Breeding method and breeding device of KASP marker of ciliatus pepper orange fruit color

CN122581177APending Publication Date: 2026-08-18QINGHAI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610837558.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-11
Publication Date
2026-08-18

AI Technical Summary

Technical Problem

[0007]另一方面,F2代种子的萌发和幼苗期培养质量会影响后续叶片取样、DNA提取质量及分型检测稳定性

Benefits of technology

通过第一亲本和第二亲本构建分离群体,并在F2代幼苗期采用KASP分子标记K792和K846进行基因分型检测,能够在植株结果成熟前筛选K792位点为C:C且K846位点为T:T的目标单株,从而实现橙色成熟果色相关基因型的早期选择,减少对成熟期表型观察的依赖。在F2代幼苗展开2-3片真叶时采集叶片并提取基因组DNA进行检测,能够在幼苗阶段完成目标单株初筛。有利于提前淘汰非目标个体,减少后续温室或田间空间占用,降低水肥、人工和管理成本。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122581177A_ABST
    Figure CN122581177A_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of plant breeding, and particularly to a breeding method of a KASP marker of a line of orange pepper and a breeding device. The breeding method comprises S1, parent selection; S2, hybridization group building; S3, sampling and extraction; S4, marker typing; and S5, screening and fixing. The breeding device comprises a breeding box main body and a breeding part. The breeding box main body is internally provided with a plurality of partition plates, and breeding spaces are formed between adjacent partition plates. The breeding part is arranged in the breeding spaces. The breeding part comprises two cultivation boxes and a climate adjusting assembly. The climate adjusting assembly is connected between the two cultivation boxes. A mounting channel is formed in the middle of the partition plate. The mounting channel is provided with a lighting lamp. The two cultivation boxes of the breeding part are arranged on the two sides of the lighting lamp. The method is beneficial to eliminating non-target individuals in advance, reducing the occupation of subsequent greenhouse or field space, and reducing the cost of water, fertilizer, labor and management.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant breeding technology, specifically to a breeding method and apparatus for KASP marker breeding of orange fruit color in Xunhua line peppers. Background Technology

[0002] Xunhua chili peppers are a distinctive local chili pepper resource, and their mature fruit color, shape, flavor, and commercial characteristics directly affect their promotional value and market acceptance. The mature fruit colors of Xunhua chili peppers mainly include red and orange, with orange mature fruit materials having better visual identification and breeding value. Current breeding of new Xunhua chili pepper lines typically relies on traditional breeding processes such as hybridization, self-pollination, field or greenhouse cultivation, and artificial phenotypic identification at maturity.

[0003] In traditional breeding processes, fruit color traits can usually only be observed and judged after the plant has flowered, fruited, and entered the ripening stage. Because chili peppers require a long time from sowing and seedling growth to fruit ripening, breeders often need to invest significant resources in greenhouses, fields, water, fertilizer, and manual management before deciding whether to retain a particular plant or family based on the color of the ripe fruit. For segregating populations such as the F2 generation, a large number of individuals will ultimately be eliminated because they do not meet the target fruit color, resulting in substantial early-stage resource consumption and a long breeding cycle.

[0004] Meanwhile, the artificial phenotypic identification of mature fruit color is easily affected by factors such as light, temperature, water and fertilizer conditions, degree of maturity, and the subjective judgment of the observer. Especially among materials with similar phenotypes such as red, light red, orange, or intermediate colors, relying solely on visual observation can easily lead to misjudgment, making it difficult to quickly and accurately screen for target plants with orange mature fruit color during the seedling stage.

[0005] Molecular marker-assisted breeding enables targeted selection of specific traits based on genotype during the seedling stage. However, existing SSR, AFLP, and universal SNP markers are mostly broad-spectrum markers, lacking specificity and accuracy for the orange ripe fruit color trait of Xunhua pepper. Disclosure data indicates that the orange ripe fruit color trait of Xunhua pepper cannot be accurately explained simply by mutations in known structural genes such as CCS and PSY. Markers developed for known red fruit color-related genes are difficult to directly apply to this orange-fruit-colored material. Therefore, there is an urgent need to establish a molecular marker system closely related to the orange ripe fruit color trait of Xunhua pepper, suitable for high-throughput detection.

[0006] KASP genotyping technology has advantages such as high throughput, fast detection speed, and relatively clear result interpretation, making it suitable for SNP locus detection in large-scale breeding populations. However, in the breeding of orange-ripe peppers in Xunhua County, how to select marker loci that can distinguish between red and orange parents and indicate the target orange fruit color genotype, and how to complete rapid sampling, detection, and screening during the F2 seedling stage, remain problems that need to be solved by existing technologies.

[0007] On the other hand, the germination and seedling culture quality of F2 generation seeds affect the subsequent leaf sampling, DNA extraction quality, and the stability of genotyping detection. While existing conventional seedling trays or artificial climate cultivation equipment can provide certain temperature, light, and humidity conditions, multiple batches of seedlings in multiple spaces require simultaneous batch cultivation using multiple devices. Furthermore, within the same climate chamber, uneven temperature and humidity regulation, insufficient airflow exchange efficiency, excessively high or low local humidity, and uneven light utilization can easily occur at different locations. These issues affect seedling uniformity and leaf condition, thus impacting sample consistency in high-throughput KASP detection.

[0008] Therefore, there is a need for a breeding program that can combine the detection of orange fruit color-related KASP markers with controlled seedling cultivation, and a breeding device suitable for this program is needed to quickly and stably obtain test samples and screen for target single plants with orange mature fruit color during the F2 generation seedling stage. Summary of the Invention

[0009] To address the aforementioned problems, this invention provides a breeding method and apparatus for KASP marker breeding of orange fruit color in Xunhua chili peppers.

[0010] The technical solution adopted by this invention to solve its technical problem is: a KASP marker breeding method for orange fruit color of Xunhua line peppers, characterized by including the following steps: S1. Parental selection: Segregating populations were constructed using chili peppers from the Xunhuaxian variety with different mature fruit colors. The first parent was G:G at the K792 marker site and G:G at the K846 marker site, with a mature fruit color of red. The second parent was C:C at the K792 marker site and T:T at the K846 marker site, with a mature fruit color of orange. S2. Hybridization and population establishment: The first parent is hybridized with the second parent to obtain the F1 generation, and the F1 generation is self-pollinated to obtain the F2 generation. The F2 generation seeds are placed in a breeding device for germination and seedling cultivation. The breeding device is used to control the germination and seedling cultivation conditions of the F2 generation seeds. S3. Sampling and extraction: Collect leaves and extract genomic DNA during the F2 generation seedling stage; S4. Genotyping: The genomic DNA was genotyped using KASP molecular markers K792 and K846. S5. Screening and fixation: Based on the genotyping results of K792 and K846, F2 generation seedlings with K792 locus C:C and K846 locus T:T were selected as target single plants with orange mature fruit color. They were then further cultivated and self-pollinated to obtain stable orange mature fruit color Xunhuaxian pepper breeding materials.

