Mn animal model, construction method and application thereof

CN122581224APending Publication Date: 2026-08-18BEIJING CHINESE MEDICINE HOSPITAL AFFILIATED CAPITAL MEDICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610619036.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-07
Publication Date
2026-08-18

AI Technical Summary

Technical Problem

[0006]本发明发现利用Cre-loxp系统和多西环素诱导系统实现PLA2R1在特定细胞或组织中的条件性过表达,进一步构建条件性过表达人源PLA2R1转基因小鼠动物模型,能够解决hPLA2R1转基因小鼠的疾病发生过快,病情过重的问题

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application belongs to the field of biological medicine and technology, and particularly relates to a transgenic MN mouse model, a construction method and application thereof. The application finds that conditional overexpression of PLA2R1 in specific cells or tissues is realized by using a Cre-loxp system and a doxycycline induction system, and a conditional overexpression human PLA2R1 transgenic mouse animal model is further constructed, which can solve the problems of too fast disease occurrence and too heavy illness of the hPLA2R1 transgenic mouse. By specifically expressing human PLA2R1 in podocytes, the onset process of human membranous nephropathy is more accurately simulated; by using the doxycycline induction system, the expression time and expression level of PLA2R1 can be flexibly controlled, which is convenient for studying the disease progression at different stages; the researchers can accurately control the time of disease onset, which is convenient for studying the whole process of disease initiation, development and regression, and conducting time window experiments of intervention treatment; the model improves the translational medicine value, and is crucial for testing drugs targeting human PLA2R1.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and technology, specifically relating to a transgenic MN mouse model, its construction method, and its application. Background Technology

[0002] Membranous nephropathy (MN) is a common primary glomerular disease characterized by the deposition of immune complexes under the glomerular basement membrane (GBM), leading to proteinuria and nephrotic syndrome. In recent years, the incidence of MN in middle-aged and elderly populations has been increasing annually, becoming one of the important chronic kidney diseases affecting the health of the elderly. Studies have found that the pathogenesis of MN is closely related to autoimmune responses. In human MN patients, approximately 60% have autoantibodies against phospholipase A2 receptor 1 (PLA2R1), while approximately 1-3% are associated with thrombospondin Type 1 domain-containing 7A (THSD7A). These findings provide new targets for the construction of experimental models of MN.

[0003] Currently, various animal models of nephritis (MN) have been established, including the Heymann nephritis rat model and the c-BSA mouse model, which have laid the foundation for research on the pathological mechanisms of MN. However, due to the differences in antigen specificity between experimental animals and humans, these models have certain limitations in simulating the pathological processes of human MN. To better simulate human MN, researchers have constructed MN animal models that specifically express PLA2R1 and THSD7A using transgenic technology. These models are closer to human MN in terms of pathological characteristics and immune responses, providing a new platform for studying the pathogenesis of MN and developing new therapies.

[0004] Previous studies using mouse PLA2R1 expression in podocytes to create animal models have yielded poor results. In 2020, it was first reported that mPLA2R1 transgenic mice, after injection of rabbit anti-mPLA2R1 antibodies, exhibited dose-dependent nephrotic-range proteinuria and hypercholesterolemia, effectively mimicking the clinical and pathological characteristics of MN and providing a valuable model for MN research. However, the duration of the disease in this model is too short; after a 7-day observation period, the proteinuria in the mice began to spontaneously remit, thus limiting its application value in long-term disease research (drug intervention generally requires 8-12 weeks). Furthermore, injecting anti-PLA2R1 autoantibodies from patients into these mice failed to induce disease, which may be related to the 28% sequence difference between mPLA2R1 and hPLA2R1, limiting the model's ability to study the pathogenicity of human PLA2R1 antibodies (Kidney Int. 97 (5), 913-919.). The hPLA2R1 transgenic mouse avoids the above shortcomings. The hPLA2R1 transgenic mouse, first reported in 2023, can spontaneously produce anti-human PLA2R1 antibodies from 3 weeks of age without external antigen stimulation, which is closer to the natural occurrence of human MN autoimmune disease. In addition, hPLA2R1 transgenic mice can develop proteinuria at 4 weeks of age, accompanied by decreased serum albumin and increased blood lipids. The renal pathological characteristics are highly similar to those of human MN patients, providing a more accurate model for studying the pathophysiological mechanism of the disease. However, hPLA2R1 transgenic mice also have serious shortcomings. The disease in mice is spontaneous and progresses rapidly, with serious complications. Mice develop ascites at 5-6 weeks of age and die from severe nephrotic syndrome at 8 weeks of age, which makes it difficult to control the experimental results and treatment plan (Kidney Int. 103 (2), 297-303. https: / / doi.org / 10.1016 / j.kint.2022.09.008).

