTGCGCTGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGGCAGCGGAGGAGTCGTGTCGTGCCTGAGAGCGCAG(SEQ ID NO: 2007) In some implementations, the CNS promoter is the GFAP promoter or a variant or fragment thereof. An exemplary GFAP promoter sequence is provided as SEQ ID NO: 2008.

[0422] AACATATCCTGGTGTGGAGTAGGGGACGCTGCTCTGACAGAGGCTCGGGGGCCTGAGCTGGCTCTGTGAGCTGGGGAGGAGGCAGACAGCCAGGCCTTGTCTGCAAGCAGACCTGGCAGCATTGGGCTGGCCGCCCCCCAGGGCCTCCTCTTCATGCCCAGTGAATGACTCACCTTGGCACAGACACAATGTTCGGGGTGGGCACAGTGCCTGCTTCCCGCCGCACCCCAGCCCCCCTCAAATGCCTTCCGAGAAGCCCATTGAGCAGGGGGCTTGCATTGCACCCCAGCCTGACAGCCTGGCATCTTGGGATAAAAGCAGCACAGCCCCCTAGGGGCTGCCCTTGCTGTGTGGCGCCACCGGCGGTGGAGAACAAGGCTCTATTCAGCCTGTGCCCAGGAAAGGGGATCAGGGGATGCCCAGGCATGGACAGTGGGTGGCAGGGGGGGAGAGGAGGGCTGTCTGCTTCCCAGAAGTCCAAGGACACAAATGGGTGAGGGGAGAGCTCTCCCCATAGCTGGGCTGCGGCCCAACCCCACCCCCTCAGGCTATGCCAGGGGGTGTTGCCAGGGGCACCCGGGCATCGCCAGTCTAGCCCACTCCTTCATAAAGCCCTCGCATCCCAGGAGCGAGCAGAGCCAGAGCAGGTTGGAGAGGAGACGCATCACCTCCGCTGCTCGC (SEQ ID NO: 2008) In some embodiments, the CNS promoter is the chicken beta-actin hybrid (CBh) promoter or a variant or fragment thereof. An exemplary CBh promoter sequence is provided as SEQ ID NO: 2009.

[0423] CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATG GCCCGCCTGGCATTGTGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCTCCCCACCCCCAATTTTGTATTTATTTTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGG GGGGGGGGGGGGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGACGCTGCCTTCGCCCCGT GCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGCCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTTCTCCTCCGGGCTGTAATTAGCTGAGCAAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTAATTACCTGGAGCACCTGCCTGAAATCACTTTTTTTCAG (SEQ ID NO: 2009) Uses of AAV particles containing variant AAV capsid proteins This disclosure provides, in particular, a method for delivering a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles as described herein to cells or tissues (e.g., CNS cells or tissues). This disclosure also provides a method for treating a subject with a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles generated using the methods or systems described herein.

[0424] In some embodiments, this document discloses a method for treating CNS conditions in a subject, comprising administering a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles as described herein.

[0425] In some embodiments, this document also discloses a method for improving symptoms of CNS disorders in a subject, comprising administering a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles as described herein.

[0426] In some implementations, CNS disorders are the result of genetic abnormalities.

[0427] In some implementation schemes, CNS disorders are not the result of genetic abnormalities.

[0428] In some implementations, CNS diseases are those disclosed herein.

[0429] Exemplary CNS conditions are disclosed in international patent application PCT / US2019 / 054345, filed on October 2, 2019, the entire contents of which are incorporated herein by reference.

[0430] In some implementations, the CNS condition is selected from one or more of the following: Friedreich ataxia, Drave syndrome, spinocerebellar ataxia type 3, Niemann-Pick type C, Huntington's disease, Pompe disease, myotonic dystrophy type 1, glucose transporter 1 deficiency syndrome (Devivo syndrome), Tay-Sachs disease, spinal muscular atrophy, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Danon disease, Rett syndrome, Angelman syndrome, Parkinson's disease, tau proteinosis, or hereditary epilepsy (e.g., STXBP1 hereditary epilepsy or CDKL5 hereditary epilepsy). In some implementations, the CNS condition is selected from one or more of the following: (a) neuromuscular diseases, such as amyotrophic lateral sclerosis (ALS), Huntington's disease, or myotonic dystrophy; (b) Alzheimer's disease; (c) amplified duplication diseases, such as Huntington's disease or myotonic dystrophy; or (d) any one or a combination of all of (a)-(c).

[0431] In some embodiments, a composition comprising multiple rAAV particles as described herein (e.g., a pharmaceutical composition) is administered to a subject who has a disease, condition, or disorder, or who is at risk of a disease, condition, or disorder. In some embodiments, a composition comprising multiple rAAV particles as described herein (e.g., a pharmaceutical composition) is administered to a subject in combination with one or more additional therapeutic agents. In some embodiments, a composition comprising multiple rAAV particles as described herein (e.g., a pharmaceutical composition) is brought into contact with an organ, tissue, or cell outside the body. The organ, tissue, or cell may be introduced into the subject and may be protected from damage that would otherwise be caused by the recipient's immune system.

[0432] In some embodiments, the methods and kits of the present invention can be used to evaluate and / or monitor gene therapy. In some embodiments, gene therapy includes administration of a composition comprising a plurality of rAAV particles described herein (e.g., a pharmaceutical composition). In some embodiments, samples for evaluating and / or monitoring gene therapy can be obtained before gene therapy is initiated. In some embodiments, samples are obtained after a first gene therapy treatment or dose. In some embodiments, samples are obtained after the end of gene therapy. In some embodiments, samples are obtained at specific time points, intervals, or any other time measure before, during, or after gene therapy.

[0433] Methods of transfecting host cells with AAV particles containing variant AAV capsid proteins This disclosure provides, in particular, a method for transfecting host cells, the method comprising: combining a nucleic acid with a transfection reagent, and introducing the mixture into the host cell under conditions that result in transfection of the host cell with the nucleic acid.

[0434] In some embodiments, the nucleic acid used in the methods disclosed herein comprises one or more vectors. In some embodiments, the nucleic acid disclosed herein comprises one or more vectors encoding: (i) at least one payload having an AAV inverted terminal repeat (ITR) sequence side-attached to either side of the at least one payload, (ii) at least one AAVRep polypeptide, (iii) at least one AAV Cap polypeptide, and / or (iv) at least one adenovirus helper polypeptide.

[0435] The host cell (e.g., a mammalian host cell, such as HEK293) can be transfected with at least one helper peptide or nucleic acid (e.g., at least one Ad2 helper peptide or nucleic acid), at least one Rep peptide or a fragment thereof, at least one Cap peptide or a fragment thereof, and at least one payload (e.g., for peptide expression or inhibitory or directing nucleic acid).

[0436] In some embodiments, the transfection methods disclosed herein may include transient transfection. In some embodiments, the transient transfection method is suspension transient transfection (sTT). In some embodiments, the transient transfection method is adherent transient transfection.

[0437] In some embodiments, this disclosure provides transfected host cells comprising two, three, or four vectors as described herein.

[0438] In some embodiments, the method includes transfecting host cells with three vectors. In some embodiments, the three vectors include: (i) a first vector encoding at least one payload, wherein the at least one payload is side-contacted with an AAV ITR on either side; (ii) a second vector encoding at least one AAV Rep peptide and at least one AAV Cap peptide; and (iii) a third vector encoding at least one adenovirus helper peptide.

[0439] In some embodiments, the method includes transfecting host cells with two vectors. In some embodiments, the two vectors include: (i) a first vector encoding at least one AAV Cap polypeptide and at least one payload, wherein the at least one payload is side-loaded with an AAV ITR on either side; and (ii) a second vector encoding at least one adenovirus helper polypeptide and at least one AAV Rep polypeptide.

[0440] The transfection methods disclosed herein include transfecting nucleic acids (e.g., containing one or more vectors) with any transfection reagent known to those skilled in the art for introducing nucleic acid molecules into host cells (e.g., mammalian cells, such as HEK293). In some embodiments, the transfection reagent comprises lipids, polymers, or combinations thereof. In some embodiments, the transfection reagent is a reagent capable of forming a complex with nucleic acids.

[0441] In some embodiments, the transfection reagent comprises a polymer, a lipid, or both a polymer and lipids. In some embodiments, the transfection reagent is or comprises a polymer. In some embodiments, the transfection reagent is or comprises a lipid. In some embodiments, the transfection reagent comprises both a polymer and lipids.

[0442] In some embodiments, the transfection agent is or comprises a polymer, such as a cationic polymer. In some embodiments, the transfection agent comprises polyethyleneimine (PEI), FectoVIR, TransIT-VirusGEN, or combinations thereof. In some embodiments, the transfection agent is or comprises polyethyleneimine (PEI).

[0443] In some embodiments, host cells are transfected with PEI. In some embodiments, host cells are transfected with a DNA to transfection reagent (e.g., PEI) weight (wt.) ratio of about 1:1 to about 1:2, about 1:1 to about 1:5, or about 1:1 to about 1:10, for example, about 1:0.05, about 1:1, about 1:1.25, about 1:1.5, about 1:2, about 1:2.5, about 1:3, about 1:3.5, about 1:4, about 1:4.5, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9, or about 1:10. In some embodiments, the DNA to transfection reagent weight ratio depends on the cell culture density (e.g., adherent or suspension host cells).

[0444] In some embodiments, the transfection method disclosed herein uses the following vector mass ratio: (i) a first vector encoding at least one payload, (ii) a second vector encoding at least one Rep peptide and / or at least one Cap peptide, and (iii) a third vector encoding at least one accessory peptide. In some embodiments, the vector mass ratio of (i) the first vector encoding at least one payload to (ii) the second vector encoding at least one Rep peptide and / or at least one Cap peptide to (iii) the third vector encoding at least one accessory peptide is approximately 1:1:1. In some embodiments, the vector mass ratio of (i) the first vector encoding at least one payload to (ii) the second vector encoding at least one Rep peptide and / or at least one Cap peptide to (iii) the third vector encoding at least one accessory peptide is not approximately 1:1:1.

[0445] In some embodiments, the mass ratio of (i) a first vector encoding at least one payload to (ii) a second vector encoding at least one Rep peptide and / or at least one Cap peptide to (iii) a third vector encoding at least one accessory peptide is about 1:0.5:1, about 1:1:2, about 1:1:3, about 1:1:4, about 1:1:5, about 1:1:6, about 1:1:7, about 1:1:8, about 1:1:9, about 1:1:10, about 5:10:1, or about 1:0.5: 2. Approximately 1:0.5:10, Approximately 1:0.5:5, Approximately 0.5:5:1, Approximately 1:10:20, Approximately 1:2:1, Approximately 1:3:1, Approximately 1:4:1, Approximately 1:5:1, Approximately 1:6:1, Approximately 1:7:1, Approximately 1:8:1, Approximately 1:9:1, Approximately 1:10:1, Approximately 10:1:1, Approximately 9:1:1, Approximately 8:1:1, Approximately 7:1:1, Approximately 6:1:1, Approximately 6:1:1, Approximately 4:1:1, Approximately 3:1:1, Approximately 2:1:1 or Approximately 1:0.5:5.

[0446] In some embodiments, the mass ratio of (i) a first carrier encoding at least one payload to (ii) a second carrier encoding at least one Rep polypeptide and / or at least one Cap polypeptide to (iii) a third carrier encoding at least one accessory polypeptide is about 1:0.5:1 to about 1:0.5:10; about 1:1:1 to about 1:1:10; about 0.5:1:1 to about 5:1:1; about 1:1:1 to about 1:10:1; or about 1:1:1 to about 10:1:1.

[0447] host cells This disclosure particularly provides host cells for transfection with at least one vector described herein to produce rAAV particles. Host cells include progeny cells of the original cell transfected with at least one vector described herein. Due to natural, accidental, or intentional mutations, progeny cells of the parent cell may be substantially different from the parent cell in morphology or genomic content.

[0448] Components for generating rAAV particles from host cells can be provided trans-present on at least one vector. Stable host cells may contain at least one polypeptide for generating rAAV particles using methods known to those skilled in the art. In some embodiments, stable host cells contain at least one polypeptide under the control of an inducible promoter. In other embodiments, stable host cells contain at least one polypeptide under the control of a constitutive promoter. For example, stable host cells (e.g., HEK293 cells) may contain nucleic acids encoding an E1 helper polypeptide under the control of a constitutive promoter. Other stable host cells may be generated by those skilled in the art using conventional methods.

[0449] Exemplary host cells include prokaryotes or eukaryotes (single-celled or multi-celled), bacterial cells (e.g., Escherichia coli, Bacillus spp.) Bacillus spp. Streptomyces ( Streptomyces spp.) Strains), mycobacterial cells, fungal cells, yeast cells (e.g., Saccharomyces cerevisiae), S.cerevisiae ), Saccharomyces cerevisiae ( S.pombe Pichia pastoris () P. pastoris ), Pichia pastoris () P. methanolica Plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells or *Spodoptera litura* cells), plant ... *Spodoptera litura* cells), plant cells, insect cells (e.g., SF-9, SF Trichoplusia ni ()), non-human animal cells, human cells, or cell fusions, such as hybridomas or tetramorphic hybridomas. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a human, monkey, ape, hamster, rat, or mouse cell.