[0011] As an optimization, the K792 marker is located at position 219174466 of the pepper reference genome NC_061116.1; the K846 marker is located at position 219344429 of the pepper reference genome NC_061116.1. The K792 marker is used to detect G / C allelic variations, and the K846 marker is used to detect the G allele carried by the red parent and the T allele carried by the orange parent.

[0012] As an optimization, in step S5, the leaves of the F2 generation seedlings are collected 12-20 days after sowing, when the seedlings have unfolded 2-3 true leaves; 100-200 mg of fresh leaves are collected from each seedling, and genomic DNA is extracted using a high-throughput DNA extraction kit or the CTAB method.

[0013] A breeding device includes a breeding box body and a breeding section. The breeding box body has several partitions inside, and a breeding space is formed between adjacent partitions. The breeding section is located in the breeding space and includes two cultivation boxes and a climate control component. The climate control component is connected between the two cultivation boxes. An installation channel is provided in the middle of the partition plate, and a lighting lamp is provided in the installation channel. The two cultivation boxes of the breeding section are respectively located on both sides of the lighting lamp.

[0014] As an optimization, the climate control component includes a connecting pipe and a control box. The connecting pipe is connected between two incubation boxes, and the control box is connected through the middle of the connecting pipe. The control box has a first control channel, a second control channel, and a third control channel arranged in parallel inside. When the climate control component drives the airflow between the two incubation boxes, the airflow directions of the second control channel and the third control channel are opposite, forming a low-pressure micro-circulation area at the second control channel and the third control channel, which drives the gas in the two incubation boxes to flow rapidly towards the control box. The first regulating channel is equipped with two solenoid valves, and a water distribution pipe is arranged between the two solenoid valves. Both the second and third regulating channels are equipped with circulating air pumps. The second regulating channel is equipped with a moisture absorption component, and the third regulating channel is equipped with a humidification component, an air exchange component, and a heating component.

[0015] As an optimization, the second and third adjustment channels are arranged adjacent to each other. The humidification component includes a humidification box and an atomizing nozzle. The opening of the atomizing nozzle faces the inside of the third adjustment channel. The ventilation component includes a ventilation pipe and a ventilation pump. The heating component includes a heating wire that extends into the inside of the third adjustment channel. The moisture-absorbing component includes a moisture-absorbing box, and a moisture-absorbing block is detachably connected inside the moisture-absorbing box.

[0016] As an optimization, the first adjustment channel, the second adjustment channel, and the third adjustment channel are arranged in parallel, and the length direction of the three channels is arranged along the length direction of the connecting pipe. Both sides of the microcirculation area are equipped with detection sensing modules, which include temperature sensors, humidity sensors, and air pressure sensors.

[0017] As an optimization, the incubation box includes a main body and a cover plate. The cover plate is L-shaped, with the horizontal section covering the top of the main body and the vertical section covering the upper part of the main body adjacent to the lighting lamp. The cover plate is detachably connected to the main body and is made of a light-transmitting material. The light-transmitting material of the cover plate of the cultivation box in different breeding spaces may be the same or different.

[0018] As an optimization, a connecting rod is provided between the main parts of the two incubation boxes. The connecting rod is arranged parallel to the connecting tube, and several fixing plates are connected between the connecting rod and the connecting tube.

[0019] As an optimization, the adjustment box is equipped with a control panel, which is used to execute adjustment commands on the adjustment box.

[0020] The beneficial effects of this plan are as follows: By constructing segregating populations using first and second parents, and performing genotyping using KASP molecular markers K792 and K846 during the F2 seedling stage, target plants with C:C at the K792 locus and T:T at the K846 locus can be screened before fruit maturity. This allows for early selection of genotypes related to orange-colored mature fruit, reducing reliance on phenotypic observation at maturity. When F2 seedlings have 2-3 true leaves, leaves are collected and genomic DNA is extracted for testing, enabling initial screening of target plants at the seedling stage. This facilitates the early elimination of non-target individuals, reducing subsequent greenhouse or field space occupation and lowering water, fertilizer, labor, and management costs.

[0021] The breeding device of this application can carry out regional cultivation of different batches or combinations of F2 generation materials, and simultaneously conduct simulated cultivation under different climates to meet breeding needs and improve breeding quality and efficiency. The two incubation boxes are connected by a connecting tube and a regulating box, and a low-pressure micro-circulation area with opposite airflow directions is formed by the second and third regulating channels, so that the gas in the two incubation boxes can flow rapidly towards the regulating box, thereby improving the air exchange efficiency in the incubation boxes and improving the problem of uneven local temperature and humidity. The invention combines the detection of KASP markers related to the orange ripe fruit color of Xunhua pepper, early screening of F2 generation seedlings, and a controlled breeding device, which can shorten the fruit color selection cycle, improve the accuracy of target single plant screening, reduce ineffective cultivation costs, and improve the stability of seedling sample culture and detection process. It is suitable for molecular-assisted breeding of ripe orange ripe fruit materials of Xunhua pepper. Attached Figure Description

[0022] Figure 1 This is an isometric view of the breeding device of the present invention.

[0023] Figure 2 This is a front view schematic diagram of the breeding device of the present invention.

[0024] Figure 3 This is an axonometric view of the breeding section of the present invention.

[0025] Figure 4 This is a schematic diagram of the breeding section of the present invention.

[0026] Figure 5 For the present invention Figure 4 A schematic diagram of the AA cross-section structure.

[0027] Figure 6 For the present invention Figure 5 A magnified structural diagram of part B.

[0028] The components include: 1. Breeding box body; 2. Divider plate; 3. Incubation box; 4. Lighting lamp; 5. Connecting pipe; 6. Adjustment box; 7. First adjustment channel; 8. Second adjustment channel; 9. Third adjustment channel; 10. Solenoid valve; 11. Water distribution pipe; 12. Circulating air pump; 13. Humidification box; 14. Air exchange pipe; 15. Heating wire; 16. Moisture absorption box; 17. Detection sensor module; 18. Cover plate; 19. Connecting rod; 20. Control panel. Detailed Implementation

[0029] A breeding method for orange-fruit-colored KASP markers in Xunhua peppers, characterized by the following steps: S1. Parental selection: Selected chili peppers with stable mature fruit color and different genetic backgrounds as parents. The first parent is a red mature fruit color parent, and the second parent is an orange mature fruit color parent. The first parent is G:G at the K792 marker site and G:G at the K846 marker site, and the second parent is C:C at the K792 marker site and T:T at the K846 marker site. Before using the parent plants, genomic DNA was extracted from fresh leaves of each parent plant and genotyping was performed using K792 and K846 markers. When the genotyping result of the first parent was G:G / G:G and the genotyping result of the second parent was C:C / T:T, and the fruit color of the two parents remained stable for 2-3 consecutive growth cycles, they were used for subsequent hybridization and population establishment.