[0005] Most existing animal models of neonatal muscular atrophy (MN) are based on immune-mediated damage, while insufficiently considering other factors such as cellular senescence and inflammatory responses in the disease's development. Furthermore, MN is prevalent in middle-aged and elderly individuals, but there is currently a lack of animal models that can simulate the pathogenesis of MN in an aging context. Therefore, developing new animal models of MN, especially those capable of simulating the combined effects of aging and multiple pathological factors, is of great significance for a deeper understanding of the pathological mechanisms of MN and for exploring new treatment strategies. Summary of the Invention

[0006] This invention discovers that conditional overexpression of PLA2R1 in specific cells or tissues can be achieved using the Cre-loxp system and doxycycline induction system. Furthermore, a conditional overexpression of human PLA2R1 transgenic mouse model can be constructed, which can solve the problems of rapid disease onset and severe illness in hPLA2R1 transgenic mice. Based on this, this invention was completed.

[0007] In a first aspect, the present invention provides an MN animal model in which a transgenic fragment is inserted at the ROSA26 site, the transgenic fragment comprising LoxP-STOP codon-LoxP-Tet on-hPLA2R1, and hPLA2R1 expression is induced using doxycycline.

[0008] Furthermore, the animal is a mouse and / or a rat.

[0009] In a second aspect, the present invention provides a method for preparing the MN animal model as described in the first aspect, the method comprising the following steps: M1. Construct a transgenic vector containing the LoxP-STOP codon-LoxP-Tet on-hPLA2R1 transgenic fragment; M2. To prepare transgenic animals, the transgenic vector, gRNA and CAS9 constructed in M1 were introduced into the fertilized eggs of animals. The surviving fertilized eggs were transplanted into the oviducts of surrogate animals to continue development and obtain hPLA2R1 transgenic animals. M3. After obtaining hPLA2R1 transgenic animals, they were bred with NPHS2-Cre (podocyte-specific) animals to obtain Cre-positive hPLA2R1 transgenic animals; M4. MN animal model was obtained by inducing hPLA2R1 expression using doxycycline.

[0010] Furthermore, the animal is a mouse and / or a rat.

[0011] Furthermore, in step M2, the transgenic animal is a transgenic animal containing the ROSA26 site.

[0012] Furthermore, in step M4, the doxycycline induction time is 3-5 weeks; preferably 4 weeks.

[0013] Furthermore, in step M4, the dose of doxycycline induced is selected from 1-2 mg / L.

[0014] Thirdly, the present invention provides the application of the MN animal model as described in the first aspect in drug screening, wherein the application is for screening drugs for treating kidney diseases.

[0015] Furthermore, the kidney disease is membranous nephropathy.

[0016] Furthermore, the animal is a mouse and / or a rat.

[0017] Beneficial effects This invention provides a conditional overexpression model of human PLA2R1 transgenic mice, achieving dual conditional control of human PLA2R1 gene expression through a combination of the Cre-loxP system and the doxycycline induction system. The Tet-On-based controllable expression system of human PLA2R1 successfully addresses the problems of rapid disease onset and excessive disease severity in hPLA2R1 transgenic mice. This model can accurately simulate the pathogenesis of human membranous nephropathy, providing a powerful tool for studying the pathogenesis of membranous nephropathy and developing new treatment strategies.

[0018] By combining the Cre-loxP system and the doxycycline induction system, dual conditional control of human PLA2R1 gene expression was achieved, including tissue-specific and time-specific control. By specifically expressing human PLA2R1 on podocytes, the pathogenesis of human membranous nephropathy was simulated more accurately. The doxycycline induction system allows for flexible control of PLA2R1 expression time and level, facilitating the study of disease progression at different stages. This model can serve as a drug screening platform for developing novel treatment strategies for PLA2R1-associated membranous nephropathy.