[0450] In some embodiments, the host cells are selected from: kidney cells (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, or BHK), CHO cells (e.g., CHO Kl, DXB-1 1 CHO, or Veggie-CHO), COS cells (e.g., COS-7), retinal cells, Vero cells, CV1 cells, HepG2 cells, WI38 cells, MRC 5 cells, Colo205 cells, HB8065 cells, HL-60 cells (e.g., BHK21), Jurkat cells, Daudi cells, A431 cells (epidermal), CV-1 cells, U937 cells, 3T3 cells, L cells, C127 cells, SP2 / 0 cells, NS-0 cells, MMT 060562 cells, Sertoli cells, BRL 3A cells, HT1080 cells, myeloma cells, tumor cells, or cell lines derived from the above cells.

[0451] In some embodiments, the host cell includes kidney cells (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, or BHK). In some embodiments, the host cell includes HEK293 cells. In some embodiments, the host cell (e.g., HEK 293 cells) contains or expresses the E1 peptide. In some embodiments, the host cell does not contain or express the E1 peptide. In some embodiments, the host cell includes CHO cells (e.g., CHO-K, DXB-1 CHO, or Veggie-CHO). In some embodiments, the host cell includes CHO-K cells.

[0452] In some embodiments, the host cells are or comprise suspension cells. In some embodiments, at least 10% + / - 15%, at least 15 + / - 15%, at least 20 + / - 15%, at least 25 + / - 15%, at least 30 + / - 15%, at least 35 + / - 15%, at least 40 + / - 15%, at least 45 + / - 15%, at least 50 + / - 15%, at least 55 + / - 15%, at least 60 + / - 15%, at least 65 + / - 15%, at least 70 + / - 15%, at least 75 + / - 15%, at least 80 + / - 15%, at least 85 + / - 15%, at least 90 + / - 15%, at least 95 + / - 15%, at least 99 + / - 15% or more of the host cells in the culture are in suspension.

[0453] In some embodiments, host cells (e.g., adherent or suspension host cells) are seeded at a certain density prior to transfection. In some embodiments, at a density of at least about 1.0 x 10⁻⁶ cells prior to transfection. 4 live cells (VC) / cm 2 Seed host cells at a density of approximately 1.0 x 10⁻⁶ (e.g., adherent host cells). 4 vc / cm 2 From approximately 2.0 x 10 4 vc / cm 2 The density, for example, is about 1.0 x 10⁻⁶. 4 vc / cm 2 Approximately 1.1 x 10 4 vc / cm 2 Approximately 1.2 x 10 4 vc / cm 2 Approximately 1.3 x 10 4 vc / cm 2 Approximately 1.4 x 10 4 vc / cm 2 Approximately 1.5 x 10 4 vc / cm 2 Approximately 1.6 x 10 4 vc / cm 2 Approximately 1.7 x 10 4 vc / cm 2 Approximately 1.8 x 10 4 vc / cm 2 Approximately 1.9 x 10 4 vc / cm 2 or approximately 2.0 x 10 4 vc / cm 2 In some implementations, prior to transfection, at a concentration of at least 1.0 x 10⁻⁶... 6 vc / cm 2 Seed host cells at a density of + / - 15% (e.g., suspension host cells), for example at 1.0 x 10⁻⁶. 6 vc / cm 2 + / - 15% to 2.0 x 10 6 vc / cm 2 + / - 15% density, for example, 1.0 x 10 6 vc / cm 2 + / - 15%, 1.1 x 10 6 vc / cm 2 + / - 15%, 1.2 x 10 6 vc / cm 2+ / - 15%, 1.3 x 10 6 vc / cm 2 + / - 15%, 1.4 x 10 6 vc / cm 2 + / - 15%, 1.5 x 10 6 vc / cm 2 + / - 15%, 1.6 x 10 6 vc / cm 2 + / -15%, 1.7 x 10 6 vc / cm 2 + / - 15%, 1.8 x 10 6 vc / cm 2 + / - 15%, 1.9 x 10 6 vc / cm 2 + / - 15% or 2.0 x 10 6 vc / cm 2 + / - 15%.

[0454] carrier Many forms of vectors can be used in the methods for producing the rAAV particles described herein. Non-limiting examples of vectors include plasmids, phage vectors, granules, phage particles, artificial chromosomes, and viral vectors (e.g., vectors suitable for gene therapy). Vector genetic elements can be delivered to a person skilled in the art, for example, by any suitable method known in the art, including genetic engineering, recombination engineering, and synthetic techniques (see, for example, Sambrook 1989 cited herein).

[0455] In some embodiments, the vector encodes at least one accessory polypeptide. In some embodiments, the vector encodes at least one Rep polypeptide and / or at least one Cap polypeptide. In some embodiments, the vector encodes at least one payload (e.g., for expressing a polypeptide or as an inhibitory or guide nucleic acid). In some embodiments, the vector encodes at least one accessory polypeptide and at least one Rep polypeptide. In some embodiments, the vector encodes at least one Cap polypeptide and at least one payload.

[0456] Vectors may include conventional control elements operatively linked to nucleic acids encoding any of the polypeptides or payloads described herein in a manner that allows transcription, translation, and / or expression in cells transfected with vectors described herein. Expression control sequences include appropriate transcription initiation, termination, promoter, and enhancer sequences; effective RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences stabilizing cytoplasmic mRNA; sequences enhancing translation efficiency (e.g., Kozak concordant sequences); sequences enhancing protein stability; and sequences enhancing secretion of the encoded product when needed. A variety of expression control sequences, including native, constitutive, inducible, and / or tissue-specific promoters, are known in the art and may be included in vectors described herein.

[0457] Examples of constitutive promoters include, but are not limited to, the retro-transcribed Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer), the SV40 promoter, and the dihydrofolate reductase promoter.

[0458] Inducible promoters allow for the regulation of gene expression and can be modulated by the presence of exogenously provided compounds, environmental factors (such as temperature), or specific physiological states (e.g., acute phase, specific differentiation state of the cell, or only in replicating cells). Inducible promoters and inducible systems are derived from a variety of commercial sources, including but not limited to Invitrogen, Clontech, and Ariad. Many other systems have been described and can be readily selected by those skilled in the art. Examples of inducible promoters regulated by exogenously provided promoters include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system, the ecdysone insect promoter, the tetracycline inhibitory system, the tetracycline inducible system, the RU486 inducible system, and the rapamycin inducible system. Other types of potentially useful inducible promoters are regulated by specific physiological states, such as temperature, acute phase, specific differentiation state of the cell, or only in replicating cells.

[0459] In another embodiment, a natural promoter or fragment thereof encoding a nucleic acid encoding any of the polypeptides or payloads described herein may be used. In some embodiments, other natural expression control elements, such as enhancer elements, polyadenylation sites, or Kozak concordant sequences, may also be used to mimic natural expression.

[0460] Vectors encoding accessory peptides This disclosure particularly provides vectors (e.g., plasmids) encoding at least one helper polypeptide. AAV is a helper-dependent DNA parvovirus, belonging to the helper-dependent virus (AAV) family. DependovirusThe preparation of recombinant AAV requires co-infection with a related virus (e.g., adenovirus, herpesvirus, or vaccinia virus) or an auxiliary vector encoding helper peptides (such as structural proteins and proteins used for viral genome replication).

[0461] Helper vectors may contain nucleotide sequences for non-AAV-derived viral and / or cellular functions upon which AAV replication depends, including but not limited to activation of gene transcription, stage-specific mRNA splicing, DNA replication, synthesis of at least one Cap polypeptide, and / or capsid assembly. Virus-based helper polypeptides may be derived from any known helper virus, such as adenovirus, herpesvirus, vaccinia virus, or combinations thereof. Thus, helper vectors (e.g., plasmids) used for culturing host cells may contain sufficient helper polypeptides to allow the packaging of recombinant AAV vectors into AAV capsid polypeptides.

[0462] In some embodiments, the helper vector comprises an Ad2 helper vector. In some embodiments, the nucleic acid sequence of the Ad2 helper vector is derived from the adenovirus 2 genome (GenBank accession number J01917.1). In some embodiments, the helper vector comprises an Ad5 helper vector. In some embodiments, the nucleic acid sequence of the Ad5 helper vector is derived from the adenovirus 5 genome (GenBank accession number AY601635).

[0463] The accessory polypeptide and nucleic acid may include at least one, two, three, or four of E1, E2a, E4, or VA RNA. In some embodiments, E1 includes E1a and / or E1b. In some embodiments, one or both of E2a and VA RNA increase the stability and / or efficiency of AAV mRNA translation, such as for... cap Gene transcripts. In some embodiments, E4 promotes DNA replication. In some embodiments, E1a contains a transactivator (e.g., a regulator of at least one Ad gene, AAV). rep Genes and / or AAV cap (Gene activity). In some embodiments, E1b contains viral mRNA transport. Helper peptides are described in Coura Rdos. and Nardi BN., (2008). Genetics and Molecular Biology 31(1): Further details are provided on pages 1-11, and the references are incorporated herein by reference in their entirety.

[0464] In some embodiments, the helper vector includes a selection marker. Exemplary selection markers include, but are not limited to, antibiotic resistance genes. In some embodiments, the antibiotic resistance gene is not a gene encoding penicillin. In some embodiments, the antibiotic resistance gene is not a gene encoding a penicillin derivative. In some embodiments, the antibiotic resistance gene includes an antibiotic resistance gene selected from: kanamycin, puromycin, neomycin, hygromycin, blastomycin, gentamicin, Gr18, or bleomycin. In some embodiments, the antibiotic resistance gene includes an antibiotic resistance gene against kanamycin.

[0465] In some embodiments, the nucleic acid encoding the accessory polypeptide is oriented in the same direction (e.g., 5' to 3') on the accessory vector. In some embodiments, the nucleic acid encoding the accessory polypeptide is transcribed from the accessory vector in the same direction. In some embodiments, the accessory polypeptide and nucleic acid comprise VA RNA and E4 oriented in the same direction on the accessory vector. In some embodiments, the accessory polypeptide comprises E4 and E2a oriented in the same direction on the accessory vector. In some embodiments, the accessory polypeptide and nucleic acid comprise VA RNA, E4, and E2a oriented in a 5' to 3' direction on the accessory vector. In some embodiments, the accessory vector does not contain a nucleic acid sequence encoding fibrin or a fragment thereof (e.g., does not contain the nucleic acid sequence or a fragment thereof of GenBank accession number AP_000226.1).

[0466] Vectors encoding Rep and / or Cap peptides This disclosure particularly provides vectors (e.g., plasmids) encoding at least one Rep polypeptide and / or at least one Cap polypeptide (e.g., the variant Cap disclosed herein). Generation of rAAV particles may include culturing host cells with at least one Rep polypeptide and at least one Cap polypeptide (e.g., the variant Cap disclosed herein). Rep proteins (e.g., one, two, three, or four of Rep78, Rep68, Rep52, and Rep40) are involved in viral DNA replication, the resolution of replication intermediates, and the generation of single-stranded genomes. In some embodiments, the vector comprises a nucleic acid sequence encoding one, two, three, or four of Rep78, Rep68, Rep52, or Rep40, or a variant of any of the foregoing.

[0467] In some embodiments, the Rep polypeptide comprises a nucleic acid sequence derived from the AAV2 serotype. For example, the nucleic acid sequence encoding the Rep polypeptide may be derived from the AAV2 genome (as found in accession number NC_001401). In some embodiments, the Rep polypeptide comprises an AAV2 Rep polypeptide (as found in accession number NC_001401) operatively linked to a p5 and / or p19 promoter. In some embodiments, the Rep polypeptide comprises the amino acid sequence of YP_680422.1 or a fragment thereof. In some embodiments, a promoter is operatively linked to a nucleic acid sequence encoding at least one Rep polypeptide. In some embodiments, the promoter operatively linked to the nucleic acid sequence encoding at least one Rep polypeptide comprises a p5 and / or p19 promoter. In some embodiments, a wild-type promoter of AAV2 or a variant thereof is operatively linked to a nucleic acid sequence encoding at least one Rep polypeptide. In some embodiments, the promoter regulating the expression of at least one Rep polypeptide (e.g., a p5 promoter) is located on the vector at a different position than the wild-type promoter of AAV2 or a variant thereof. In some embodiments, the promoter (e.g., the p5 promoter) is located at the 3' of the nucleic acid encoding at least one Rep polypeptide.

[0468] Cap peptides (e.g., VP1, VP2, and VP3) are structural proteins that contain a capsid. In some embodiments, the vector contains a nucleic acid sequence encoding one, two, or all three of VP1, VP2, and VP3, such as a variant AAV capsid disclosed herein. In some embodiments, the vector includes a nucleic acid sequence encoding at least one Cap peptide (e.g., a variant AAV capsid peptide disclosed herein) and at least one Rep peptide. In other embodiments, the vector encodes at least one Cap peptide (e.g., a variant AAV capsid peptide disclosed herein), and the vector alone encodes at least one Rep peptide.