[0030] S2. Hybridization and Population Establishment: The first parent is crossed with the second parent to obtain the F1 generation. When the F1 seedlings have 2-3 true leaves, leaves are collected and genotyped using K792 and K846 markers. If the K792 locus of the F1 seedling is G:C or C:G, and the K846 locus is G:T or T:G, it indicates that it is the expected heterozygous genotype. The F1 generation that has passed genotyping verification is further cultivated and self-pollinated. The self-pollinated seeds of the F1 generation are harvested to obtain F2 generation seeds.

[0031] Each hybridization combination should yield no fewer than 200 F1 seeds, and after self-pollination of the F1 generation, no fewer than 500 F2 generation seeds should be obtained to meet the high-throughput screening requirements of the F2 generation segregating population. If the F1 generation heterozygous genotype verification rate is less than 95%, the homozygosity of the parents, hybridization procedures, or seed contamination should be re-examined.

[0032] F2 generation seeds are placed in a breeding device for germination and seedling cultivation. The breeding device is used to control the germination and seedling cultivation conditions of F2 generation seeds. During the seedling cultivation process, individual plants or individual holes can be numbered according to methods such as F2-001 and F2-002 to maintain a one-to-one correspondence between seeds, seedlings, leaf samples, DNA samples, and subsequent mature plants. By using a breeding device to cultivate F2 generation materials of different batches or different hybrid combinations in different areas, the impact of environmental fluctuations on seedling growth and leaf sampling quality can be reduced.

[0033] S3. Sampling and extraction: Collect leaves and extract genomic DNA during the F2 generation seedling stage; 12-20 days after sowing F2 seedlings, when the seedlings have developed 2-3 true leaves, collect 100-200 mg of fresh leaves from each seedling. The collected leaves can be placed in clearly labeled centrifuge tubes or 96-well plates, and associated with the individual F2 seedling numbers. Genomic DNA is extracted using a plant genomic DNA extraction kit or the CTAB method. The extracted DNA concentration is adjusted to 20-50 ng / μL, and the OD260 / 280 is controlled at 1.8-2.0 to meet the requirements for subsequent KASP genotyping.

[0034] S4. Genotyping: The genomic DNA was genotyped using KASP molecular markers K792 and K846. The K792 marker is located at locus 219174466 of the pepper reference genome NC_061116.1 and is used to detect G / C allelic variations. The K846 marker is located at locus 219344429 of the pepper reference genome NC_061116.1 and is used to detect the G allele carried by the red parent and the T allele carried by the orange parent.

[0035] The forward primer for K792 is GAAGGTGACCAAGTTCATGCTCTGCTTGTTTGACCTAGTTATATTACTTA, and the reverse primer for K792 is GAAGGTCGGAGTCAACGGATTTGCTTGTTTGACCTAGTTATATTACTTG; the forward primer for K846 is GAAGGTGACCAAGTTCATGCTATATCTCTAATTTTCAAGGGGTCTC, and the reverse primer for K846 is GAAGGTCGGAGTCAACGGATTATATCTCTAATTTTCAAGGGGTCTT.

[0036] KASP genotyping can be performed on a real-time quantitative PCR platform or a 384-well KASP genotyping platform. For a single detection reaction, the total reaction volume is 20 μL, containing 10 μL of 2×SYBR GreenMaster Mix, 2 μL of sample genomic DNA, specific primers corresponding to the KASP label, and ddH2O. For high-throughput detection, K792 and K846 detection wells can be set up separately in the same 384-well plate, along with a known genotype positive control and a template-free negative control.

[0037] The amplification program can be set as follows: 94°C pre-denaturation for 2 min; 94°C denaturation for 5 s, 60°C annealing / extension for 30 s, for a total of 40 cycles; after amplification, melting curve analysis is performed at 55°C to 95°C. After detection, the genotypes of each sample at the K792 and K846 loci are determined based on the fluorescence signal, Ct value, melting curve, and / or the results output by the genotyping software.

[0038] S5. Screening and Fixation: F2 generation seedlings were classified according to the genotyping results of the two markers K792 and K846. Plants with K792 locus G:G and K846 locus G:G were identified as homozygous for red mature fruit color; plants with K792 locus G:C and K846 locus G:T were identified as heterozygous; and plants with K792 locus C:C and K846 locus T:T were identified as homozygous for orange mature fruit color.

[0039] When the breeding objective is orange mature fruit color, F2 seedlings with K792 locus C:C and K846 locus T:T are selected as target single plants for orange mature fruit color, and non-target genotype seedlings are discarded or managed separately. The selected target single plants are further cultivated until the flowering and fruiting period, and the fruit color performance is observed and recorded at maturity. Single plants with fruit color consistent with the target and comprehensive agronomic traits that meet the breeding objective are self-pollinated to form F3 inbred lines.

[0040] In the F3 to F4 generations, 3-5 plants from each inbred line were selected again for leaf collection and K792 and K846 genotyping tests. When all individuals within the same inbred line maintained the C:C / T:T homozygous genotype and the mature fruit color was stably orange, the inbred line was determined to be a stable orange mature fruit color inbred line, which could be used as material for subsequent cultivar evaluation or regional trials.

[0041] F2 generation population screening and validation: Approximately 600 F2 generation seeds were sown. Samples were taken about 15 days after sowing, when the seedlings had 2-3 true leaves. Genotyping was performed using K792 and K846 markers, respectively. The results showed that the F2 generation population yielded three types of plants: G:G / G:G homozygous, G:C / G:T heterozygous, and C:C / T:T homozygous, with the ratio of the three genotypes closely resembling a 1:2:1 segregation pattern.

[0042] C:C / T:T homozygous seedlings were retained as target plants for orange mature fruit color and continued to be cultivated until maturity. Fruit color was observed and recorded at maturity. When the K792 / K846 marker was used for F2 population testing, the genotype and mature fruit color phenotype concordance rate reached over 98%, which significantly reduced misjudgments caused by relying on manual observation at maturity for initial screening and allowed for early identification of target plants in the seedling stage.