[0019] The conditional nature of the expression of PLA2R1 avoids the complex phenotypes that may result from systemic expression, ensuring that the disease model occurs only in the target organ, the kidney. Inducibility allows researchers to precisely control the timing of disease onset, facilitating the study of the entire process of disease initiation, development, and resolution, as well as conducting time-window experiments for interventional treatments; Humanization, using human pathogenic genes, allows the model to more realistically simulate the immunological and pathological characteristics of human membranous nephropathy, improving the model's translational medical value and making it crucial for testing drugs targeting human PLA2R1.

[0020] The MN animal model of this invention can achieve the coexistence of Cre gene positive and knock-in homozygous mice. Without switching the mouse on and off, the mice will not develop the disease, achieving a stable genetic model. After obtaining homozygous mice, there is no need to wait for breeding time, and the model mice are knock-in homozygous. Attached Figure Description

[0021] Figure 1 To construct plasmids for transgenic vectors.

[0022] Note: The transgenic fragments include LoxP-STOP codon-LoxP-Tet on-hPLA2R1.

[0023] Figure 2 The results are for screening positive offspring mice of the F0 generation.

[0024] Figure 3 The results are for the identification of F1 generation pups.

[0025] Figure 4 The ratio of urinary microalbumin to creatinine (UACR mg / g) was used for each group of mice.

[0026] Figure 5 The results are shown in the immunofluorescence staining of Dox-induced dual-gene mouse glomeruli.

[0027] Note: Red indicates hPLA2R1; green indicates podocyte marker protein Synaptopodin.

[0028] Figure 6 The results are immunofluorescence results for mouse glomeruli.

[0029] Note: Mouse IgG is red fluorescent, podocyte marker protein SYNAP is green, and nuclear DAPI is blue.

[0030] Figure 7 The ratio of urinary albumin to creatinine and the status of blood protein in each group of mice were recorded. Figure 8 A schematic diagram showing the structure of the transgenic fragment LoxP-STOP codon-LoxP-Tet on-hPLA2R1. Detailed Implementation

[0031] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.

[0032] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0033] Example 1: Construction of transgenic humanized mice Test methods A conditional knock-in of the human PLA2R1 gene was created at the ROSA26 site in mice using CRISPR / Cas-mediated genome engineering.

[0034] The mouse ROSA26 gene (NCBI reference sequence: NR_027008.1) is located on mouse chromosome 6. The human PLA2R1 gene (NCBI reference sequence: NM_007366.5) is located on human chromosome 2.

[0035] Target sites and sgRNA design sgRNA was designed targeting the mouse Gt(ROSA)26Sor site. The target sequence of the sgRNA used was: CTCCAGTCTTTCTAGAAGAT, and its PAM sequence was: GGG.

[0036] Off-target analysis results showed that the sgRNA perfectly matched the target site located in the Gt(ROSA)26Sor region of mouse chr6.

[0037] Transgenic vector design A transgenic vector containing the LoxP-STOP codon-LoxP-Tet on-hPLA2R1 sequence was constructed. The transgenic vector comprises the following elements: CAG promoter, loxP, PGK-Neo, 6×SV40 pA, loxP, Kozak-Tet-On, BGHpA, TRE3G promoter, Kozak-human PLA2R1 CDS, and rBG pA.

[0038] The overall structure of the transgenic vector is as follows: 5' homologous arm-CAG promoter-loxP-PGK-Neo-6×SV40pA-loxP-Kozak-Tet-On-BGH pA-TRE3G promoter-Kozak-human PLA2R1 CDS-rBG pA-3' homologous arm. The 5' and 3' homologous arms are derived from the genomic sequences flanking the ROSA26 target site and can be obtained by PCR amplification using a BAC clone as a template. Figure 1 As shown.

[0039] The lengths of the 5' and 3' homologous arms can be set according to the site-specific integration efficiency, as long as they can support homologous recombination of the target fragment at the ROSA26 site.

[0040] The vector expressing sgRNA was constructed using the In-Fusion method and validated by enzyme digestion, PCR, and sequencing.

[0041] First, using a template containing the target sequence, fragments of each functional element of the transgenic vector, including the 5' homologous arm, 3' homologous arm, and intermediate transgenic vector, are amplified. Primers with 15-20 bp overlapping homologous sequences are designed according to the ligation sequence of each fragment, and linearized fragments with overlapping ends are obtained by PCR. Subsequently, the linearized vector backbone and each target fragment are mixed at a predetermined molar ratio and added to an In-Fusion reaction system. After incubation at 50°C for 15-30 min, the mixture is transformed into competent *E. coli*. Single clones are picked for initial screening by colony PCR. Positive clones undergo plasmid extraction in small quantities, followed by restriction endonuclease digestion, PCR, and Sanger sequencing to verify the vector and confirm that the ligation direction of each functional element is correct and the sequence is error-free. To reduce base errors during amplification, in one embodiment, a high-fidelity DNA polymerase is preferably used for fragment amplification.