[0469] For example, the nucleic acid sequence encoding a Cap polypeptide comprising the AAV variant capsid protein disclosed herein may further comprise a nucleic acid sequence derived from a known AAV genome sequence, including but not limited to: AAV9 / hu14 provided as SEQ ID NO: 123 in U.S. Patent 7,906,111; AAV1 accession number NC_002077 or AF063497; AAV2 accession number NC_001401; AAV5 accession number Y18065 or AF085716; accession number AAV6 NC_001862; or AAV8 accession number NC_006261.1 In some embodiments, the nucleic acid sequence encoding a Cap polypeptide (e.g., the variant AAV capsid polypeptide disclosed herein) is derived from the AAV genome sequence or a variant thereof as described in U.S. Patent No. 7,906,111, which is incorporated herein by reference in its entirety. In some embodiments, the nucleic acid sequence encoding the Cap polypeptide (e.g., the variant AAV capsid polypeptide disclosed herein) is derived from the AAV genome sequence or a variant thereof as described in International Publication No. WO 2018 / 160582, which is incorporated herein by reference in its entirety.

[0470] In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV2 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV1 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV2 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV3B serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV5 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV8 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV9 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV4 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV7 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV10 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV11 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV12 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAV13 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein further comprises a nucleic acid sequence derived from the AAVhu68 serotype or a variant thereof. In some embodiments, the Cap polypeptide comprising the AAV variant capsid protein disclosed herein also comprises a nucleic acid sequence derived from the AAVrh10 serotype or a variant thereof.

[0471] In some embodiments, the promoter is operatively linked to a nucleic acid sequence encoding at least one Cap polypeptide comprising a variant capsid protein of the AAV disclosed herein. In some embodiments, wild-type promoters of AAV2, AAV5, AAV8, and AAV9 are operatively linked to a nucleic acid sequence encoding at least one Rep polypeptide. In some embodiments, the p40 promoter is operatively linked to a nucleic acid sequence encoding at least one Cap polypeptide comprising a variant capsid protein of the AAV disclosed herein.

[0472] carrier of encoded payload This disclosure particularly provides vectors (e.g., plasmids) encoding at least one payload. The payload sequence is typically a sequence of interest that is intended to be introduced into a cell, tissue, organ, or organism.

[0473] In some implementations, the payload is side-mounted with an inverted terminal repeat (ITR). The AAV sequence of the rAAV vector typically contains cis-acting 5' and 3' inverted terminal repeat (ITR) sequences (see, for example, Carter BJ, (1990)). Handbook of Parvoviruses (I): Pages 155-168, the cited references are incorporated herein by reference in their entirety. ITR sequences are typically about 145 nt in length. In some embodiments, one or both of the 5' ITR or 3' ITR nucleic acid sequences are modified relative to a known ITR nucleic acid sequence. Modification of the ITR nucleic acid sequence is within the scope of the art (see, for example, Sambrook J. 1989; and Fisher K. et al., (1996)). J Virol 70: Pages 520-532, each of which is incorporated herein by reference in its entirety. AAV ITR sequences can be obtained from any known AAV, including mammalian AAV types.

[0474] In some embodiments, the payload is a heterologous protein with therapeutic purposes, such as an enzyme, cytokine, antibody, receptor, fusion protein, or chimeric peptide. In some embodiments, the payload is linked to a secretion signal sequence for secreting an expressed peptide from a host cell. In some embodiments, the payload is a heterologous nucleic acid with therapeutic purposes, such as miRNA, siRNA, shRNA, mRNA, snRNA, or CRISPR / Cas guide RNA or precursors thereof. Those skilled in the art will recognize that the payload can be selected from any heterologous protein or nucleic acid of interest. In some embodiments, the payload sequence includes one or more aptamer-binding domains or peptide-binding domains (e.g., transcription factor-binding domains). The vector typically also includes other regulatory elements (e.g., promoters, introns, and / or enhancers) to regulate the expression or amount of the payload in cells or tissues.

[0475] According to various embodiments, the payload sequence can have any length, such as any integer value between 2 nucleotides and 10,000 nucleotides or elsewhere. In some embodiments, the nucleic acid sequence encoding the payload comprises at least 20 nucleotides, at least 50 nucleotides, at least 75 nucleotides, at least 100 nucleotides, at least 150 nucleotides, at least 200 nucleotides, at least 250 nucleotides, at least 300 nucleotides, at least 350 nucleotides, at least 400 nucleotides, at least 450 nucleotides, at least 500 nucleotides, at least 550 nucleotides, at least 600 nucleotides, at least 650 nucleotides, at least 700 nucleotides, at least 750 nucleotides, at least 800 nucleotides, at least 850 nucleotides, at least 90 nucleotides. 0 nucleotides, at least 950 nucleotides, at least 1000 nucleotides, at least 1100 nucleotides, at least 1200 nucleotides, at least 1300 nucleotides, at least 1400 nucleotides, at least 1500 nucleotides, at least 1600 nucleotides, at least 1700 nucleotides, at least 1800 nucleotides, at least 2000 nucleotides, at least 2500 nucleotides, at least 3000 nucleotides, at least 4000 nucleotides, at least 5000 nucleotides, at least 6000 nucleotides, at least 7000 nucleotides, at least 8000 nucleotides, at least 9000 nucleotides. In some implementations, the nucleic acid sequence encoding the payload comprises a length of 50 to 25,000 nucleotides, 100 to 20,000 nucleotides, 500 to 10,000 nucleotides, 1,000 to 8,000 nucleotides, and / or 2,000 to 5,000 nucleotides.

[0476] Culture containers and culture parameters This disclosure provides, in particular, a method for culturing host cells using at least one of the vectors described herein to produce rAAV particles. Various growth media (e.g., mammalian growth media) can be used according to the invention. In some embodiments, cells can be grown in one of a variety of chemically defined media, wherein the components of the media are both known and controlled. In some embodiments, cells can be grown in a composite media, wherein not all components of the media are known and / or controlled.

[0477] Cultures of host cells can be prepared in any culture medium suitable for the specific cell type being cultured. In some embodiments, the host cell culture medium contains, for example: inorganic salts, carbohydrates (e.g., sugars such as glucose, galactose, maltose, or fructose), amino acids, vitamins (e.g., B vitamins (e.g., B12), vitamin A, vitamin E, riboflavin, thiamine, or biotin), fatty acids (e.g., cholesterol or steroids), proteins (e.g., albumin, transferrin, fibronectin, or fetoglobulin), serum (e.g., albumin, growth factors, or growth inhibitors such as fetal bovine serum, newborn calf serum, or horse serum), trace elements (e.g., zinc, copper, selenium, or tricarboxylic acid intermediates), hydrolysates (e.g., derived from plant or animal sources), or combinations thereof.

[0478] Commercially available culture media can be used to culture the host cells described herein. Exemplary culture media may include, but are not limited to, Dulbecco's modified Eagle's medium ([DMEM], Sigma), FreeStyle™ F17 expression medium (ThermoFisher), DMEM / F12 medium (Invitrogen), CD OptiCHO™ medium (Invitrogen), CDEfficientFeed™ medium (Invitrogen), Cell Boost (HyClone™) medium (GE LifeSciences), BalanCD™ CHO Feed (Irvine Scientific), BD Recharge™ (BectonDickinson), Cellvento Feed™ (EMD Millipore), Ex-cell CHOZN Feed™ (Sigma-Aldrich), CHO Feed bioreactor supplement (Sigma-Aldrich), SheffCHO™ (Kerry), Zap-CHO™ (Invitria), ActiCHO™ (PAA / GE Healthcare), minimum essential medium (Sigma), or RPMI-1640 (Sigma). The culture medium may be supplemented as needed with hormones and / or other growth factors (e.g., insulin, transferrin, or epidermal growth factor), salts (e.g., sodium chloride, calcium, magnesium, or phosphate), buffers (e.g., HEPES), nucleosides (e.g., adenosine or thymidine), antibiotics (e.g., kanamycin, puromycin, neomycin, hygromycin, blastomycin, gentamicin, Gr18, or bleomycin), trace elements, lipids (e.g., linoleic acid or other fatty acids), or glucose or equivalent energy. In some embodiments, the culture medium for culturing host cells contains glutamine or glutamine dipeptide. In some embodiments, the culture medium for culturing host cells contains surfactants. In some embodiments, the nutrient medium is a serum-free medium, a protein-free medium, or a chemically defined medium. Any other necessary supplements at appropriate concentrations known to those skilled in the art may also be included.

[0479] After culturing host cells as described herein, multiple rAAV particles are recovered. In some embodiments, rAAV particles are recovered by lysing the host cells and recovering the rAAV particles from the lysate, for example, after centrifugation. In some embodiments, rAAV particles are recovered from the culture supernatant. In some embodiments, the lysis solution used for the host cells contains chemical reagents such as detergents (e.g., sodium dodecyl sulfate (SDS), ethyltrimethylammonium bromide, Triton X-100, bile salts (such as bile salts), or zwitterionic detergents (such as CHAPS)). In some embodiments, the lysis solution used for the host cells contains salts (e.g., NaCl) and a high pH (e.g., a pH greater than about 7). In some embodiments, the rAAV particles are purified using purification methods such as chromatography (e.g., affinity chromatography), ion exchange chromatography (e.g., cation exchange chromatography), or filtration (e.g., UF / DF filtration).

[0480] In some implementations, multiple rAAV particles are generated during large-scale preparation. In some embodiments, large-scale preparation of host cells (e.g., suspension host cells) involves at least 3 liters of medium plus / min, 10 liters of medium plus / min, for example, mediums between 50 liters plus / min and 1000 liters plus / min, or mediums between 50 liters plus / min and 2000 liters plus / min, for example, at least 20 liters plus / min, 30 liters plus / min, 40 liters plus / min, 50 liters plus / min, 55 liters plus / min, 60 liters plus / min, 65 liters plus / min, 70 liters plus / min, 75 liters plus / min, 80 liters plus / min, 85 liters plus / min, 90 liters plus / min, 95 liters plus / min, 100 liters plus / min, 200 liters plus / min 15%, 300L + / - 15%, 400L + / - 15%, 500L + / - 15%, 600L + / - 15%, 700L + / - 15%, 800L + / - 15%, 900L + / - 15%, 1,000L + / - 15%, 1,250L + / - 15%, 1,500L + / - 15%, 1,750L + / - 15%, 2,000L + / - 15% or more of culture medium.

[0481] In some implementations, the large-scale production of host cells (e.g., adherent host cells) is at least 5 m 2 + / - 15% of culture medium, for example, 5 ml 2 + / - 15% to 500 m 2 Culture medium between + / - 15%, for example, at least 5 ml 2+ / -15%、10 m 2 + / - 15%、15 m 2 + / - 15%、20 m 2 + / - 15%、25 m 2 + / - 15%、20 m 2 + / - 15%、35 m 2 + / - 15%、40 m 2 + / - 15%、45 m 2 + / - 15%、50 m 2 + / - 15%、55 m 2 + / - 15%、60 m 2 + / - 15%、65m 2 + / - 15%、75 m 2 + / - 15%、80 m 2 + / - 15%、85 m 2 + / - 15%、90 m 2 + / - 15%、95 m 2 + / - 15%、100 m 2 + / - 15%、150 m 2 + / - 15%、175 m 2 + / - 15%、200 m 2 + / - 15%、225 m 2 + / - 15%、250 m 2 + / - 15%、275 m 2 + / - 15%、300 m 2 + / - 15%、325 m 2 + / - 15%、330 m 2 + / - 15%、340 m 2 + / -15%、350 m 2 + / - 15%、375 m 2 + / - 15%、400 m 2 + / - 15%、425 m 2 + / - 15%、450 m 2 + / - 15%、475 m 2 + / - 15%、500 m 2 + / - 15%、600 m 2 + / - 15%、700 m 2 + / - 15%、800 m 2 + / - 15%、900m 2+ / - 15%, 1000 m 2 + / - 15%, 1100 m 2 + / - 15%, 1200 m 2 + / - 15%, 1300 m 2 + / - 15%, 1400m 2 + / - 15%, 1500 m 2 + / - 15%, 1600 m 2 + / - 15%, 1700 m 2 + / - 15%, 1800 m 2 + / - 15%, 1900m 2 + / - 15%, 2000 m 2 + / - 15%, 2500 m 2 + / - 15%, 3000 m 2 + / - 15%, 3500 m 2 + / - 15%, 4000m 2 + / - 15%, 4500 m 2 + / - 15%, 5000 m 2 + / - 15%, 5500 m 2 + / - 15%, 6000 m 2 + / - 15%, 6500m 2 + / - 15%, 7000 m 2 + / - 15%, 7500 m 2 + / - 15%, 8000 m 2 + / - 15%, 8500 m 2 + / - 15%, 9000m 2 + / - 15%, 9500 m 2 + / - 15%, 10,000 m 2 + / - 15%, 11,000 m 2 + / - 15%, 12,000 m 2 + / -15%, 13,000 m 2 + / - 15%, 14,000 m 2 + / - 15%, 15,000 m 2 + / - 15% or more of culture medium.