[0043] Therefore, this invention establishes a complete molecular-assisted breeding process for orange-ripe Xunhua peppers through parental genotype verification, controlled F2 seedling culture, K792 / K846 high-throughput genotyping, target genotype screening, and high-generation self-pollination fixation. Those skilled in the art can implement this method and obtain Xunhua pepper breeding materials with stable orange-ripe fruit color based on the above steps.

[0044] Example 1: Complete operation from two parents to F1 generation 1. Source of materials and preliminary identification: Red parent 'XHB': from the College of Agriculture and Forestry, Qinghai University; phenotype is deep red, without orange-yellow patches; Orange parent 'H0809': from the College of Agriculture and Forestry, Qinghai University; phenotype is uniformly orange, and its performance has been stable over many years.

[0045] 2. Parental KASP mark verification DNA extraction CTAB method, 100mg fresh leaves At a concentration of 50 ng / μL, OD260 / 280 = 1.8 K792 testing KASP classification 'XHB': G:G; 'H0809': C:C K846 Detection KASP classification 'XHB': G:G; 'H0809': T:T Trait stability assessment After three consecutive generations of self-pollination or aseptic propagation, observe the fruit color. 'XHB' (red) is stable, 'H0809' (orange) is stable. 3. Hybridization operation: Healthy 'XHB' and 'H0809' plants were selected and artificially hybridized during their peak flowering period, with both reciprocal and orthogonal crosses performed, resulting in a total of 400 F1 seeds.

[0046] 4. F1 Seed Sowing and Seedling KASP Screening: F1 seeds were sown, with a germination rate of 98%, yielding approximately 390 F1 seedlings. 15 days after sowing, when the seedlings had 2-3 true leaves, KASP testing was performed. Expected results: all F1 seedlings with K792 genotype G:C and K846 genotype G:T. Actual test results: 375 seedlings met expectations (96.2% validation rate).

[0047] 5. Phenotypic evaluation of F1 adults: All F1 fruits are red or light red, confirming that red is the dominant trait. F1 plants flower uniformly and produce abundant fruit.

[0048] 6. F1 self-pollination seed collection: Obtain sufficient F1 self-pollinated seeds (approximately 600 seeds) for the F2 generation.

[0049] Example 2: Large-scale KASP screening of F2 generation seedlings 1. Sowing and seedling emergence: Sowing time: March 1, 2025; Sowing quantity: 600 F1 self-pollinated seeds; Sowing location: breeding equipment; Conditions: Temperature 22-25°C, photoperiod 16h / 8h, relative humidity 60-70%; Emergence time: March 7-10 (emergence in about 7-10 days) 2. Seedling sampling and DNA extraction: Sampling period: March 15-20 (12-20 days after sowing) Sampling criteria: Seedlings with 2-3 true leaves unfolded Sample preparation: Numbered F2-001 to F2-600, take 150 mg of fresh leaves per plant, place them in a 2 mL marked microcentrifuge tube, add liquid nitrogen and freeze immediately.

[0050] DNA extraction (96-well plate high-throughput method): Using the Spark Jade Plant DNA Kit, 600 samples were divided into 7 batches (80-96 samples per batch), with each batch taking about 2 hours to extract, and the final concentration was adjusted to 30 ng / μL.

[0051] 3. KASP Fractal Operation: Instrument: Roche LightCycler 480II Real-Time PCR System.

[0052] 384-well plate design: 1st and 2nd 384-well plates: F2-001 to F2-192, marked K792; 3rd-4th 384-well plates: F2-001 to F2-192, marked K846; 5th-6th 384-well plates: F2-193 to F2-384, marked K792; 7th-8th well plates of 384: F2-193 to F2-384, marked K846; 9th-10th well plates of 384: F2-385 to F2-576, K792 and K846 mixed; 384-well plates 11-12: F2-577 to F2-600, K792 and K846 mixed.

[0053] Total testing time: reaction solution preparation: 30-40 minutes; PCR amplification: approximately 2-3 hours; data analysis: 30-60 minutes; total time for a single 384-well plate: 3-4 hours; time to complete testing of all 600 samples: 2-3 days.

[0054] 4. Genotype interpretation and classification: Use RocheLightCyclerSoftware for automatic interpretation.

[0055] Sample classification results: G:G / G:G 148 25.2% red reserve G:C / G:T 298 50.8% Separation disuse C:C / T:T 146 24.9% orange color Retain as needed Number of seedlings retained: approximately 150 G:G / G:G red homozygous seedlings; Number of seedlings culled: Approximately 298 heterozygous plants; Release of greenhouse space: approximately 75%.

[0056] 5. Phenotypic validation and accuracy statistics: Fruit ripening observation (approximately 90-120 days after planting): Record the number, shape, and color of each fruit on each plant. Fruit color assessment: Use a standard colorimetric card.

[0057] Results statistics: Overall compliance rate: (147+145) / (148+146)=292 / 294=99.3%.

[0058] Example 3: Verification of homozygosity in higher generation lines 1. The KASP of the F3-F4 generation high-generation series is verified again: Materials: 125 inbred lines (F3-001 to F3-125) were formed from 148 red homozygous seedlings retained from the F2 generation after 2-3 generations of self-pollination.

[0059] Procedure: Four replicates (four adult plants) were selected from each high-generation line. 100 mg of fresh leaves were taken from each plant. A total of 125 inbred lines × 4 replicates = 500 plant samples were collected and KASP typing was performed.

[0060] Test results: Among the 125 inbred lines, the genotypes of the four individuals tested in each inbred line were 100% identical, and all should maintain the G:G / G:G homozygous type, which meets the requirement that the inbred line is completely homozygous.

[0061] 6. Cost and Time Statistics: Time cost: from sowing to sampling: 15 days, KASP test completed: 3 days, seedlings determined to be viable: 18 days, seedlings cultivated to fruit maturity: 40-50 days, total time: 70-80 days (40-70 days earlier than the traditional 120-150 days).

[0062] Economic Costs: Planting costs for 600 F2 generation seedlings (land, irrigation, fertilizer, etc.): Traditional method (all mature seedlings): approximately 8,000-10,000 RMB; This method (only 150 seedlings are kept, the rest are discarded): approximately 2,000-3,000 RMB, saving 5,000-7,000 RMB. KASP testing cost: 600 seedlings × 40 RMB / seedling = 24,000 RMB (if 3-4 different hybridization combinations are carried out simultaneously, the cost per combination is 6,000-8,000 RMB). Overall Cost Comparison: Traditional method: 8,000-10,000 + 15,000-20,000 (later management) = 23,000-30,000 RMB; This method: 2,000-3,000 + 8,000 (KASP) + 3,000-5,000 (later management) = 13,000-16,000 RMB, saving 7,000-17,000 RMB per F2 generation.

