A silage additive, silage and application thereof

Abstract

The application provides a silage additive, a silage and application thereof, and relates to the field of forage processing and biological safety technology.The silage additive comprises Litsea cubeba stem and leaf powder, dihydromyricetin, corn flour and bran.The silage additive is mixed with silage raw materials and then fermented, so that the nutritional components in the silage are effectively improved, the fermentation quality of the silage is improved, the microbial community in the silage is regulated, and the level of quinolone and glycopeptide antibiotic resistance genes in the silage is effectively reduced.The application also provides application of the silage in animal feeding, which can effectively improve the growth performance and antioxidant capacity of animals, effectively reduce the abundance of tetracycline, beta-lactam and MLS antibiotic resistance genes in the intestinal tract of animals, and achieve the integrated effect of silage quality improvement and biological safety prevention and control.

Description

Technical Field

[0001] This invention relates to the fields of forage processing and biosafety technology, specifically to a silage additive, silage, and its application. Background Technology

[0002] Forage grasses are an important feed source for herbivores in southern regions, boasting advantages such as high yield, soft and juicy leaves, and good palatability. However, the simultaneous occurrence of rain and heat in southern regions during summer leads to high moisture content in forage grasses at harvest. Direct ensiling of forage grasses easily results in nutrient loss and poor fermentation quality, severely hindering their efficient utilization. Furthermore, the complex microbial activity during high-moisture ensiling can lead to excessive proliferation of harmful fungi and molds, causing fermentation failure and nutrient loss. The resulting mycotoxins directly threaten livestock product safety and human and animal health, posing potential public health hazards through the food chain.

[0003] Currently, most methods for regulating feed moisture rely on physical methods, such as natural wilting to control forage moisture. However, fluctuations in rainfall and high-temperature evaporation during dry and wet seasons directly weaken this stability, making precise moisture control impossible. High moisture content in forage leads to significant loss of leachate during silage, carrying soluble nutrients and resulting in nutrient loss. Under high moisture conditions, insufficient compaction density and higher residual oxygen levels allow aerobic putrefactive bacteria and molds to proliferate rapidly in the early stages of silage. This not only consumes fermentable sugars but also produces mycotoxins that directly threaten livestock product safety and human and animal health, posing a potential public health hazard through the food chain. Simultaneously, opportunistic pathogens carrying resistance genes proliferate along with aerobic putrefactive bacteria and molds, causing a sharp increase in the abundance of corresponding antibiotic resistance genes, thus adversely affecting animal drug resistance. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a silage additive by compounding Amomum villosum stem and leaf powder and dihydromyricetin. The Amomum villosum stem and leaf powder plays a dual role in physically adsorbing free water and slowly releasing natural antibacterial components, while dihydromyricetin synergistically enhances antioxidant and antibacterial effects. The combination of the two can effectively improve the quality of silage and inhibit the growth of drug-resistant bacteria and harmful bacteria carrying mobile genetic elements in silage after fermentation.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a silage additive containing functional components; by weight, the functional components include 20-30 parts of Amomum villosum stem and leaf powder and 0.0050-0.01 parts of dihydromyricetin.

[0006] Preferably, the silage additive further includes auxiliary materials; by weight, the auxiliary materials contain 5-10 parts of carbon source and 3-7 parts of nitrogen source.

[0007] This invention provides an application of the silage additive in at least one of the following: Improve the quality of feed silage; Inhibit the growth of drug-resistant bacteria or harmful bacteria carrying mobile genetic elements in silage; Block the horizontal spread of drug resistance genes; And reduce gene exchange activity at the microbial community level.

[0008] Preferably, the improvement of silage quality includes at least one of the following: improving the nutritional composition of silage, improving the fermentation quality of silage, and regulating the balance of the silage microbial community.

[0009] Preferably, the drug-resistant bacteria include bacteria resistant to quinolone and / or glycopeptide antibiotics.

[0010] Preferably, the mobile genetic element includes a transposon, a transposase, and a plasmid.

[0011] This invention provides a silage feed, which is obtained by fermenting silage feed using the silage feed additive; the fresh weight of the silage raw material is 60-70 parts; the weight is the same as the weight of the silage feed additive.

[0012] Preferably, the silage raw material includes at least one of king grass, elephant grass, and American foxtail grass.

[0013] This invention provides an application of the silage in animal husbandry, wherein the animal husbandry includes improving animal growth performance and / or reducing the spread of drug resistance genes in animals.

[0014] Preferably, the drug resistance gene includes a drug resistance gene for at least one antibiotic selected from tetracyclines, β-lactams, macrolides, lincosamides, and streptozotocins.