[0482] Host cells can be cultured in cell culture vessels or bioreactors. In some embodiments, the cell culture vessel is adapted for / used to culture adherent cells. In other embodiments, the cell culture vessel is adapted for / used to culture suspension cells. Exemplary cell culture vessels include 35 mm, 60 mm, 100 mm, or 150 mm dishes, multiwell plates (e.g., 6-well, 12-well, 24-well, 48-well, or 96-well plates), or flasks (e.g., T-flasks, such as T-25, T-75, or T-160 flasks) or shake flasks.

[0483] In some embodiments, host cells are cultured in a bioreactor. In some embodiments, the bioreactor is adapted / used for culturing adherent cells. In some embodiments, the bioreactor is adapted / used for culturing suspension cells. The bioreactor can be, for example, a continuous flow batch bioreactor, a perfusion bioreactor, a batch processing bioreactor, or a fed-batch bioreactor. An exemplary bioreactor is a fixed-bed bioreactor, such as the iCELL is bioreactor (for culturing adherent cells). The bioreactor can be maintained under conditions sufficient to produce rAAV particles. Culture conditions can be adjusted to optimize the yield, purity, or structure of the rAAV particles.

[0484] In some embodiments, the bioreactor contains multiple host cells. In some embodiments, the host cells in the bioreactor include living cells (VCs).

[0485] In some embodiments, the bioreactor contains at least about 1 x 10 6 One, approximately 1 x 10 7 One, approximately 1 x 10 8 One, approximately 1 x 10 9 One, approximately 1 x 10 10 One, approximately 1 x 10 11 One, approximately 1 x 10 12 One, approximately 1 x 10 13 One or approximately 1 x 10 14 One host cell (e.g., a live host cell). In some embodiments, the bioreactor contains 1 x 10 6 Up to 1 x 10 14 One host cell; 1 x 10 6 Up to 0.5 x 10 14 One host cell; 1 x 10 6 Up to 1 x 10 13 One host cell; 1 x 10 6 Up to 0.5 x 10 13 One host cell; 1 x 10 6 Up to 1 x 10 12One host cell; 1 x 10 6 Up to 0.5 x 10 12 One host cell; 1 x 10 6 Up to 1 x 10 11 One host cell; 1 x 10 6 Up to 0.5 x 10 11 One host cell; 1 x 10 6 Up to 1 x 10 10 1 host cell; 1 x 10 6 Up to 0.5 x 10 10 One host cell; 1 x 10 6 Up to 1 x 10 9 One host cell; 1 x 10 6 Up to 0.5 x 10 9 One host cell; 1 x 10 6 Up to 1 x 10 8 One host cell; 1 x 10 6 Up to 0.5 x 10 8 One host cell; 1 x 10 6 Up to 1 x 10 7 One host cell; 1 x 10 6 Up to 0.5 x 10 7 One host cell; 0.5 x 10 7 Up to 1 x 10 14 One host cell; 1 x 10 8 Up to 1x 10 14 One host cell; 0.5 x 10 9 Up to 1 x 10 14 One host cell; 1 x 10 9 Up to 1 x 10 14 One host cell; 0.5 x 10 10 Up to 1 x 10 14 One host cell; 1 x 10 10 Up to 1 x 10 14 One host cell; 0.5 x 10 11 Up to 1 x 10 14 One host cell; 1 x 10 11 Up to 1 x 10 14 One host cell; 0.5 x 10 12 Up to 1 x 10 14 One host cell; 1 x 10 12 Up to 1 x 10 14 One host cell; 0.5 x 10 13 Up to 1 x 1014 One host cell; 1 x 10 13 Up to 1 x 10 14 One host cell; or 0.5 x 10 13 Up to 1 x 10 14 One host cell.

[0486] In some embodiments, the bioreactor contains approximately 0.5 million host cells / mL, approximately 1 million host cells / mL, approximately 1.5 million host cells / mL, approximately 2 million host cells / mL, approximately 2.5 million host cells / mL, approximately 3 million host cells / mL, approximately 3.5 million host cells / mL, approximately 4 million host cells / mL, approximately 4.5 million host cells / mL, approximately 5 million host cells / mL, approximately 5.5 million host cells / mL, approximately 6 million host cells / mL, approximately 7 million host cells / mL, approximately 8 million host cells / mL, approximately 9 million host cells / mL, or approximately 10 million host cells / mL. In some embodiments, the host cells in the bioreactor include live cells (VCs).

[0487] In some embodiments, the bioreactor contains at least about 1 liter, about 2 liters, about 3 liters, about 10 liters, about 20 liters, about 30 liters, about 40 liters, about 50 liters, about 55 liters, about 60 liters, about 65 liters, about 70 liters, about 75 liters, about 80 liters, about 85 liters, about 90 liters, about 95 liters, about 100 liters, about 200 liters, about 300 liters, about 400 liters, about 500 liters, about 600 liters, about 700 liters, about 800 liters, about 900 liters, about 1000 liters, about 1500 liters, about 2000 liters, or about 3000 liters of culture medium.

[0488] In one embodiment, the bioreactor is maintained under conditions that promote host cell growth, such as at a temperature (e.g., 37°C) and gas concentration (e.g., 5% - 10% CO2) that allows host cell growth. For example, the bioreactor may perform one or more of the following: feeding of nutrients and / or carbon sources, injection of suitable gases (e.g., oxygen), inflow and outflow of fermentation or cell culture media, separation of gas and liquid phases, maintenance of temperature, maintenance of oxygen and CO2 levels, maintenance of pH levels, agitation (e.g., stirring), cleaning, and / or sterilization. An exemplary bioreactor unit may contain multiple reactors within a single unit; for example, a unit may contain 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 or more bioreactors. Any suitable bioreactor diameter and / or shape can be used. In some embodiments, a suitable reactor may be circular, such as cylindrical. In some implementations, a suitable reactor may be square, for example, rectangular.

[0489] rAAV particle generation This disclosure relates in particular to rAAV particles generated using the methods described herein. Typically, rAAV particles generated using the methods described herein can be any AAV serotype. AAV serotypes typically have different tropisms to infect different tissues. In some embodiments, AAV serotype selection is based on tropism.

[0490] In some implementations, rAAV particles may comprise or be based on any of the following serotypes and their variants, including but not limited to: AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVhu68, or AAVrh10.

[0491] In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV1 serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV2 serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV3B serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV5 serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV8 serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV9 serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV4 serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV7 serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV10 serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV11 serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV12 serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAV13 serotype or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAVhu68 or a variant thereof. In some embodiments, the rAAV particles containing the AAV variant capsid protein disclosed herein contain AAVrh10 or a variant thereof.

[0492] In some embodiments, the methods described herein produce multiple rAAV particles at higher titers, for example, resulting in improved rAAV particle production. In some embodiments, improved production comprises a higher yield of multiple rAAV particles compared to multiple rAAV particles produced using an auxiliary vector containing a nucleic acid sequence of an antibiotic resistance gene other than KanR (e.g., an ampicillin resistance gene). In some embodiments, high titers are relative to AAV particles produced, for example, from a reference auxiliary vector (e.g., an Ad5 vector, such as the Ad5 vector described herein) under otherwise identical conditions.

[0493] In some implementations, the high titer is greater than 7.0 x 10⁻⁶. 9vg / mL + / - 15%, for example, when cultured in suspension. In some embodiments, high titers are greater than about 7.0 x 10⁻⁶, for example, when cultured in suspension. 9 vg / mL, for example, greater than about 7.5 x 10 9 vg / mL, 8.0 x 10 9 vg / mL, 8.5 x 10 9 vg / mL, 9.0 x 10 9 vg / mL, 1.0 x 10 10 vg / mL, 1.5 x 10 10 vg / mL, 2.0 x 10 10 vg / mL, 2.5 x 10 10 vg / mL, 3.0 x 10 10 vg / mL, 3.5 x 10 10 vg / mL, 4.0 x 10 10 vg / mL, 4.5 x 10 10 vg / mL, 5.0 x 10 10 vg / mL, 5.5 x 10 10 vg / mL, 6.0 x 10 10 vg / mL, 6.5 x 10 10 vg / mL, 7.0 x 10 10 vg / mL, 7.5 x 10 10 vg / mL, 8.0 x10 10 vg / mL, 8.5 x 10 10 vg / mL, 9.0 x 10 10 vg / mL, 9.5 x 10 10 vg / mL, 1.0 x 10 11 vg / mL, 1.5 x 10 11 vg / mL, 2.0 x 10 11 vg / mL or higher.

[0494] In some implementations, such as when cultured in a bioreactor (e.g., a fixed-bed bioreactor), the high titer of rAAV particles is at least about 7.0 x 10⁻⁶. 9 vg / cm 2 Approximately 7.5 x 10 9 vg / cm 2 Approximately 8.0 x 10 9 vg / cm 2 Approximately 8.5 x 109 vg / cm 2 Approximately 9.0 x 10 9 vg / cm 2 Approximately 9.5 x 10 9 vg / cm 2 Approximately 1.0 x 10 10 vg / cm 2 Approximately 1.5 x 10 10 vg / cm 2 Or higher.

[0495] In some implementations, the high titer of rAAV particles is greater than 5.0 x 10⁻⁶. 13 vg / m 2 + / - 15%, for example, greater than 6.0 x 10 13 vg / m 2 + / - 15、7.0 x 10 13 vg / m 2 + / - 15、8.0 x 10 13 vg / m 2 + / - 15、9.0 x 10 13 vg / m 2 + / - 15、1.0 x 10 14 vg / m 2 + / - 15、2.0 x 10 14 vg / m 2 + / - 15、3.0 x 10 14 vg / m 2 + / -15, 4.0 x 10 14 vg / m 2 + / - 15、5.0 x 10 14 vg / m 2 + / - 15、6.0 x 10 14 vg / m 2 + / - 15、7.0 x10 14 vg / m 2 + / - 15、8.0 x 10 14 vg / m 2 + / - 15、9.0 x 10 14 vg / m 2 + / - 15 or more.

[0496] In some embodiments, a plurality of rAAV particles described herein are harvested after incubation for at least 3 days. In some embodiments, a plurality of rAAV particles described herein are harvested after incubation for at least about 3 days to about 10 days, for example, after incubation for about 3 to about 7 days, about 3 to about 5 days, about 4 to about 9 days, about 4 to about 8 days, or about 4 to about 6 days, for example, after incubation for at least about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, or longer. In some embodiments, the plurality of rAAV particles produced by the methods described herein are substantially free of one or both of helper adenovirus or herpesvirus. In some embodiments, the plurality of rAAV particles are substantially free of one or both of helper adenovirus or herpesvirus, for example, with a purity of at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or higher, and are free of one or both of helper adenovirus or herpesvirus. The aforementioned methods for generating recombinant vectors are not intended to be limiting, and other suitable methods will be apparent to those skilled in the art.

[0497] rAAV particle composition This disclosure particularly provides compositions comprising a plurality of rAAV particles formed by the methods described herein and / or using the systems described herein. In some embodiments, the composition comprises a pharmaceutical composition containing at least one pharmaceutically acceptable component (e.g., a pharmaceutically acceptable carrier, diluent, or excipient). Such pharmaceutical compositions are particularly suitable for in vivo or ex vivo administration to a subject.

[0498] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier, excipient, or diluent. Such excipients include any pharmaceutical agent, such as one that does not induce an immune response harmful to the individual receiving the composition, and which can be administered without excessive toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, sugar, and ethanol. Pharmaceutically acceptable salts may also be included, such as inorganic acid salts, such as hydrochlorides, hydrobroms, phosphates, or sulfates; and salts of organic acids, such as acetates, propionates, malonates, or benzoates. Additionally, excipients such as wetting agents or emulsifiers or pH buffers may be present in such media.

[0499] The pharmaceutical composition may be provided as a salt and can form with a number of acids, including but not limited to hydrochloric acid, sulfuric acid, acetic acid, lactic acid, tartaric acid, malic acid, or succinic acid. Salts tend to be more soluble in aqueous solvents or other protic solvents than their corresponding free base forms. In some embodiments, the pharmaceutical composition may be a lyophilized powder.

[0500] Pharmaceutical compositions may contain solvents (aqueous or non-aqueous), solutions (aqueous or non-aqueous), emulsions (e.g., oil-in-water or water-in-oil), suspensions, syrups, elixirs, dispersions and suspension media, coatings, and isotonic and absorption promoters or delayers compatible with drug administration or in vivo contact or delivery. Aqueous and non-aqueous solvents, solutions, and suspensions may contain suspending agents and thickeners. Such pharmaceutically acceptable carriers include tablets (coated or uncoated), capsules (hard or soft), microbeads, powders, granules, and crystals. Supplemental active compounds (e.g., preservatives, antibacterial agents, antiviral agents, and antifungal agents) may also be incorporated into the composition.

[0501] Pharmaceutical compositions may be formulated to be compatible with specific routes of administration or delivery as described herein or known to those skilled in the art. Therefore, pharmaceutical compositions contain carriers, diluents, or excipients suitable for administration via various routes.