[0063] like Figures 1-6 As shown, the breeding device is applied to the KASP marker breeding method for orange fruit color of Xunhua pepper. Its features include: a breeding box body 1 and a breeding section; the breeding box body 1 has several partitions 2 inside, forming a breeding space between adjacent partitions 2; the breeding section is located within the breeding space; the breeding section includes two cultivation boxes 3 and a climate control component; the climate control component is connected between the two cultivation boxes 3. An installation channel is provided in the middle of the partition plate 2, and a lighting lamp 4 is provided in the installation channel. The two cultivation boxes 3 of the breeding section are respectively located on both sides of the lighting lamp 4.

[0064] This embodiment also provides a breeding device applied to the aforementioned KASP marker breeding method for orange fruit color in Xunhua line peppers, particularly suitable for F2 generation seed germination, seedling cultivation, and environmental control before leaf sampling. The breeding device, by setting up multiple breeding spaces, can perform zoned cultivation of F2 generation materials from different batches, different hybrid combinations, or different numbering segments, facilitating subsequent management corresponding to the K792 and K846 genotyping results.

[0065] The breeding box body 1 forms the outer shell and overall support structure of the device. The breeding box body 1 can be made of stainless steel plate, aluminum alloy profile, powder-coated steel plate, or rigid engineering plastic. Its inner wall can be made of corrosion-resistant and easy-to-clean materials, such as SUS304 stainless steel plate, PVC plate, or ABS plate. An insulation layer can be installed on the outside of the breeding box body 1. The insulation layer can be made of polyurethane foam, rubber-plastic insulation material, or polystyrene foam material to reduce the impact of external temperature changes on the breeding space. The breeding box body 1 is also equipped with an openable door or maintenance door, and a sealing strip can be installed at the door to reduce temperature and humidity fluctuations within the breeding space.

[0066] The partition plate 2 is made of aluminum alloy plate, stainless steel sheet, PVC plate or acrylic plate. The partition plate 2 can be connected to the main body 1 of the breeding box by screws, slots or buckles, preferably a detachable structure, so as to adjust the number and height of breeding space according to different seedling scales. The surface of the partition plate 2 can be coated with a waterproof coating or an anti-corrosion coating to adapt to the high humidity environment during the seedling process.

[0067] The breeding section features a sealed structure, with a climate-regulating component controlling the internal environment of the cultivation box 3. Two cultivation boxes 3 can be used to hold F2 generation seeds or seedlings from different numbered sections, or for parallel replication of the same hybrid combination. The cultivation boxes 3 are made of polypropylene, polycarbonate, ABS plastic, stainless steel, or food-grade plastic. They can hold seedling trays, seedling substrate, or absorbent pads. The bottom of the cultivation box 3 can be equipped with drainage holes, a collection trough, or a removable tray to facilitate the drainage of excess water and maintain a stable root environment.

[0068] Lighting lamp 4 can be an LED plant grow light, a full-spectrum LED strip, or a red-blue composite LED panel. The power can be selected according to the size of the breeding space, for example, 10W-40W. The color temperature of lighting lamp 4 can be 4000K-6500K, or a combination of red light with a wavelength of approximately 660nm and blue light with a wavelength of approximately 450nm can be used for plant supplemental lighting. A transparent waterproof lampshade can be installed on the outside of lighting lamp 4. The lampshade can be made of PC, PMMA, or tempered glass to improve moisture resistance and safety.

[0069] like Figures 3-6As shown, the climate control component includes a connecting pipe 5 and a control box 6. The connecting pipe 5 is connected between two incubation boxes 3, and the control box 6 is connected through the middle of the connecting pipe 5. The control box 6 has a first control channel 7, a second control channel 8, and a third control channel 9 arranged in parallel inside. When the climate control component drives the airflow between the two incubation boxes 3, the airflow directions of the second control channel 8 and the third control channel 9 are opposite, forming a low-pressure micro-circulation area at the second control channel 8 and the third control channel 9, which drives the gas in the two incubation boxes 3 to flow rapidly towards the control box 6. The first regulating channel 7 is equipped with two solenoid valves 10, and a water distribution pipe 11 is arranged between the two solenoid valves 10. The second regulating channel 8 and the third regulating channel 9 are both equipped with circulating air pumps 12. The second regulating channel 8 is equipped with a moisture absorption component, and the third regulating channel 9 is equipped with a humidification component, a ventilation component, and a heating component.

[0070] The climate control component is used to regulate the air circulation, temperature, humidity, and ventilation between and within the two incubation boxes 3. The climate control component includes a connecting pipe 5 and a regulating box 6. The connecting pipe 5 connects the two incubation boxes 3, and the regulating box 6 is connected through the middle of the connecting pipe 5. The connecting pipe 5 can be made of food-grade silicone tubing, PVC tubing, polypropylene tubing, or thin-walled stainless steel tubing. The connecting pipe 5 and the incubation boxes 3 can be connected via quick-connect fittings, threaded fittings, or sealing rings to ensure airtightness and facilitate disassembly and cleaning.

[0071] The regulating box 6 is used to install airflow regulation, humidification, dehumidification, ventilation, and heating components. The regulating box 6 can be made of ABS engineering plastic, polycarbonate, PVC, or stainless steel. The regulating box 6 can be connected to the connecting pipe 5 using flanges, clips, or threads. The three regulating channels are arranged along the length of the connecting pipe 5 and are parallel to each other to shorten the airflow path and facilitate the integration of various functional components.

[0072] like Figure 3 and Figure 6 As shown, the second adjustment channel 8 and the third adjustment channel 9 are arranged adjacent to each other. The humidification component includes a humidification box 13 and an atomizing nozzle. The opening of the atomizing nozzle faces the inside of the third adjustment channel 9. The ventilation component includes a ventilation pipe 14, which is equipped with a ventilation pump. The heating component includes a heating wire 15, which extends into the inside of the third adjustment channel 9. The moisture-absorbing component includes a moisture-absorbing box 16, and a moisture-absorbing block is detachably connected inside the moisture-absorbing box 16.