[0042] Embryo manipulation sgRNA is prepared by in vitro transcription or chemical synthesis, and Cas9 is preferably prepared in the form of recombinant Cas9 protein.

[0043] sgRNA and Cas9 protein were pre-incubated on ice to form a ribonucleoprotein complex (RNP), which was then used in conjunction with the transgenic vector for microinjection. BALB / c mouse zygotes were selected as gene editing recipients. sgRNA, Cas9 protein, and the transgenic vector were mixed at predetermined concentrations and microinjected into pronuclear or cytoplasmic cells under a micromanipulation system. After injection, morphologically normal zygotes were briefly cultured in embryo culture medium. Viable embryos were then selected and transferred to the oviducts of pseudopregnant surrogate mothers for further development. F0 generation pups were obtained after the surrogate mothers gave birth.

[0044] Screening and genetic verification of positive pups After birth, approximately 2-3 mm of tail tip tissue was harvested from F0 generation mice, placed in lysis buffer, and proteinase K was added. Lysis was performed at 55°C for 2-6 hours or overnight. After lysis, DNA was purified using an animal tissue genomic DNA extraction kit, and finally eluted with elution buffer to obtain genomic DNA. The extracted DNA was used as a template for subsequent PCR amplification and sequencing analysis.

[0045] PCR reactions can be performed using a 20 μL or 25 μL system, including genomic DNA template, upstream and downstream primers, 2×PCR Mix or high-fidelity amplification system, and nuclease-free water. The PCR reaction program can be set as follows: 95℃ pre-denaturation for 3-5 min; followed by 30-35 cycles: 95℃ denaturation for 15-30 s, 55-65℃ annealing for 15-30 s, 72℃ extension for 20-60 s; and finally, a final extension at 72℃ for 5 min. Amplification products are analyzed by 1.5%-2.0% agarose gel electrophoresis. Positive bands are purified from the gel and sent for Sanger sequencing; the sequencing results are compared with the theoretical target integration sequence to confirm the correctness of the linker region sequence.

[0046] F0 individuals identified as positive by PCR and sequencing were bred with wild-type mice to obtain the F1 generation. The F1 generation was then verified by PCR to confirm the stable inheritance of targeted integration.

[0047] Test results Genomic DNA of F0 generation mice born to surrogate mothers was amplified by PCR for screening positive offspring. Primers ROSA26_PLA2R1-BJ-F / R, ROSA26_PLA2R1-LOXP-F / R, and ROSA26_PLA2R1-WT-F / R were used to specifically amplify the genomic DNA of F0 generation mice.

[0048] Among them, the ROSA26_PLA2R1-BJ-F / R primer pair is used to detect the connection region sequence between the genomic target site and the inserted expression cassette; the ROSA26_PLA2R1-LOXP-F / R primer pair is used to detect specific fragments containing loxP-related regions in the inserted expression cassette; and the ROSA26_PLA2R1-WT-F / R primer pair is used to detect the region corresponding to the wild-type ROSA26 site, thereby distinguishing between wild-type and knock-in alleles.

[0049] PCR results as follows Figure 2 As shown, A79 and A80 offspring are heterozygous ROSA26_hPLA2R1[CKI / + The remaining pups were wild-type (A76, A77, A78, and A81). Therefore, subsequent experiments used A79 and A80 pups. Primer information is shown in Table 1.

[0050] Table 1 Primer information used for PCR validation of positive mouse pups Example 2: Preparation of conditionally hPLA2R1 transgenic mice Test methods Acquisition of NPHS2-Cre mice NPHS2-Cre mice are transgenic mice that specifically express Cre recombinase in podocytes. They were purchased from Shanghai Southern Model Biotechnology Co., Ltd., and the strain name is Nphs2-2A-Cre(BALB / C)).

[0051] Crossing NPHS2-Cre mice with transgenic mice The A79 and A80 mice (two female heterozygous mice) from Example 1 were crossed with one male mouse that was homozygous for NPHS2-Cre to obtain double transgenic mice (hPLA2R1 and NPHS2-Cre double heterozygotes).