[0502] Compositions suitable for parenteral administration may comprise aqueous and non-aqueous solutions, suspensions, or emulsions of the active compound, and the formulations are generally sterile and isotonic with the blood of the intended recipient. Non-limiting illustrative examples include water, buffered saline, Hanks' solution, Ringer's solution, glucose, fructose, ethanol, animal oil, vegetable oil, or synthetic oil. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Alternatively, suspensions may be prepared as suitable oil injection suspensions, depending on the circumstances. Suitable lipophilic solvents or mediators include fatty oils, such as sesame oil; or synthetic fatty acid esters, such as ethyl oleate or triglycerides; or liposomes. Optionally, the suspension may also contain suitable stabilizers or solubilizing agents to allow for the preparation of highly concentrated solutions.

[0503] Cosolvents and adjuvants may be added to formulations. Non-limiting examples of cosolvents include hydroxyl groups or other polar groups, such as alcohols like isopropanol; glycols like propylene glycol, polyethylene glycol, polypropylene glycol, and glycol ethers; glycerol; polyoxyethylene alcohols and polyoxyethylene fatty acid esters. Adjuvants include, for example, surfactants such as soybean lecithin and oleic acid; sorbitan esters such as sorbitan trioleate; and polyvinylpyrrolidone.

[0504] After the pharmaceutical compositions are prepared, they can be placed in appropriate containers and labeled for use in treatment. Such labeling may include the amount, frequency, and method of administration.

[0505] Pharmaceutical compositions and delivery systems suitable for the compositions, methods, and uses described in this disclosure are known in the art (see, for example, Fox LM., (2006)). Am J Pharm Educ. 70(3): Page 71).

[0506] application This disclosure particularly provides a method of administering a composition (e.g., a pharmaceutical composition) comprising a plurality of rAAV particles formed by the methods described herein and / or generated using the systems described herein. Compositions comprising rAAV generated by the methods described herein or using the systems described herein (e.g., pharmaceutical compositions) may be used to treat CNS conditions, such as subjects who have or are susceptible to the CNS conditions described herein. The route and / or manner of administration may vary depending on the desired outcome. Those skilled in the art (e.g., physicians) know that dosing regimens can be adjusted to provide a desired response, such as a therapeutic response. Methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intrathecal, intravaginal, intravaginal, transdermal, rectal, inhalation, or local administration, particularly for the ear, nose, eye, or skin. The method of administration is determined by the physician.

[0507] For example, the composition can be administered by injection or infusion into the retina, subretinal, intravitreal, anterior chamber, or choroid. Other exemplary routes of administration may include, but are not limited to, bronchial (e.g., bronchial infusion), oral, enteral, intradermal, intraarterial, intracerebellomedullary cistern (ICM), intradermal, intragastric, intramedullary, intramuscular, intranasal, intraparenchymal (e.g., intrathalamic), intraperitoneal, intrathecal, intravenous, intravenous, intraventricular, mucosal, nasal, oral, rectal, intraspinal, subpial, subcutaneous, sublingual, local, tracheal (e.g., endotracheal infusion), transdermal, vaginal, and intravitreal administration.

[0508] The methods and uses disclosed herein include delivery and administration via whole-body, regional, or local routes, or by any route such as injection or infusion. Compositions comprising a plurality of rAAV particles formed by the methods described herein (e.g., pharmaceutical compositions) may be administered by injection or infusion via any route.

[0509] Drug compositions are typically delivered in vivo via injection using a conventional syringe, but other delivery methods, such as convection-enhanced delivery, are also possible. For example, the composition can be delivered subcutaneously, epidermally, intradermally, intrathecally, intraorally, intra-orbitally, intramucosally, intraperitoneally, intravenously, intrapleurally, intra-arterially, intracoronaryly, orally, intrahepatically, via the portal vein, or intramuscularly. Other routes of administration include oral and pulmonary administration, suppositories, and transdermal application. Clinicians focused on treating patients with specific diseases or conditions can determine the optimal route of administration for the carriers described herein.

[0510] In addition, the pharmaceutical compositions disclosed herein can also be administered by perfusion, for example, via limb perfusion.

[0511] This disclosure provides methods for introducing a composition (e.g., a pharmaceutical composition) comprising the rAAV particles described herein into cells, tissues, or animals. In some embodiments, such methods include contacting cells, tissues, or animals with a composition comprising the rAAV particles described herein, such that at least one payload is expressed or present in the cells, tissues, or animals.

[0512] This disclosure also provides methods for administering a composition (e.g., a pharmaceutical composition) comprising the rAAV particles described herein to a subject. In some embodiments, such methods include administering the composition comprising the rAAV particles described herein to a subject (e.g., a mammal) such that at least one payload is expressed or present in the subject (e.g., in the subject's cells or tissues). In some embodiments, the method includes providing the composition comprising the rAAV particles described herein (e.g., a pharmaceutical composition) to the cells of the subject (e.g., a mammal) such that at least one payload is expressed or present in the subject.

[0513] Compositions containing the rAAV particles described herein (e.g., pharmaceutical compositions) may be administered in sufficient or effective amounts to subjects in need. Dosage may vary and depend on the type, onset, progression, severity, frequency, duration, or probability of the disease being treated, the expected clinical endpoint, prior or concurrent treatment, the subject's general health condition, age, sex, race, or immunological capacity, and other factors that a person skilled in the art will understand. Dosage, quantity, frequency, or duration may be increased or decreased proportionally as indicated by any adverse side effects, complications, or other risk factors for treatment and the subject's condition. Those skilled in the art will understand the factors that may affect the dosage and time required to provide an amount sufficient to provide a beneficial therapeutic or preventative effect.

[0514] The dosage required to achieve a therapeutic effect will vary based on several factors, including but not limited to: the route of administration, the level of payload or payload expression required to achieve the therapeutic effect, the specific disease being treated, any host immune response, and the stability of the payload or payload expression. Those skilled in the art can determine the dosage range for treating patients with a specific disease or condition based on the foregoing factors and other factors.

[0515] An effective or adequate amount may (but does not need to) be provided in a single application, may require multiple applications, and may (but does not need to) be administered alone or in combination with another composition. For example, the amount may be increased proportionally depending on the needs of the treated individual, the type, state, and severity of the disease being treated, or any side effects of the treatment. An effective amount also includes amounts that result in a reduction in the use of another treatment, treatment regimen, or program.

[0516] Therefore, the pharmaceutical composition comprises a composition containing an effective amount of rAAV particles to achieve the intended therapeutic purpose. Determining the therapeutically effective dose using the techniques and guidelines provided herein is entirely within the capabilities of a skilled physician. The therapeutic dose may depend on factors such as the subject's age and general condition, the severity of the disease or symptom, and the amount or expression of the effective payload in the subject. Therefore, the therapeutically effective dose in humans will fall within a relatively wide range that can be determined by a physician based on the individual patient's response to rAAV-based treatment. The pharmaceutical composition may be delivered to the subject to allow the in vivo production of the effective payload described herein via gene- and / or cell-based therapies or via in vitro modification of patient or donor cells.

[0517] In some embodiments, the composition comprising the rAAV particles described herein (e.g., a pharmaceutical composition) may be administered to the subject once daily, once weekly, every 2, 3, or 4 weeks, or even at longer intervals. In some embodiments, the composition comprising the rAAV particles described herein (e.g., a pharmaceutical composition) may be administered according to a dosing regimen comprising (i) an initial administration once daily, once weekly, every 2, 3, or 4 weeks, or even at longer intervals; followed by (ii) a period of non-administration for, for example, 1, 2, 3, 4, 5, 6, 8, or 10 months, or 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, or 10 years. In some embodiments, the composition comprising the rAAV particles described herein (e.g., a pharmaceutical composition) may be administered as follows: (i) once or more during an initial time period of up to 2 weeks, 4 weeks, or 6 weeks or less; followed by (ii) a period of non-administration, for example, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, or 10 years. In some embodiments, subjects are monitored before and / or after treatment with the composition comprising the rAAV particles described herein (e.g., a pharmaceutical composition).

[0518] Immunosuppressive regimen The methods disclosed herein may also include administration of an immunosuppressive regimen in combination with rAAV particles or a composition containing rAAV particles.

[0519] In some embodiments, the immunosuppressive regimen includes: (i) dexamethasone or prednisolone, and (ii) a calcineurin inhibitor. In some embodiments, the calcineurin inhibitor includes macrolides. In some embodiments, the calcineurin inhibitor includes tacrolimus.

[0520] In some embodiments, immunosuppressive regimens are administered intraosseously, intrathecally, intravenously, and / or orally. In some embodiments, an intraosseous immunosuppressive regimen is administered. In some embodiments, dexamethasone is administered intrathecally.

[0521] In some implementation schemes, an immunosuppressive regimen is administered daily.

[0522] In some embodiments, the immunosuppressive regimen is initiated before the administration of rAAV particles or a composition containing rAAV particles.

[0523] In some embodiments, an immunosuppressive regimen is administered (i) on each of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more days prior to the administration of rAAV particles or a composition containing rAAV particles, (ii) on the same day as the administration of rAAV particles or a composition containing rAAV particles, and / or (iii) on each day following the administration of rAAV particles or a composition containing rAAV particles, for approximately 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or longer.

[0524] In some embodiments, prednisolone is administered at a dose of about 0.3 mg / kg to about 10 mg / kg. In some embodiments, prednisolone is administered at doses of about 0.3 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, or about 10 mg / kg. In some embodiments, prednisolone is administered at a dose of about 3 mg / kg. In some embodiments, prednisolone is administered at a dose of 3 mg / kg.

[0525] In some embodiments, dexamethasone is administered at a dose of about 0.1 mg / kg to about 1 mg / kg. In some embodiments, dexamethasone is administered at doses of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.6 mg / kg, about 0.7 mg / kg, about 0.8 mg / kg, about 0.9 mg / kg, or about 1 mg / kg. In some embodiments, dexamethasone is administered at a dose of about 0.5 mg / kg.

[0526] In some embodiments, the calcineurin inhibitor is tacrolimus. In some embodiments, tacrolimus is administered at a dose of about 0.5 mg / kg to about 5 mg / kg. In some embodiments, tacrolimus is administered at doses of about 0.5 mg / kg, about 0.6 mg / kg, about 0.7 mg / kg, about 0.8 mg / kg, about 0.9 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, or about 5 mg / kg.

[0527] In some implementations, tacrolimus is administered at a dose of approximately 1 mg / kg.

[0528] In some embodiments, the immunosuppressive regimen comprises prednisolone and tacrolimus. In some embodiments, prednisolone is administered at a dose of about 3 mg / kg, and tacrolimus is administered at a dose of about 1 mg / kg. In some embodiments, the immunosuppressive regimen is administered daily from 2 days prior to administration of a dose of rAAV particles or a composition containing rAAV particles to 20 days after administration of a dose of rAAV particles or a composition containing rAAV particles. In some embodiments, the immunosuppressive regimen is administered orally. In some embodiments, rAAV particles or a composition containing rAAV particles are administered intravenously.

[0529] In some embodiments, the immunosuppressive regimen comprises dexamethasone and tacrolimus. In some embodiments, dexamethasone is administered at a dose of about 0.5 mg / kg, and tacrolimus is administered at a dose of about 1 mg / kg. In some embodiments, the immunosuppressive regimen is administered daily from 2 days prior to administration of a dose of rAAV particles or a composition containing rAAV particles to 20 days after administration of a dose of rAAV particles or a composition containing rAAV particles. In some embodiments, the immunosuppressive regimen is administered orally. In some embodiments, rAAV particles or a composition containing rAAV particles are administered intravenously.

[0530] AAV Capsule Reference Sequence SEQ ID NO: 2001: AAV9 VP1 capsid reference sequence SEQ ID NO: 2002: AAV1 VP1 capsid reference sequence SEQ ID NO: 2003: AAV2 VP1 capsid reference sequence SEQ ID NO: 2010: AAV3B VP1 capsid reference sequence SEQ ID NO: 2004: AAV5 VP1 capsid reference sequence SEQ ID NO: 2005: AAV6 VP1 capsid reference sequence SEQ ID NO: 2006: AAV8 VP1 capsid reference sequence SEQ ID NO: 2051: AAV4 VP1 capsid reference sequence SEQ ID NO: 2052: AAV7 VP1 capsid reference sequence SEQ ID NO: 2053: AAV10 VP1 capsid reference sequence SEQ ID NO: 2054: AAV11 VP1 capsid reference sequence SEQ ID NO: 2055: AAV12 VP1 capsid reference sequence SEQ ID NO: 2056: AAV13 VP1 capsid reference sequence SEQ ID NO: 2057: AAVhu68 VP1 capsid reference sequence SEQ ID NO: 2058: AAVrh10 VP1 capsid reference sequence The following examples further illustrate this disclosure. These examples are provided for illustrative purposes only and should not be construed as limiting the scope or content of this disclosure in any way.

[0531] All publications, patent applications, patents, and other references (including GenBank accession numbers) mentioned herein are incorporated herein by reference in their entirety. Furthermore, the materials, methods, and examples described are illustrative only and not intended to be limiting. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While suitable methods and materials are described herein, similar or equivalent methods and materials may be used in the practice or experimentation of this invention.