[0073] The first regulating channel 7 is mainly used for water replenishment or culture medium replenishment. The first regulating channel 7 is equipped with two solenoid valves 10, with a water distribution pipe 11 between the two solenoid valves 10. The solenoid valves 10 can be normally closed miniature solenoid valves 10, with an operating voltage of DC12V or DC24V, and the valve body material can be brass, stainless steel, or engineering plastic. The water distribution pipe 11 can be a silicone hose or PE pipe. The two solenoid valves 10 can control water inflow and outflow separately, reducing leakage and improving humidity regulation accuracy.

[0074] The circulating air pump 12 can be a miniature DC diaphragm air pump, a brushless DC fan, or a centrifugal miniature fan. The operating voltage can be DC12V or DC24V. The flow rate of a single circulating air pump 12 can be selected according to the volume of the incubation box 3, for example, 1L / min-10L / min. The circulating air pump 12 is used to drive the gas flow between the two incubation boxes 3 and the regulating box 6, so that the air in the incubation box 3 can be continuously regulated through the second regulating channel 8 and the third regulating channel 9.

[0075] During operation, the airflow directions in the second regulating channel 8 and the third regulating channel 9 are opposite, forming a low-pressure microcirculation zone in adjacent areas. This low-pressure microcirculation zone induces the gas in the two cultivation boxes 3 to flow rapidly towards the regulating box 6, allowing air from inside the cultivation box 3 to continuously enter the regulating box 6 for humidification, dehumidification, heating, or ventilation, before returning to the cultivation box 3. This airflow organization method reduces local temperature and humidity differences within the cultivation boxes 3, preventing excessive moisture, dryness, or uneven heating of seedlings, thus maintaining a more uniform environment within the two cultivation boxes 3 and improving the uniformity of F2 generation seedling growth.

[0076] The humidification box 13 can be made of PP or ABS plastic, and its interior is used to store sterile or purified water. The atomizing nozzle can be an ultrasonic atomizing plate, a microporous atomizing nozzle, or a piezoelectric ceramic atomizing plate, and the operating frequency can be selected from common atomization frequencies such as 1.7MHz or 2.4MHz. The atomized water mist enters the third regulating channel 9 and enters the incubation box 3 with the circulating airflow, thereby increasing the relative humidity inside the incubation box 3.

[0077] The ventilation pipe 14 can be made of PVC or stainless steel. An air filter, such as a sponge filter block, non-woven fabric filter, HEPA filter membrane, or activated carbon filter element, can be installed at the air inlet of the ventilation pipe 14 to reduce the entry of external dust and bacteria into the breeding space. The ventilation pump can be a miniature diaphragm pump or a miniature fan, with an operating voltage of DC12V or DC24V. The ventilation assembly is used to introduce outside air or expel air from the cultivation box 3 when the carbon dioxide concentration, humidity, or air pressure is unsuitable.

[0078] The heating wire 15 can be a nickel-chromium alloy heating wire 15, a PTC ceramic heating element, or a silicone heating element, and an insulating sleeve or protective net can be installed on the outside. The heating assembly, used in conjunction with a temperature sensor, can maintain the temperature of the breeding space within the range required for F2 generation seed germination and seedling growth, such as 22-25 degrees Celsius. To improve safety, the heating assembly can also be equipped with a temperature control protection switch or an overheat protector. The moisture-absorbing box 16 can be made of PP, ABS, or stainless steel mesh, and the moisture-absorbing block can be made of silica gel desiccant, molecular sieve, calcium chloride moisture-absorbing block, or recyclable moisture-absorbing material. The moisture-absorbing box 16 is preferably a pull-out or snap-on detachable structure to facilitate replacement or regeneration of the moisture-absorbing material after it becomes saturated. When the humidity inside the cultivation box 3 is too high, the airflow passes through the second regulating channel 8 and comes into contact with the moisture-absorbing block, thereby reducing the humidity of the circulating air.

[0079] like Figure 6 As shown, the first adjustment channel 7, the second adjustment channel 8 and the third adjustment channel 9 are arranged in parallel, and the length direction of the three channels is arranged along the length direction of the connecting pipe 5. Both sides of the microcirculation area are equipped with detection sensing modules 17, which include a temperature sensor, a humidity sensor and a pressure sensor.

[0080] Temperature sensors can be DS18B20, PT100, NTC thermistors, or equivalent; humidity sensors can be SHT30, SHT31, DHT22, or equivalent; and air pressure sensors can be BMP280, BME280, or equivalent. The detection sensor module 17 collects environmental data in real time within the breeding space or regulating box 6 and transmits the data to the control panel 20 or controller to automatically control the circulating air pump 12, solenoid valve 10, humidification assembly, moisture absorption assembly, ventilation assembly, and heating assembly based on preset thresholds. Depending on actual usage requirements, CO2 detection sensors, etc., can also be installed; specific models are selected based on actual needs and will not be elaborated here.

[0081] like Figure 1 and Figure 3 As shown, the incubation box 3 includes a main body and a cover plate 18. The cover plate 18 is L-shaped. The horizontal section of the cover plate 18 covers the top of the main body, and the vertical section of the cover plate 18 covers the upper part of the side of the main body adjacent to the lighting lamp 4. The cover plate 18 is detachably connected to the main body and is made of a light-transmitting material. The light-transmitting materials of the cover plate of the cultivation box 3 in different breeding spaces may be the same or different.

[0082] The cover portion 18 can be made of a light-transmitting material, such as a transparent polycarbonate sheet, acrylic sheet, tempered glass, or transparent PVC sheet. The L-shaped cover portion 18 reduces moisture loss within the cultivation box 3 while allowing light from the illumination lamp 4 to enter the cultivation box 3 from the side or top. The cover portions 18 of the cultivation box 3 in different breeding spaces can use the same or different light-transmitting materials. For example, in breeding spaces requiring higher light intensity, a high-transmittance polycarbonate cover can be used; in breeding spaces requiring reduced light intensity or simulating low-light conditions, a frosted acrylic cover or a transparent cover with a light-blocking coating can be used. By changing the cover portion 18 with different light-transmitting materials, seedling experiments under different light conditions can be conducted.

[0083] like Figure 3 As shown, a connecting rod 19 is arranged between the main parts of the two incubation boxes 3. The connecting rod 19 is arranged parallel to the connecting pipe 5, and several fixing plates are connected between the connecting rod 19 and the connecting pipe 5.

[0084] The connecting rod 19 can be made of stainless steel, aluminum alloy, or engineering plastic, and the fixing plate can be made of stainless steel, aluminum alloy, or ABS. The connecting rod 19 and the fixing plate are used to improve the overall stability between the two incubation boxes 3 and the climate control component, and to prevent the incubation boxes 3 from shifting during handling or airflow circulation.

[0085] like Figure 3 As shown, the adjustment box 6 is equipped with a control panel 20, which is used to execute adjustment commands on the adjustment box 6.