[0052] Identification of double transgenic mice Double transgenic mice were identified using PCR. Since all mice in this generation were NPHS2 heterozygous, this example only targeted the hPLA2R1 gene for PCR identification. Specific primers were designed to detect the presence of the transgenic fragment and the Cre gene, respectively (Table 2).

[0053] Table 2 NPHS2 Identification Primer Information Test results like Figure 3 As shown, among the F1 generation pups, B33, B34, B37, B43, and B45 were hPLA2R1 heterozygotes, while the rest were wild-type. Ultimately, double-transgenic positive hPLA2R1 CKI / was obtained. + NPHS2-Cre + Mice (hPLA2R1; Cre) + Dox + ).

[0054] Example 3: Establishment and pathological characterization of the MN mouse model Doxycycline administration led to increased urinary protein in mice. The double-transgenic hPLA2R1 CKI / obtained in Example 2 was used. + NPHS2-Cre + Mice were used as experimental subjects. Starting at 4 weeks of age, double-transgenic hPLA2R1 CKI / + NPHS2-Cre +Mice were randomly divided into an experimental group and a control group, with five mice in each group. The experimental group received drinking water containing 1.0 mg / mL doxycycline, while the control group received ordinary drinking water, for a period of 4 weeks. The doxycycline-containing drinking water was prepared fresh each time, stored away from light, and changed regularly to ensure drug stability and relatively consistent intake. During the administration period, 4-hour urine samples were collected from each group of mice weekly. After centrifugation, the urine supernatant was collected, and the urine microalbumin level was detected using a urine microalbumin ELISA kit or an immunoturbidimetric assay kit. The urine creatinine level was detected using a creatinine assay kit, and the urine albumin / creatinine ratio (UACR, mg / g) was calculated.

[0055] Simultaneously, hPLA2R1 CKI was administered without doxycycline. + NPHS2-Cre + Mice and Cre-negative hPLA2R1 CKI / + NPHS2-Cre - Mice were used as controls, with 5 mice in each group, to compare differences in proteinuria under different genotypes and induction conditions.

[0056] The results are as follows Figure 4 As shown, compared with hPLA2R1 CKI without doxycycline / + NPHS2-Cre + Mice and Cre-negative hPLA2R1 CKI / + NPHS2-Cre - Compared to mice, hPLA2R1 CKI / after doxycycline induction + NPHS2-Cre + The urinary albumin / creatinine ratio in mice was significantly increased (P < 0.01), indicating that doxycycline successfully induced hPLA2R1 expression in podocytes and led to the appearance of a proteinuria phenotype.

[0057] The above results indicate that after Dox induction, hPLA2R1 CKI / + NPHS2-Cre + Proteinuria was successfully induced in the mice. The conditional mice constructed in this invention can develop an early renal injury phenotype associated with membranous nephropathy under Dox induction.

[0058] The formation process of conditional podocyte hPLA2R1 expression mouse model at different time points Conditional podocyte hPLA2R1-expressing mice (TRE3G-hPLA2R1) constructed using the Tet-On system were administered Dox at weeks 3, 4, and 5 via drinking water containing 1.0 mg / mL doxycycline to observe the formation of the MN model. The doxycycline-containing drinking water was freshly prepared, stored protected from light, and replaced regularly to ensure drug stability and relatively consistent intake.

[0059] Table 3 summarizes the model formation process of conditional podocyte hPLA2R1 expression mice constructed based on the Tet-On system at different time points. The results showed that after Dox induction began at P21, hPLA2R1 mRNA and protein expression could be gradually detected after P28, and abnormalities subsequently appeared in indicators such as urine protein / creatinine ratio, serum albumin, blood lipids, and BUN; after P35, glomerular IgG deposition could be further observed; and at P56, typical ultrastructural changes of membranous nephropathy, such as foot process fusion and electron-dense deposition under the basement membrane, were visible under an electron microscope.

[0060] The results suggest that the model has clear time-dependent evolutionary characteristics and can stably simulate the occurrence and development of membranous nephropathy.