[0532] List the implementation plan Implementation Scheme 1. A recombinant adeno-associated virus (rAAV) particle, said recombinant adeno-associated virus (rAAV) particle comprising: (a) A variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to the corresponding parental AAV capsid protein, wherein: (i) The peptide insert comprises the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3, and X4 are independently any amino acid, and X5 is Y, W, or F; and (ii) The peptide insertion site is located in the variable region (VR) of the parental AAV capsid protein, and (b) Heterologous nucleic acids containing nucleotide sequences encoding payloads.

[0533] Implementation Scheme 2. A recombinant adeno-associated virus (rAAV) particle, said recombinant adeno-associated virus (rAAV) particle comprising: (a) A variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to the corresponding parental AAV capsid protein, wherein: (i) The peptide insertion comprises the sequence provided in Table 1 or Table 3; and (ii) The peptide insertion site is located in the variable region of the parental AAV capsid protein, and (b) Heterologous nucleic acids containing nucleotide sequences encoding payloads.

[0534] Implementation Scheme 3. The rAAV particle as described in Implementation Scheme 1 or 2, wherein the insertion site is located between two adjacent amino acids in the variable region of the parental AAV capsid protein.

[0535] Implementation Scheme 4. The rAAV particle as described in Implementation Scheme 1 or 2, wherein the insertion site is located between two non-adjacent amino acids in the variable region of the parental AAV capsid protein.

[0536] Implementation Scheme 5. The rAAV particle as described in any of the preceding implementation schemes, wherein the insertion of a heteropeptide replaces a continuous amino acid segment of the parental AAV capsid protein.

[0537] Implementation Scheme 6. The rAAV particle as described in any one of Implementation Schemes 1 to 4, wherein the insertion of the heteropeptide does not replace a continuous amino acid segment of the parental AAV capsid protein.

[0538] Implementation Scheme 7. The rAAV particle as described in any of the preceding embodiments, wherein the peptide is inserted into VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII or VR-IX of the parental AAV capsid protein.

[0539] Implementation Scheme 8. The rAAV particle as described in any of the preceding implementation schemes, wherein the peptide is inserted into VR-VIII of the parental AAV capsid protein.

[0540] Implementation Scheme 9. The rAAV particle as described in Implementation Scheme 6, wherein the parental AAV capsid protein is the AAV9 capsid protein, and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0541] Implementation Scheme 10. The rAAV particle as described in Implementation Scheme 8 or 9, wherein the insertion site is located between amino acids 588 and 589 of VP1 of the AAV9 capsid protein or at the corresponding position in VP1 of the parental AAV capsid protein.

[0542] Implementation Scheme 11. The rAAV particle as described in any one of Implementation Schemes 8 to 10, wherein the insertion site is located between amino acids 588 and 589 of VP2 of the AAV9 capsid protein or at the corresponding position in VP2 of another parental AAV capsid protein.

[0543] Implementation Scheme 12. The rAAV particle as described in any one of Implementation Schemes 8 to 11, wherein the insertion site is located between amino acids 588 and 589 of VP3 of the AAV9 capsid protein or at the corresponding position in VP3 of another parental AAV capsid protein.

[0544] Implementation Scheme 13. The rAAV particle as described in any of the preceding embodiments, wherein the variant AAV capsid protein comprises: (1) a peptide insertion comprising the sequence of SEQ ID NO: 75, and (2) one or more sequences of VP1, VP2 or VP3 of the AAV9 capsid protein.

[0545] Implementation Scheme 14. The rAAV particle as described in any one of Implementation Schemes 1 to 12, wherein the variant AAV capsid protein comprises: (1) a peptide insertion comprising the common sequence of SEQ ID NO: 1, and (2) one or more sequences of VP1, VP2 or VP3 of the AAV9 capsid protein.

[0546] Implementation Scheme 15. The rAAV particle as described in Implementation Scheme 14, wherein the peptide insertion comprises the sequence provided in Table 2 or Table 4.

[0547] Implementation Scheme 16. The rAAV particle as described in Implementation Scheme 14 or 15, wherein the peptide insert comprises the sequence of SEQ ID NO: 14 (IPQGVYI).

[0548] Implementation Scheme 17. The rAAV particle as described in Implementation Scheme 14 or 15, wherein the peptide insert comprises the sequence of SEQ ID NO: 18 (KGGQVYI).

[0549] Implementation Scheme 18. The rAAV particle as described in Implementation Scheme 14 or 15, wherein the peptide insert comprises the sequence of SEQ ID NO: 24 (NNQGVYI).

[0550] Implementation Scheme 19. The rAAV particle as described in Implementation Scheme 14 or 15, wherein the peptide insert comprises the sequence of SEQ ID NO: 44 (TNHGVYI).

[0551] Implementation Scheme 20. The rAAV particle as described in Implementation Scheme 14 or 15, wherein the peptide insert comprises the sequence of SEQ ID NO: 47 (TQHGVYI).

[0552] Implementation Scheme 21. The rAAV particle as described in any one of Implementation Schemes 1 to 12, wherein the peptide insertion comprises the sequence provided in Table 3.

[0553] Implementation Scheme 22. The rAAV particle as described in Implementation Scheme 15 or 21, wherein the peptide insert comprises the sequence of SEQ ID NO: 75 (TTMGVYI).

[0554] Implementation Scheme 23. The rAAV particle as described in any of the preceding implementation schemes, wherein the variant AAV capsid protein confers increased infectivity and / or transduction to central nervous system (CNS) cells compared to the infectivity and / or transduction to CNS cells of a control AAV particle containing the corresponding parental AAV capsid protein.

[0555] Implementation Scheme 24. The rAAV particle as described in Implementation Scheme 23, wherein the variant AAV capsid protein confers at least 1.5-fold increased infectivity and / or transduction in CNS cells compared to the infectivity and / or transduction in CNS cells of a control AAV particle containing the corresponding parental AAV capsid protein.

[0556] Implementation Scheme 25. The rAAV particles as described in Implementation Scheme 23 or 24, wherein the CNS cells include CNS epithelial cells, nerve cells, CNS connective tissue cells, stem cells or progenitor cells, CNS immune cells, spinal cord cells, or combinations thereof.

[0557] Implementation Scheme 26. The rAAV particles as described in Implementation Scheme 25, wherein the CNS epithelial cells comprise cells lining one or more ventricles.

[0558] Implementation Scheme 27. The rAAV particle as described in Implementation Scheme 25, wherein the nerve cells include neural support cells, such as astrocytes, glial cells, or Schwann cells.

[0559] Implementation Scheme 28. The rAAV particles as described in Implementation Scheme 25, wherein the CNS connective tissue cells include adipocytes or meningeal cells, or both.

[0560] Implementation Scheme 29. The rAAV particle as described in any of the preceding embodiments, wherein the variant AAV capsid protein further comprises one or more modifications to the amino acid sequence flanking the peptide insertion site.

[0561] Implementation Scheme 30. The rAAV particle as described in any one of Implementation Schemes 27 to 29, wherein the one or more modifications are located within about 10 amino acids upstream or downstream of the peptide insertion site, for example, within about 5 amino acids upstream or downstream of the peptide insertion site.

[0562] Implementation Scheme 31. The rAAV particle as described in any one of Implementation Schemes 27 to 30, wherein the one or more modifications include insertions, deletions, mutations, or combinations thereof.

[0563] Implementation Scheme 32. The rAAV particle as described in any of the preceding embodiments, wherein the variant AAV capsid protein further comprises one or more modifications to the amino acid sequence at or near the glycan binding region.

[0564] Implementation Scheme 33. The rAAV particles as described in Implementation Scheme 32, wherein the one or more modifications reduce glycan binding.

[0565] Implementation Scheme 34. rAAV particles as described in Implementation Scheme 32 or 33, wherein the polysaccharide is galactose.

[0566] Implementation Scheme 35. The rAAV particle as described in any one of Implementation Schemes 27 to 34, wherein the one or more modifications are at or between the following amino acids: (a) positions 271 and 272 of the AAV9 capsid protein or corresponding positions in the capsid protein of another parental AAV capsid protein; (b) position 446 of the AAV9 capsid protein or corresponding position in the capsid protein of another parental AAV capsid protein; (c) position 470 of the AAV9 capsid protein or corresponding position in the capsid protein of another parental AAV capsid protein; (d) positions 501 and 505 of the AAV9 capsid protein (e.g., at any one or all or a combination of residues 501, 502, 503, 504, or 505) or corresponding positions in the capsid protein of another parental AAV capsid protein; (e) positions 489 and 545 of VP1 of the AAV9 capsid protein or corresponding positions in the capsid protein of another parental AAV capsid protein; (f) The corresponding positions of VP1 591 and 621 of the AAV9 capsid protein or the capsid protein of another parent AAV capsid protein; or any combination or all of (g) (a)-(f).

[0567] Implementation Scheme 36. The rAAV particle as described in any of the preceding implementation schemes, wherein the variant AAV capsid protein has at least 90% identity with the parental AAV capsid protein.

[0568] Implementation Scheme 37. The rAAV particle as described in Implementation Scheme 36, wherein the identity percentage is determined by comparing the sequence of a variant AAV capsid protein without the peptide insertion with the parental AAV capsid protein.

[0569] Implementation Scheme 38. The rAAV particle of Implementation Scheme 37, wherein the variant AAV capsid protein and the parental AAV capsid protein are 100% identical in the following cases: (a) the peptide insertion in the variant AAV capsid protein is not considered in sequence comparison; and (b) the variant AAV capsid protein does not have one or more modifications other than the peptide insertion.

[0570] Implementation Scheme 39. The rAAV particle of Implementation Scheme 37, wherein the variant AAV capsid protein and the parental AAV capsid protein have less than 100% identity in the following cases: (a) the peptide insertion in the variant AAV capsid protein is not considered in sequence comparison; and (b) the variant AAV capsid protein contains one or more modifications other than the peptide insertion.

[0571] Implementation Scheme 40. The rAAV particle as described in any of the preceding implementation schemes, wherein the parental AAV capsid protein is the AAV9 capsid protein of SEQ ID NO: 2001.

[0572] Implementation Scheme 41. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV1 capsid protein of SEQ ID NO: 2002.

[0573] Implementation Scheme 42. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV2 capsid protein of SEQ ID NO: 2003.

[0574] Implementation Scheme 43. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV3B capsid protein of SEQ ID NO: 2010.

[0575] Implementation Scheme 44. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV5 capsid protein of SEQ ID NO: 2004.

[0576] Implementation Scheme 45. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV6 capsid protein of SEQ ID NO: 2005.

[0577] Implementation Scheme 46. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV8 capsid protein of SEQ ID NO: 2006.

[0578] Implementation Scheme 47. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV4 capsid protein of SEQ ID NO: 2051.

[0579] Implementation Scheme 48. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV7 capsid protein of SEQ ID NO: 2052.

[0580] Implementation Scheme 49. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV10 capsid protein of SEQ ID NO: 2053.

[0581] Implementation Scheme 50. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV11 capsid protein of SEQ ID NO: 2054.

[0582] Implementation Scheme 51. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV12 capsid protein of SEQ ID NO: 2055.

[0583] Implementation Scheme 52. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAV13 capsid protein of SEQ ID NO: 2056.

[0584] Implementation Scheme 53. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAVhu68 capsid protein of SEQ ID NO: 2057.

[0585] Implementation Scheme 54. The rAAV particle as described in any one of Implementation Schemes 1 to 39, wherein the parental AAV capsid protein is the AAVrh10 capsid protein of SEQ ID NO: 2058.

[0586] Implementation Scheme 55. The rAAV particle as described in any of the preceding implementation schemes, wherein the payload is or comprises a polypeptide.

[0587] Implementation Scheme 56. The rAAV particle as described in Implementation Scheme 55, wherein the polypeptide is or comprises: (i) a CRISPR-Cas protein, or a variant or fragment thereof; (ii) a zinc finger protein, or a variant or fragment thereof; (iii) a TALEN protein, or a variant or fragment thereof; (iv) a base editor, or a variant or fragment thereof; (v) a leader editor, or a variant or fragment thereof; and / or (vi) a meganuclease, or a variant or fragment thereof.

[0588] Implementation Scheme 57. The rAAV particle as described in Implementation Scheme 56, wherein the CRISPR-Cas protein is a type II, type V, or type VI CRISPR-Cas protein, such as Cas9 protein, Cas12a protein, Cas12b protein, Cas12c protein, Cas12d protein, Cas12e protein, Cas12f protein, Cas12g protein, Cas12h protein, Cas12i protein, Cas13a protein, Cas13b protein, or a variant or fragment thereof.

[0589] Implementation Scheme 58. rAAV particles as described in Implementation Scheme 56 or 57, wherein the polypeptide is associated with CNS conditions.

[0590] Implementation Scheme 59. The rAAV particles as described in Implementation Scheme 58, wherein the CNS condition is the result of a genetic abnormality.

[0591] Implementation Scheme 60. The rAAV particles as described in Implementation Scheme 58, wherein the CNS condition is not the result of a genetic abnormality.

[0592] Implementation Scheme 61. The rAAV particles as described in Implementation Scheme 58, wherein the CNS condition is selected from: Friedreich ataxia, Drave syndrome, spinocerebellar ataxia type 3, Niemann-Pick type C, Huntington's disease, Pompe disease, myotonic dystrophy type 1, glucose transporter 1 deficiency syndrome (Devivo syndrome), Tay-Sachs disease, spinal muscular atrophy, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Danon disease, Rett syndrome, Angelman syndrome, Parkinson's disease, tau proteinosis, hereditary epilepsy, or combinations thereof.