[0086] The control panel 20 may include a touch screen, buttons, knobs, display screen, indicator lights, or communication interface. The controller may be a microcontroller, PLC controller, or embedded control board. The control panel 20 can be used to set temperature threshold, humidity threshold, illumination time, air exchange interval, running time of circulating air pump 12, opening time of solenoid valve 10, and working status of heating components. It can also display temperature, humidity, air pressure, and equipment operating status.

[0087] The operating steps and working principle of the device are as follows: Step 1: F2 Generation Material Numbering and Loading: F2 generation seeds obtained from F1 generation self-pollination are numbered sequentially as F2-001, F2-002, etc., and each numbered seed is sown separately in a seedling tray, seedling substrate, or absorbent pad within culture box 3. By ensuring a one-to-one correspondence between seed numbers, culture box 3 location, subsequent leaf sample numbers, DNA sample numbers, and K792 / K846 genotyping results, sample confusion during large-scale F2 population screening can be avoided, establishing a traceable sample management system between the breeding device and the KASP marker breeding method.

[0088] Step 2: Zoned Placement and Culture Parameter Setting: Place the culture box 3 containing F2 generation seeds into the corresponding breeding space within the main body 1 of the breeding chamber. Different breeding spaces can correspond to different hybridization combinations, different batches, or different numbered segments of F2 generation materials. Set the germination and seedling stage culture parameters for the F2 generation seeds via the control panel 20, such as temperature 22-25 degrees Celsius, photoperiod 16h / 8h, relative humidity 60%-70%, and ventilation interval. This zoned culture method allows for the simultaneous management of multiple breeding populations within the same breeding device, reducing batch variations caused by using multiple ordinary climate chambers.

[0089] Step 3: Light Supply and Enclosed Seedling Raising: Turn on the lighting lamp 4 to provide the necessary light for seedling growth to the cultivation boxes 3 on both sides. Since the cultivation boxes 3 are positioned on both sides of the lighting lamp 4, and the cover plate 18 has an L-shaped light-transmitting structure, light can enter the cultivation boxes 3 from the top and the side closest to the lighting lamp 4. Simultaneously, the cover plate 18 reduces moisture loss and maintains a relatively stable microenvironment within the cultivation boxes 3. This improves the uniformity of F2 generation seedling emergence and leaf growth, providing more consistent leaf material for subsequent seedling DNA sampling.

[0090] Step 4: Establishing Micro-circulation Airflow: After starting the circulating air pump 12, the gas in the two incubation boxes 3 enters the regulating box 6 through the connecting pipe 5. The airflow directions in the second regulating channel 8 and the third regulating channel 9 are opposite, forming a low-pressure micro-circulation area in their adjacent region. This low-pressure micro-circulation area induces the gas in the two incubation boxes 3 to flow rapidly towards the regulating box 6. Compared with simply relying on natural diffusion within the box or unidirectional fan circulation, this device uses opposite airflow to create local low-pressure traction, causing the air in the two incubation boxes 3 to actively enter the regulating box 6 for processing, which can improve the problems of uneven local temperature and humidity and insufficient gas exchange within the incubation boxes 3.

[0091] Step 5: Temperature, Humidity, and Ventilation Interlocking Regulation: The detection sensor module 17 monitors the temperature, humidity, and air pressure data within the breeding space or regulating box 6 in real time and transmits the data to the control panel 20 or controller. When the humidity is lower than the set value, the controller activates the solenoid valve 10 and the humidification component, causing the water distribution pipe 11 to replenish water to the humidification box 13, and the atomizing nozzle carries the water mist into the third regulating channel 9. When the humidity is higher than the set value, the circulating airflow passes through the moisture-absorbing component in the second regulating channel 8, where the moisture-absorbing block reduces the humidity of the circulating air. When the temperature is lower than the set value, the heating wire 15 or the heating component heats the circulating airflow. When the air pressure, humidity, or gas state is unsuitable, the ventilation component ventilates through the ventilation pipe 14. The above interlocking regulation ensures that the F2 generation seedlings are in a stable environment for a long period, which is beneficial for improving the quality of leaf samples and the stability of KASP detection.

[0092] Step Six: Seedling Sampling and KASP Detection Integration: 12-20 days after sowing, when F2 seedlings have developed 2-3 true leaves, collect 100-200 mg of fresh leaves from each seedling according to the numbering in culture box 3. Record the corresponding sample numbers with the original seed number, breeding space number, and location in culture box 3. Genomic DNA is then extracted from the leaf samples, and genotyping is performed using the K792 and K846 KASP molecular markers. Because the breeding device maintains relatively stable temperature, humidity, light, and ventilation conditions before sampling, the leaf conditions of each seedling are relatively consistent, which helps reduce errors in DNA extraction and genotyping caused by differences in sample quality.

[0093] Step 7: Backfilling of Genotyping Results and Management of Target Seedlings: After KASP genotyping is completed, the K792 and K846 genotyping results are backfilled to the corresponding F2 generation seedling numbers. Seedlings with K792 locus C:C and K846 locus T:T are retained and cultivated as target plants for orange mature fruit color. Seedlings with non-target genotypes can be culled, transferred, or managed separately according to breeding objectives. Since seeds, seedlings, samples, and genotype results in the breeding device are all numbered, target seedlings can be directly located during the seedling stage, reducing the greenhouse or field space required for artificial fruit color identification at maturity.

[0094] Step 8: Continued Cultivation and Self-Pollution Fixation of Target Individual Plants: The selected orange-ripe target individual plants will continue to be cultivated until flowering and fruiting. Fruit color will be observed and agronomic traits recorded at maturity. Individual plants with fruit color consistent with the C:C / T:T target genotype and whose overall traits meet the breeding objectives will be self-pollinated to form F3 inbred lines. In the F3 and F4 generations, this breeding device can be used to further manage the progeny materials by zoning and numbering. The homozygous stability of the inbred lines will be confirmed again using K792 and K846 typing, thus completing the fixation of stable orange-ripe fruit color breeding materials.

[0095] Furthermore, the breeding device of this application can also be used to simulate the climate environment of different regions, which facilitates subsequent cultivation experiments in different regions, such as simulating the environment of different regions such as Xining City, Xunhua County, and Huangzhong County, and making multiple comparisons of the yield, traits, quality indicators and resistance indicators of plant strains. The specific cultivation environment required can be adjusted according to the actual planting needs.