[0061] Table 3 Formation of the MN model Sample collection confirmed hPLA2R1 expression in podocytes. Immunofluorescence was used to detect PLA2R1 protein expression in glomeruli. OCT-embedded frozen sections of kidney tissue (5 μm) were subjected to double immunofluorescence staining to detect the expression and co-localization of PLA2R1 and podocyte marker protein (SYNAP) in the glomeruli. After fixation and blocking, the sections were incubated with anti-PLA2R1 and anti-SYNAP primary antibodies, respectively, followed by the addition of corresponding fluorescently labeled secondary antibodies. Cell nuclei were counterstained with DAPI, and images were finally acquired under a confocal microscope.

[0062] like Figure 5 As shown, hPLA2R1 is specifically expressed in mouse podocytes.

[0063] The presence of IgG particle deposition in the glomeruli of mice meets the pathological criteria for membranous nephropathy. Immunofluorescence detection of mouse IgG in mouse kidney tissue was performed, along with co-localization with SYNAP: Mouse kidney tissue was embedded in OCT and cut into 5 μm frozen sections, air-dried at room temperature, and washed with PBS. Sections were fixed with 4% paraformaldehyde for 10 min, then permeabilized with 0.5% Triton X-100 for 10 min, and blocked with 5% BSA at room temperature for 30 min. Rabbit anti-Synaptopodin primary antibody was then added, and the sections were incubated overnight at 4 °C. Simultaneously, fluorescently labeled goat anti-mouse IgG was used to detect mouse IgG deposition in the glomeruli. The following day, after washing with PBS, the sections were incubated with the corresponding fluorescently labeled secondary antibody for 1 h, counterstained with DAPI nuclei, mounted with anti-fluorescence quenching, and finally, images were acquired using confocal microscopy to analyze the co-localization of mouse IgG and SYNAP.

[0064] like Figure 6 As shown, the glomeruli of the model group showed significant granular IgG deposition, which was correlated with the localization of podocyte marker proteins. This indicates that IgG in the model group mice was deposited along the glomerular basement membrane, while no IgG deposition was observed in the glomeruli of the control group. The IgG fluorescence characteristics of the model group mice were consistent with the classic diagnostic features of membranous nephropathy, indicating successful modeling.

[0065] Example 4: Application of the MN mouse model in drug screening and evaluation Test methods Membranous nephropathy, as an autoimmune disease, is primarily treated with immunosuppressants. In this example, cyclosporine, a commonly used clinical drug, was used to observe its therapeutic effect on the model. 18 hPLA2R1 CKI / + NPHS2-Cre + Mice were divided into three groups: a control group, a model group, and a cyclosporine group. Cyclosporine was dissolved in water after being converted to the commonly used clinical dosage for mice and administered by gavage once daily. The model group was administered an equal volume of drinking water by gavage. Intervention continued until 8 weeks of age, at which point blood biochemical parameters were measured. During the intervention period, 4-hour urine samples were collected weekly to measure the urinary microalbumin-to-creatinine ratio.

[0066] Test results Using a fully automated biochemical reaction instrument, indicators such as urinary protein and serum albumin in mice were detected to assess disease manifestations. Results are as follows: Figure 7 As shown, the urinary protein level in the cyclosporine group was significantly lower than that in the model group (P < 0.05), while the serum albumin level was significantly higher than that in the model group (P < 0.05). This indicates that cyclosporine has a therapeutic effect on a mouse model of membranous nephropathy based on hPLA2R1 as its autoantigen, which provides a basis for the evaluation and application of other drugs.

[0067] Example 5: Comparison of Transgenic Vector Design In patent CN119080934 A, the inserted CAG-LSL-PLA2R1-polyA fragment comprises four parts: a CAG promoter, an LSL (LoxP-stop-LoxP) sequence, a PLA2R1 coding region, and a polyA signaling sequence. The CAG promoter drives efficient and stable transcriptional expression of the gene in the cell. The LSL, or LoxP-stop-LoxP sequence, is an element used for conditional gene expression, enabling precise spatiotemporal control of PLA2R1 gene expression. For example, it can activate PLA2R1 gene expression only in specific tissues (such as podocytes) by introducing Cre recombinase. The PLA2R1 coding region is the gene sequence encoding phospholipase A2 receptor 1 (originally described as the transcript of the mouse PLA2R1 gene (ENSMUST00000112525.4, 4464nt in length, encoding 1487aa). The polyA signal sequence is located at the 3' end of the gene expression vector, which helps to improve the stability of the mRNA.