[0593] Implementation Scheme 62. The rAAV particles as described in Implementation Scheme 55, wherein the polypeptide is an enzyme.

[0594] Implementation Scheme 63. The rAAV particle as described in Implementation Scheme 55, wherein the polypeptide is an antibody.

[0595] Implementation Scheme 64. The rAAV particle as described in Implementation Scheme 55, wherein the polypeptide is a secretory protein.

[0596] Implementation Scheme 65. The rAAV particle as described in any one of Implementation Schemes 1 to 54, wherein the payload is or comprises an RNA molecule.

[0597] Implementation Scheme 66. The rAAV particle as described in Implementation Scheme 65, wherein the RNA molecule is siRNA, miRNA, gRNA, antisense RNA, circular RNA, snRNA, or aptamer.

[0598] Implementation Scheme 67. The rAAV particle as described in Implementation Scheme 66, wherein the RNA molecule targets a nucleic acid molecule encoding a polypeptide associated with CNS disease.

[0599] Implementation Scheme 68. The rAAV particles as described in Implementation Scheme 67, wherein the CNS condition is selected from: Friedreich ataxia, Drave syndrome, spinocerebellar ataxia type 3, Niemann-Pick type C, Huntington's disease, Pompe disease, myotonic dystrophy type 1, glucose transporter 1 deficiency syndrome (Devivo syndrome), Tay-Sachs disease, spinal muscular atrophy, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Danon disease, Rett syndrome, Angelman syndrome, Parkinson's disease, tau proteinosis, hereditary epilepsy, or combinations thereof.

[0600] Implementation Scheme 69. The rAAV particle as described in any one of Implementation Schemes 1 to 54, wherein the payload is or comprises a DNA molecule.

[0601] Implementation Scheme 70. The rAAV particle as described in any of the preceding implementation schemes, wherein the nucleotide sequence encoding the payload is operatively linked to a promoter.

[0602] Implementation Scheme 71. The rAAV particle as described in Implementation Scheme 70, wherein the promoter is or includes a CNS promoter.

[0603] Implementation Scheme 72. The rAAV particle as described in Implementation Scheme 71, wherein the CNS promoter is selected from: GFAP promoter, SYN1 promoter, NSE / RU5' promoter, neuroactive peptide cholecystokinin (CCK) promoter, myelin basic promoter (MBP), human myelin-associated glycoprotein promoter, phosphate-activated glutaminase (PAG) promoter, vesicle glutamate transporter (vGLUT) promoter, glutamate decarboxylase (GAD) promoter, Camk2a promoter, TH (tyrosine hydroxylase) promoter, Hb9 promoter, CNP promoter, NES (nestin) promoter, Tub1a promoter, SST (somatostatin) promoter, MeCP2 promoter, or combinations thereof.

[0604] Implementation Scheme 73. The rAAV particle as described in Implementation Scheme 70, wherein the promoter is or contains a chicken β-actin heterozygous (CBh) promoter.

[0605] Implementation Scheme 74. A pharmaceutical composition comprising: (a) rAAV particles as described in any of the preceding embodiments; and (b) a pharmaceutically acceptable excipient.

[0606] Implementation Scheme 75. A method for delivering a payload to CNS cells, the method comprising administering a pharmaceutical composition as described in Implementation Scheme 74 to the CNS cells.

[0607] Implementation Scheme 76. The method as described in Implementation Scheme 75, wherein the CNS cells are in vitro.

[0608] Implementation Scheme 77. The method as described in Implementation Scheme 75, wherein the CNS cells are in vivo.

[0609] Implementation Scheme 78. The method of any one of Implementation Schemes 75 to 77, wherein the CNS cells are derived from a subject who has or has been diagnosed with a CNS condition.

[0610] Implementation Scheme 79. A method for treating a subject with CNS disease and / or improving the symptoms of CNS disease in a subject, the method comprising administering to the subject a pharmaceutical composition as described in Implementation Scheme 74.

[0611] Implementation Scheme 80. The method as described in Implementation Scheme 78 or 79, wherein the CNS condition is selected from: Friedreich ataxia, Drave syndrome, spinocerebellar ataxia type 3, Niemann-Pick type C, Huntington's disease, Pompe disease, myotonic dystrophy type 1, glucose transporter 1 deficiency syndrome (Devivo syndrome), Tay-Sachs disease, spinal muscular atrophy, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Danon disease, Rett syndrome, Angelman syndrome, Parkinson's disease, tau proteinosis, hereditary epilepsy, or combinations thereof.

[0612] Implementation Scheme 81. The method of Implementation Scheme 78 or 79, wherein the pharmaceutical composition is administered via an administration route selected from: intravenous, intra-arterial, intracoronary, intraparenchymal, subpiaural, intrathecal, intraocular, intraventricular (ICV), intracerebellomedullary cistern (ICM), or intramuscular.

[0613] Implementation Scheme 82. The method of any one of Implementation Schemes 79 to 81, wherein the subject is a human.

[0614] Implementation Scheme 83. An isolated cell, said isolated cell being transduced with rAAV particles as described in any one of Implementation Schemes 1 to 73.

[0615] Implementation Scheme 84. An isolated nucleic acid comprising a nucleotide sequence encoding a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, and wherein: (i) the peptide insertion comprises the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3, and X4 are independently any amino acids, and X5 is Y, W, or F; (ii) the peptide insertion site is in the variable region (VR) of the parental AAV capsid protein.

[0616] Implementation Scheme 85. The isolated nucleic acid as described in Implementation Scheme 84, wherein the peptide is inserted into VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII or VR-IX of AAV9 of the parental AAV capsid protein.

[0617] Implementation Scheme 86. The isolated nucleic acid as described in Implementation Scheme 84 or 85, wherein the peptide is inserted into VR-VIII of the parental AAV capsid protein.

[0618] Implementation Scheme 87. The isolated nucleic acid as described in Implementation Scheme 86, wherein the parental AAV capsid protein is the AAV9 capsid protein, and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0619] Implementation Scheme 88. An isolated cell comprising nucleic acid as described in any one of Implementation Schemes 84 to 87.

[0620] Implementation Scheme 89. A variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, and wherein: (i) the peptide insertion comprises the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acids, and X5 is Y, W or F; (ii) the peptide insertion site is in the variable region (VR) of the parental AAV capsid protein.

[0621] Implementation Scheme 90. A variant AAV capsid protein as described in Implementation Scheme 89, wherein the peptide is inserted into VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII, or VR-IX of the parental AAV capsid protein.

[0622] Implementation Scheme 91. A variant AAV capsid protein as described in Implementation Scheme 90, wherein the peptide is inserted into VR-VIII of the parental AAV capsid protein.

[0623] Implementation Scheme 92. The variant AAV capsid protein as described in Implementation Scheme 91, wherein the parental AAV capsid protein is the AAV9 capsid protein, and the VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein.

[0624] Implementation Scheme 93. A composition comprising a targeting portion and a payload, wherein the targeting portion comprises a peptide having the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acid, and X5 is Y, W or F.

[0625] Implementation Scheme 94. A composition comprising a targeting portion and a payload, wherein the targeting portion comprises a peptide having a sequence provided in Table 1, Table 2, Table 3 or Table 4.

[0626] Implementation Scheme 95. The composition as described in Implementation Scheme 93 or 94, wherein the targeting portion is coupled to or fused with the payload.

[0627] Implementation Scheme 96. The composition of any one of Implementation Schemes 93 to 95, wherein the targeting portion is inserted into a viral protein (e.g., AAV capsid).

[0628] Implementation Scheme 97. The composition of any one of Implementation Schemes 93 to 96, wherein the targeting portion is part of a carrier, for example incorporated into a carrier.

[0629] Implementation Scheme 98. The composition of any one of Implementation Schemes 93 to 96, wherein the targeting portion is not part of the carrier.

[0630] Implementation Scheme 99. The composition of any one of Implementation Schemes 93 to 98, wherein the targeting portion is a CNS targeting portion.

[0631] Implementation Scheme 100. A recombinant adeno-associated virus (rAAV) particle comprising: (a) a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, wherein: (i) the peptide insertion comprises a sequence of at least four, at least five, or at least six consecutive amino acids of a sequence provided in any one of Tables 1, 2, 3, or 4; and (ii) the peptide insertion site is in the variable region (VR) of the parental AAV capsid protein; and (b) a heterologous nucleic acid comprising a nucleotide sequence encoding a payload.

[0632] Implementation Scheme 101. A composition comprising a targeting portion and a payload, wherein the targeting portion comprises a sequence of at least four, at least five, or at least six consecutive amino acids of the sequences provided in any one of Table 1, Table 2, Table 3, or Table 4.

[0633] Implementation Scheme 102. The method of any one of Implementation Schemes 75 to 82, the method comprising administering the rAAV particles or a composition comprising the rAAV particles in combination with an immunosuppressive regimen.

[0634] Implementation Scheme 103. The method as described in Implementation Scheme 102, wherein the immunosuppressive regimen comprises: (i) dexamethasone or prednisolone, and (ii) a calcineurin inhibitor.

[0635] Implementation Scheme 104. The method as described in Implementation Scheme 103, wherein prednisolone is administered at a dose of about 3 mg / kg.

[0636] Implementation Scheme 105. The method as described in Implementation Scheme 103, wherein dexamethasone is administered at a dose of about 0.5 mg / kg.

[0637] Implementation Scheme 106. The method as described in Implementation Scheme 103, wherein the calcineurin inhibitor is tacrolimus.

[0638] Implementation Scheme 107. The method as described in Implementation Scheme 106, wherein tacrolimus is administered at a dose of about 1 mg / kg.

[0639] Implementation scheme 108. The method of any one of implementation schemes 102 to 107, wherein the immunosuppressive regimen is administered daily.

[0640] Implementation Scheme 109. The method of any one of Implementation Schemes 102 to 108, wherein the administration of the immunosuppressive regimen is initiated before the administration of the rAAV particles or the composition comprising the rAAV particles.

[0641] Implementation Scheme 110. The method of any one of Implementation Schemes 102 to 109, wherein the immunosuppressive regimen is administered as follows: (i) on each of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more days prior to the administration of the rAAV particles or the composition containing the rAAV particles; (ii) on the same day as the administration of the rAAV particles or the composition containing the rAAV particles; and / or (iii) on each of approximately 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or longer after the administration of the rAAV particles or the composition containing the rAAV particles.

[0642] Implementation Scheme 111. Use of the rAAV particles as described in any one of Implementation Schemes 1 to 73 or the pharmaceutical composition as described in Implementation Scheme 74 for delivering a payload to CNS cells.

[0643] Implementation Scheme 112. A composition comprising rAAV particles as described in any one of Implementation Schemes 1 to 73 or a pharmaceutical composition as described in Implementation Scheme 74, for delivering a payload to CNS cells.

[0644] Implementation Scheme 113. The use as described in Implementation Scheme 111 or the composition used as described in Implementation Scheme 112, wherein the CNS cells are in vitro.

[0645] Implementation Scheme 114. The use as described in Implementation Scheme 111 or the composition used as described in Implementation Scheme 112, wherein the CNS cells are in vivo.

[0646] Implementation Scheme 115. Use of the rAAV particles as described in any one of Schemes 1 to 73 or the pharmaceutical composition as described in Scheme 74 for treating a subject with CNS symptoms and / or improving the symptoms of CNS symptoms in the subject, including administering the rAAV particles or the pharmaceutical composition to the subject.

[0647] Implementation Scheme 116. A composition comprising rAAV particles as described in any one of Implementation Schemes 1 to 73 or a pharmaceutical composition as described in Implementation Scheme 74, for treating a subject with CNS symptoms and / or improving the symptoms of CNS symptoms in the subject, comprising administering the rAAV particles or the pharmaceutical composition to the subject.

[0648] Implementation Scheme 117. The use as described in Implementation Scheme 15 or the composition used as described in Implementation Scheme 116, wherein the CNS condition is selected from: Friedreich ataxia, Drave syndrome, spinocerebellar ataxia type 3, Niemann-Pick type C, Huntington's disease, Pompe disease, myotonic dystrophy type 1, glucose transporter 1 deficiency syndrome (Devivo syndrome), Tay-Sachs disease, spinal muscular atrophy, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Danon disease, Rett syndrome, Angelman syndrome, Parkinson's disease, tau proteinosis, hereditary epilepsy, or combinations thereof.

[0649] Implementation Scheme 118. The use as described in Implementation Scheme 15 or the composition used as described in Implementation Scheme 116, wherein the pharmaceutical composition is administered via a route of administration selected from the following: intravenous, intra-arterial, intracoronary, intraparenchymal, subpiaural, intrathecal, intraocular, intraventricular (ICV), intracerebellomedullary cistern (ICM), or intramuscular.

[0650] Implementation Scheme 119. The use as described in Implementation Scheme 15 or the composition used as described in Implementation Scheme 116, wherein the subject is a human.