[0096] As can be seen from the above-described steps, this breeding device is not only used for ordinary seedling cultivation, but is designed around the KASP marker breeding method for orange fruit color of Xunhua pepper: On the one hand, the partition plate 2, the cultivation box 3, and the control panel 20 realize the partitioning, numbering, and traceability management of the F2 generation population; on the other hand, the low-pressure microcirculation area formed by the second regulation channel 8 and the third regulation channel 9, as well as the linkage regulation of humidification, moisture absorption, ventilation, heating, and detection sensor module 17, improve the environmental consistency and sample quality during the seedling stage; furthermore, the sampling node of the device is directly connected to the K792 / K846 genotyping detection, so that the target genotype seedlings can be located, preserved, and fixed at an early stage.

[0097] The above-described specific embodiments are merely specific examples of the present invention. The patent protection scope of the present invention includes, but is not limited to, the product form and style of the above-described specific embodiments. Any breeding method and breeding device for orange fruit color KASP marker of Xunhua line pepper that conforms to the claims of the present invention, and any appropriate changes or modifications made thereto by those skilled in the art, shall fall within the patent protection scope of the present invention.

Claims

1. A method for breeding orange-colored chili peppers using KASP markers, characterized by: Includes the following steps: S1. Parental selection: Segregating populations were constructed using chili peppers from the Xunhuaxian variety with different mature fruit colors. The first parent was G:G at the K792 marker site and G:G at the K846 marker site, with a mature fruit color of red. The second parent was C:C at the K792 marker site and T:T at the K846 marker site, with a mature fruit color of orange. S2. Hybridization and population establishment: The first parent is hybridized with the second parent to obtain the F1 generation, and the F1 generation is self-pollinated to obtain the F2 generation. The F2 generation seeds are placed in a breeding device for germination and seedling cultivation. The breeding device is used to control the germination and seedling cultivation conditions of the F2 generation seeds. S3. Sampling and extraction: Collect leaves and extract genomic DNA during the F2 generation seedling stage; S4. Genotyping: The genomic DNA was genotyped using KASP molecular markers K792 and K846. S5. Screening and fixation: Based on the genotyping results of K792 and K846, F2 generation seedlings with K792 locus C:C and K846 locus T:T were selected as target single plants with orange mature fruit color. They were then further cultivated and self-pollinated to obtain stable orange mature fruit color Xunhuaxian pepper breeding materials.

2. The method for breeding orange-colored KASP markers in Xunhua peppers according to claim 1, characterized in that: The K792 marker is located at position 219174466 in the chili reference genome NC_061116.1; the K846 marker is located at position 219344429 in the chili reference genome NC_061116.

1. The K792 marker is used to detect G / C allelic variations, and the K846 marker is used to detect the G allele carried by the red parent and the T allele carried by the orange parent.

3. The method for breeding orange-colored KASP markers in Xunhua peppers according to claim 1, characterized in that: In step S5, the leaves of the F2 generation seedlings are collected 12-20 days after sowing, when the seedlings have 2-3 true leaves; 100-200 mg of fresh leaves are collected from each plant, and genomic DNA is extracted using a high-throughput DNA extraction kit or the CTAB method.

4. A breeding device, applied to the KASP marker breeding method for orange-colored chili peppers according to any one of claims 1-3, characterized in that: It includes a breeding box body (1) and a breeding section. The breeding box body (1) is provided with several partitions (2) inside, and a breeding space is formed between adjacent partitions (2). The breeding section is set in the breeding space. The breeding section includes two cultivation boxes (3) and a climate control component. The climate control component is connected between the two cultivation boxes (3). An installation channel is provided in the middle of the partition plate (2), and a lighting lamp (4) is provided in the installation channel. The two breeding boxes (3) of the breeding section are respectively located on both sides of the lighting lamp (4).

5. The breeding apparatus according to claim 4, characterized in that: The climate control component includes a connecting pipe (5) and a control box (6). The connecting pipe (5) is connected between two incubation boxes (3). The control box (6) is connected through the middle of the connecting pipe (5). The control box (6) has a first control channel (7), a second control channel (8), and a third control channel (9) arranged in parallel inside. When the climate control component drives the air flow between the two incubation boxes (3), the airflow direction of the second control channel (8) and the third control channel (9) is opposite. A low-pressure micro-circulation area is formed at the second control channel (8) and the third control channel (9), which drives the gas in the two incubation boxes (3) to flow rapidly towards the control box (6). The first regulating channel (7) is equipped with two solenoid valves (10), and a water distribution pipe (11) is arranged between the two solenoid valves (10). The second regulating channel (8) and the third regulating channel (9) are both equipped with circulating air pumps (12). The second regulating channel (8) is equipped with a moisture absorption component, and the third regulating channel (9) is equipped with a humidification component, an air exchange component, and a heating component.

6. The breeding apparatus according to claim 5, characterized in that: The second adjustment channel (8) and the third adjustment channel (9) are arranged adjacent to each other. The humidification component includes a humidification box (13) and an atomizing nozzle. The opening of the atomizing nozzle faces the inside of the third adjustment channel (9). The ventilation component includes a ventilation pipe (14) and a ventilation pump is provided on the ventilation pipe (14). The heating component includes a heating wire (15) and the heating wire (15) extends into the inside of the third adjustment channel (9). The moisture-absorbing component includes a moisture-absorbing box (16), and a moisture-absorbing block is detachably connected inside the moisture-absorbing box (16).

7. The breeding apparatus according to claim 5, characterized in that: The first adjustment channel (7), the second adjustment channel (8) and the third adjustment channel (9) are arranged in parallel, and the length direction of the three channels is arranged along the length direction of the connecting pipe (5). Both sides of the microcirculation area are equipped with detection sensing modules (17), and the detection sensing modules (17) include a temperature sensor, a humidity sensor and a pressure sensor.

8. The breeding apparatus according to claim 5, characterized in that: The incubation box (3) includes a main body and a cover plate (18). The cover plate (18) is L-shaped. The horizontal section of the cover plate (18) covers the top of the main body, and the vertical section of the cover plate (18) covers the upper part of the side of the main body adjacent to the lighting lamp (4). The cover plate (18) is detachably connected to the main body and is made of a light-transmitting material. The light-transmitting materials of the cover plate (18) of the cultivation box (3) in different breeding spaces are the same or different.

9. The breeding apparatus according to claim 8, characterized in that: A connecting rod (19) is provided between the main body parts of the two incubation boxes (3). The connecting rod (19) is arranged parallel to the connecting tube (5). Several fixing plates are connected between the connecting rod (19) and the connecting tube (5).

10. The breeding apparatus according to claim 8, characterized in that: The adjustment box (6) is equipped with a control panel (20), which is used to execute adjustment commands on the adjustment box (6).