[0068] like Figure 8 As shown, the fragment inserted into mouse ROSA26 in this invention is CAG-LSL-Kozak-Tet-On-hPLA2R1-TRE3G promoter. This inserted fragment differs from patent CN119080934 A in that the inserted sequence encodes human PLA2R1 (NCBI Reference Sequence: NM_007366.5), instead of the mouse PLA2R1 sequence, and is incorporated into a Tet-On-based controllable expression system. These adjustments significantly alter the effectiveness of this transgenic mouse model of membranous nephropathy.

[0069] The Kozak sequence, located upstream and downstream of the start codon in eukaryotic mRNA, is a key element mediating ribosome assembly and translation initiation efficiency. Tet-On is an improved version of the third-generation Tet-On transactivator (Cre). By binding to doxycycline (Dox), it specifically binds to the TRE3G promoter, achieving extremely low background and highly sensitive gene expression induction. The TRE3G promoter consists of seven 19 bp tet operon sequences and a minimal CMV promoter, which can almost completely silence without induction and achieve up to 1000-fold or more expression enhancement upon induction.

[0070] Previous literature reported that untreated models would develop severe illness and die before reaching sexual maturity. Therefore, Cre mice and knock-in mice need to be crossed before each modeling process, requiring a generation of breeding time, and the offspring are all knock-in heterozygotes.

[0071] Adding the switch allows for the coexistence of Cre gene-positive and knock-in homozygous mice, as they will not develop the disease if the switch is not turned on, thus achieving a stable genetic model. Once homozygous mice are obtained, there is no need to wait for breeding, and the model mice are knock-in homozygous.

[0072] Example 6 Selection of transgenic mice hPLA2R1 transgenic mice spontaneously produce anti-hPLA2R1 antibodies without external antigen stimulation, more closely mimicking the natural course of human MN autoimmune diseases and aiding in the study of the initiation and maintenance mechanisms of autoimmune responses. mPLA2R1 transgenic mice require injection of external anti-mPLA2R1 antibodies to trigger an immune response and lead to disease, and cannot spontaneously produce an autoimmune response similar to that of human MN (Exp. Gerontol. 185 (2024), 112341. https: / / doi.org / 10.1016 / j.exger.2023.112341). Furthermore, differences exist in the intensity, specificity, and complement activation of the immune response, as detailed in Table 4. Table 4. Differences between mPLA2R1 transgenic mouse and hPLA2R1 transgenic mouse animal models Therefore, the hPLA2R1 transgenic mouse is more similar to the human body in terms of immune mechanism, and can better simulate the autoimmune response process and pathological mechanism of human MN, which has a greater advantage for studying the immunopathogenesis and treatment of MN.

Claims

1. An MN animal model in which a transgenic fragment is inserted at the ROSA26 site, the transgenic fragment comprising LoxP-STOP codon-LoxP-Tet on-hPLA2R1, and hPLA2R1 expression is induced using doxycycline.

2. The animal model as described in claim 1, wherein the animal is a mouse and / or a rat.

3. The method for preparing the MN animal model as described in claim 1, wherein the method comprises the following steps: M1. Construct a transgenic vector containing the LoxP-STOP codon-LoxP-Tet on-hPLA2R1 transgenic fragment; M2. To prepare transgenic animals, the transgenic vector, gRNA and CAS9 constructed in M1 were introduced into the fertilized eggs of animals. The surviving fertilized eggs were transplanted into the oviducts of surrogate animals to continue development and obtain hPLA2R1 transgenic animals. M3. After obtaining hPLA2R1 transgenic animals, they were bred with NPHS2-Cre (podocyte-specific) animals to obtain Cre-positive hPLA2R1 transgenic animals; M4. MN animal model was obtained by inducing hPLA2R1 expression using doxycycline.

4. The method of claim 3, wherein in step M2, the transgenic animal is a transgenic animal containing the ROSA26 site.

5. The method of claim 3, wherein in step M4, the doxycycline induction time is 3-5 weeks.

6. The method of claim 3, wherein in step M4, the dose of doxycycline induced is selected from 1-2 mg / L.

7. The method of claim 3, wherein the animal is a mouse and / or a rat.

8. The application of the MN animal model as described in claim 1 in drug screening, wherein the application is for screening drugs for treating kidney diseases.

9. The application as described in claim 8, wherein the kidney disease is membranous nephropathy.

10. The application as described in claim 8, wherein the animal is a mouse and / or a rat.

Citation Information

Patent Citations

  • Anti-phospholipase A2 receptor polyclonal antibody as well as preparation method and application thereof

    CN119080934A