[0651] Example The following embodiments are provided to provide a complete disclosure and description of how to make and use this disclosure to those skilled in the art, and are not intended to limit the scope of what the inventors consider to be their invention, nor are they intended to repre...

Claims

1. A recombinant adeno-associated virus (rAAV) particle, said recombinant adeno-associated virus (rAAV) particle comprising: (a) A variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to the corresponding parental AAV capsid protein, wherein: (i) The peptide insert comprises the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3, and X4 are independently any amino acid, and X5 is Y, W, or F; and (ii) The peptide insertion site is located in the variable region (VR) of the parental AAV capsid protein, and (b) Heterologous nucleic acids containing nucleotide sequences encoding payloads.

2. A recombinant adeno-associated virus (rAAV) particle, said recombinant adeno-associated virus (rAAV) particle comprising: (a) A variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to the corresponding parental AAV capsid protein, wherein: (i) The peptide insertion comprises the sequence provided in Table 1 or Table 3; and (ii) The peptide insertion site is located in the variable region of the parental AAV capsid protein, and (b) Heterologous nucleic acids containing nucleotide sequences encoding payloads.

3. The rAAV particle of claim 1 or 2, wherein the insertion site is located between two adjacent amino acids in the variable region of the parental AAV capsid protein.

4. The rAAV particle as claimed in any of the preceding claims, wherein the insertion of a heteropeptide replaces a continuous amino acid segment of the parental AAV capsid protein.

5. The rAAV particle as claimed in any of the preceding claims, wherein the peptide is inserted into VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII or VR-IX of the parental AAV capsid protein.

6. The rAAV particle as claimed in any of the preceding claims, wherein the peptide is inserted into VR-VIII of the parental AAV capsid protein.

7. The rAAV particle of claim 6, wherein the parental AAV capsid protein is the AAV9 capsid protein, and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein.

8. The rAAV particle of claim 6 or 7, wherein the insertion site is located between amino acids 588 and 589 of VP1, VP2 and / or VP3 of the AAV9 capsid protein or at the corresponding position in VP1 of the parental AAV capsid protein.

9. The rAAV particle as claimed in any of the preceding claims, wherein the variant AAV capsid protein comprises: (1) a peptide insertion comprising the sequence of SEQ ID NO: 75, SEQ ID NO: 1, SEQ ID NO: 77 or SEQ ID NO: 78, and (2) one or more sequences of VP1, VP2 or VP3 of the AAV9 capsid protein.

10. The rAAV particle of claim 9, wherein the peptide insertion comprises the sequence provided in Table 2 or Table 4.

11. The rAAV particle of any one of claims 1 to 8, wherein the peptide insertion comprises the sequence provided in Table 3.

12. The rAAV particle of any one of claims 9 to 11, wherein the peptide insert comprises the sequence of SEQ ID NO: 75 (TTMGVYI).

13. The rAAV particle as claimed in any of the preceding claims, wherein the variant AAV capsid protein confers increased infectivity and / or transduction to central nervous system (CNS) cells compared to the infectivity and / or transduction to CNS cells of a control AAV particle containing the corresponding parental AAV capsid protein.

14. The rAAV particle of claim 13, wherein the variant AAV capsid protein confers at least 1.5-fold increased infectivity and / or transduction in CNS cells compared to the infectivity and / or transduction in CNS cells of a control AAV particle containing the corresponding parental AAV capsid protein.

15. The rAAV particle of claim 13 or 14, wherein the CNS cells include CNS epithelial cells, nerve cells, CNS connective tissue cells, stem cells or progenitor cells, CNS immune cells, spinal cord cells or combinations thereof, optionally wherein; (a) The CNS epithelial cells include cells lining one or more ventricles; (b) The nerve cells include neural supporting cells, such as astrocytes, glial cells, or Schwann cells; and / or; (c) The CNS connective tissue cells include adipocytes or meningeal cells, or both; and / or one or more combinations thereof.

16. The rAAV particle as claimed in any of the preceding claims, wherein the variant AAV capsid protein further comprises one or more modifications to the amino acid sequence flanking the peptide insertion site, optionally wherein the one or more modifications are located within about 10 amino acids upstream or downstream of the peptide insertion site, for example, within about 5 amino acids upstream or downstream of the peptide insertion site.

17. The rAAV particle as claimed in any of the preceding claims, wherein the variant AAV capsid protein further comprises one or more modifications to the amino acid sequence at or near the glycan-binding region, optionally wherein the one or more modifications reduce glycan binding.

18. The rAAV particle of claim 16 or 17, wherein the one or more modifications are at or between the following amino acids: (a) The corresponding positions in the capsid protein of AAV9 at positions 271 and 272 or in the capsid protein of another parent AAV capsid protein; (b) The corresponding position in the capsid protein of AAV9 at position 446 or in the capsid protein of another parent AAV capsid protein; (c) The corresponding position in the capsid protein of AAV9 at position 470 or in the capsid protein of another parent AAV capsid protein; (d) Positions 501 and 505 of the AAV9 capsid protein (e.g., at any one or all or a combination of residues 501, 502, 503, 504 or 505) or the corresponding position in the capsid protein of another parent AAV capsid protein. (e) The corresponding positions of VP1 489 and 545 of the AAV9 capsid protein or the capsid protein of another parent AAV capsid protein. (f) The corresponding positions at VP1 591 and 621 of the AAV9 capsid protein or in the capsid protein of another parent AAV capsid protein; or (g) Any combination or all of (a)-(f).

19. The rAAV particle as claimed in any of the preceding claims, wherein the variant AAV capsid protein has at least 90% identity with the parental AAV capsid protein.

20. The rAAV particle of claim 19, wherein the percentage of identity is determined by comparing the sequence of a variant AAV capsid protein without the peptide insertion with the parental AAV capsid protein.

21. The rAAV particle as claimed in any of the preceding claims, wherein the parental AAV capsid protein is the AAV9 capsid protein of SEQ ID NO: 2001.

22. The rAAV particle as claimed in any of the preceding claims, wherein the payload is or comprises a polypeptide.

23. The rAAV particle of claim 22, wherein the polypeptide is or comprises: (i) A CRISPR-Cas protein, optionally, wherein the CRISPR-Cas protein is a type II, type V or type VI CRISPR-Cas protein, such as Cas9 protein, Cas12a protein, Cas12b protein, Cas12c protein, Cas12d protein, Cas12e protein, Cas12f protein, Cas12g protein, Cas12h protein, Cas12i protein, Cas13a protein, Cas13b protein or a variant or fragment thereof; (ii) Zinc finger proteins, or their variants or fragments; (iii) TALEN protein, or its variants or fragments; (iv) A base editor, or a variant or fragment thereof; (v) A pre-editor, or a variant or fragment thereof; (vi) Meganuclease or its variants or fragments; (vii) enzyme; (viii) Antibodies; and / or (ix) Secretory protein.

24. The rAAV particle of claim 23, wherein the polypeptide is associated with CNS disease.

25. The rAAV particle according to any one of claims 1 to 21, wherein the payload is or comprises an RNA molecule, optionally wherein the RNA molecule is siRNA, miRNA, gRNA, antisense RNA, circular RNA, snRNA, or aptamer.

26. The rAAV particle of claim 25, wherein the RNA molecule targets a nucleic acid molecule encoding a polypeptide associated with CNS disease.

27. The rAAV particles of claim 24 or 26, wherein the CNS condition is selected from: Friedreich ataxia, Drave syndrome, spinocerebellar ataxia type 3, Niemann-Pick type C, Huntington's disease, Pompe disease, myotonic dystrophy type 1, glucose transporter 1 deficiency syndrome (Devivo syndrome), Tay-Sachs disease, spinal muscular atrophy, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Danon disease, Rett syndrome, Angelman syndrome, Parkinson's disease, tau proteinosis, hereditary epilepsy, or combinations thereof.

28. The rAAV particle according to any one of claims 1 to 21, wherein the payload is or comprises a DNA molecule.

29. The rAAV particle as claimed in any of the preceding claims, wherein the nucleotide sequence encoding the payload is operatively linked to a promoter; optionally, wherein the promoter is or comprises a CNS promoter or a chicken β-actin heterozygous (CBh) promoter.

30. The rAAV particle of claim 29, wherein the CNS promoter is selected from: GFAP promoter, SYN1 promoter, NSE / RU5' promoter, neuroactive peptide cholecystokinin (CCK) promoter, myelin basic promoter (MBP), human myelin-associated glycoprotein promoter, phosphate-activated glutaminase (PAG) promoter, vesicle glutamate transporter (vGLUT) promoter, glutamate decarboxylase (GAD) promoter, Camk2a promoter, TH (tyrosine hydroxylase) promoter, Hb9 promoter, CNP promoter, NES (nestin) promoter, Tub1a promoter, SST (somatostatin) promoter, MeCP2 promoter, or any combination thereof.

31. A pharmaceutical composition comprising: (a) rAAV particles as described in any of the preceding claims; and (b) Pharmaceutically acceptable excipients.

32. A method of delivering a payload to CNS cells, the method comprising administering the pharmaceutical composition of claim 31 to the CNS cells, optionally wherein; (a) The CNS cells are in vitro; or (b) The CNS cells in vivo.

33. The method of claim 32, wherein the CNS cells are derived from a subject who has or has been diagnosed with a CNS disorder.

34. A method for treating a subject with CNS disorders and / or improving the symptoms of the subject's CNS disorders, the method comprising: The pharmaceutical composition as described in claim 31 is administered to the subject.

35. The method of claim 33 or 34, wherein the CNS condition is selected from: Friedreich ataxia, Drave syndrome, spinocerebellar ataxia type 3, Niemann-Pick type C, Huntington's disease, Pompe disease, myotonic dystrophy type 1, glucose transporter 1 deficiency syndrome (Devivo syndrome), Tay-Sachs disease, spinal muscular atrophy, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Danon disease, Rett syndrome, Angelman syndrome, Parkinson's disease, tau proteinosis, hereditary epilepsy, or combinations thereof.

36. The method of any one of claims 32 to 35, wherein the pharmaceutical composition is administered via an administration route selected from: intravenous, intra-arterial, intracoronary, intraparenchymal, subpiaural, intrathecal, intraocular, intraventricular (ICV), intracerebellomedullary cistern (ICM), or intramuscular.

37. The method of any one of claims 33 to 36, wherein the subject is a human being.

38. An isolated cell, said isolated cell being transduced with rAAV particles as claimed in any one of claims 1 to 30.

39. An isolated nucleic acid comprising a nucleotide sequence encoding a variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to a corresponding parental AAV capsid protein, and wherein: (i) The peptide insert contains the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acid, and X5 is Y, W or F; (ii) The peptide insertion site is located in the variable region (VR) of the parental AAV capsid protein.

40. The isolated nucleic acid of claim 39, wherein the peptide is inserted into VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII or VR-IX of AAV9 of the parental AAV capsid protein.

41. The isolated nucleic acid as claimed in claim 39 or 40, wherein the peptide is inserted into VR-VIII of the parental AAV capsid protein, optionally wherein the parental AAV capsid protein is an AAV9 capsid protein, and VR-VIII comprises amino acids 580 to 601 of VP1, VP2, or VP3 of the AAV9 capsid protein.

42. An isolated cell comprising the nucleic acid as described in any one of claims 39 to 41.

43. A variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to the corresponding parental AAV capsid protein, and wherein: (i) The peptide insert contains the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acid, and X5 is Y, W or F; (ii) The peptide insertion site is located in the variable region (VR) of the parental AAV capsid protein.

44. The variant AAV capsid protein of claim 43, wherein the peptide is inserted into VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII or VR-IX of the parental AAV capsid protein.

45. A composition comprising a targeting portion and a payload, wherein the targeting portion comprises a peptide having the sequence X1X2X3X4VX5I (SEQ ID NO: 1), wherein X1, X2, X3 and X4 are independently any amino acid, and X5 is Y, W or F.

46. ​​A composition comprising a targeting portion and a payload, wherein the targeting portion comprises a peptide having a sequence provided in Table 1, Table 2, Table 3 or Table 4.

47. The composition of claim 45 or 46, wherein the targeting portion; (a) Combined or integrated with the said payload; and / or (b) Insertion into viral proteins, such as AAV capsids.

48. The composition of any one of claims 45 to 47, wherein the targeting portion is a CNS targeting portion.

49. A recombinant adeno-associated virus (rAAV) particle, said recombinant adeno-associated virus (rAAV) particle comprising: (a) A variant AAV capsid protein, wherein the variant AAV capsid protein comprises a peptide insertion relative to the corresponding parental AAV capsid protein, wherein: (i) The peptide insert comprises a sequence of at least four, at least five, or at least six consecutive amino acids comprising the sequences provided in any of Tables 1, 2, 3, or 4; and (ii) The peptide insertion site is located in the variable region (VR) of the parental AAV capsid protein, and (b) Heterologous nucleic acids containing nucleotide sequences encoding payloads.

50. A composition comprising a targeting portion and a payload, wherein the targeting portion comprises a sequence of at least four, at least five, or at least six consecutive amino acids of the sequences provided in any one of Table 1, Table 2, Table 3, or Table 4.

Images