[0015] This invention provides a silage additive with Amomum villosum stem and leaf powder and dihydromyricetin as its main functional components. The Amomum villosum stem and leaf powder possesses the dual functions of physically adsorbing free water and slowly releasing natural antibacterial components, effectively inhibiting the metabolic activity of putrefactive bacteria and significantly improving the nutritional value and fermentation quality of silage. Simultaneously, dihydromyricetin effectively blocks oxidative damage, increases the permeability of the outer membrane of Gram-negative putrefactive bacteria, further enhances the antibacterial efficacy of the essential oil in Amomum villosum stems and leaves, and blocks the horizontal transfer of antibiotic resistance genes at the molecular level by inhibiting transposase and integrase activity, thus reducing the risk of antibiotic resistance gene transmission at the source. Therefore, the silage fermentation system described herein can significantly improve silage quality while reducing the emergence of drug-resistant bacteria and harmful bacteria carrying mobile genetic elements, and blocking the spread of drug resistance genes among different microorganisms. Based on the results of the embodiments of this application, the dry matter and crude protein content of the silage fermented using the silage additive in the experimental group were significantly increased to 30.01% and 10.56%, respectively; the pH value decreased to 3.92; the lactic acid content increased to 5.31%; and the ammonia nitrogen and butyric acid content decreased to 0.28% and 0.47%, respectively. All these indicators were significantly better than those of the control group (100% silage raw material alone). This demonstrates that the silage additive effectively solved the problem of severe nutrient damage during silage and improved the quality of the silage. Simultaneously, compared to the control group, putrefactive bacteria in the silage of the experimental group were effectively inhibited, and beneficial lactic acid bacteria such as *Lactobacillus* and *Lactococcus* formed a dominant community, optimizing the fermentation quality. The abundance of resistance genes such as quinolones and glycopeptides, as well as mobile genetic elements such as transposons, transposases, and plasmids, were significantly reduced, lowering the risk of drug resistance gene transmission and the possibility of drug-resistant bacteria development from the source. The silage fermentation system effectively solves the problems of silage leachate, mold, nutrient loss and pathogen transmission, while realizing the resource utilization of cardamom waste, providing a safe, stable and environmentally friendly method for herbivorous animal husbandry in tropical and humid regions. Attached Figure Description

[0016] Figure 1 The results of the microbial composition analysis of silage king grass in different treatment groups are shown. A represents the differential species discrimination results of LEfSe analysis in different treatment groups, and B is a bar chart of the relative abundance of microbial communities in different treatment groups. Figure 2 The results of antibiotic resistance gene composition analysis of silage king grass in different treatment groups show that different letters in the same class of antibiotic resistance genes represent significant differences. P <0.05); Figure 3 The results of the analysis of the mobile genetic elements composition of silage king grass in different treatment groups show that different letters in the same class of mobile elements represent significant differences. P <0.05); Figure 4 The results of antibiotic resistance gene composition analysis in goat feces from different treatment groups are shown. express P <0.05, express P <0.01; Figure 5 The results of the compositional analysis of mobile genetic elements in goat feces from different treatment groups are shown. express P <0.05, express P <0.01. Detailed Implementation

[0017] This invention provides a silage additive containing functional components; by weight, the functional components include 20-30 parts of Amomum villosum stem and leaf powder and 0.0050-0.01 parts of dihydromyricetin.

[0018] In this invention, the amount of Amomum villosum stem and leaf powder added can be 22 parts, 24 parts, 26 parts, or 28 parts. The Amomum villosum stem and leaf powder can be obtained through self-production or commercial purchase. Preferably, the Amomum villosum stem and leaf powder is obtained by drying and pulverizing the waste stems and leaves after harvesting the Amomum villosum fruit. The Amomum villosum stems and leaves are preferably harvested within 48-72 hours after fruit harvest, which can be 50 hours, 54 hours, 58 hours, or 68 hours. If the harvesting time is too early, the accumulation of effective components in the stems and leaves will be insufficient; if it is too late, the lignification of the stems and leaves will intensify, and the fiber content will increase, affecting subsequent pulverization. After harvesting, the Amomum villosum stems and leaves are preferably cut. The cutting process can increase the contact area between the material and the hot air, shorten the drying time, and improve the drying uniformity. The cutting is preferably done by cutting the Amomum villosum stems and leaves into 3-5 cm segments. In a specific embodiment of this application, a double-roll mill is used to cut the Amomum villosum stems and leaves. The double-roll mill, while cutting the material, can physically break down the fiber structure of the cardamom stems and leaves, which is beneficial for the rapid migration of internal moisture to the outside during the drying process and shortens the drying time. The drying process is preferably hot air drying, natural sun drying, or freeze drying, until the moisture content of the cardamom stems and leaves is ≤10%. In this embodiment, the cut cardamom stems and leaves are placed in an electric heating drying oven and dried using a three-stage temperature-changing process. The preferred three-stage temperature-changing process is drying at 50℃ for 2 hours, then increasing the temperature to 55℃ for 3 hours, and finally decreasing the temperature to 45℃ for 1 hour. After drying, the material is preferably pulverized. In this embodiment, a pulverizer is used for pulverization. The pulverized material is preferably passed through a 40-mesh sieve to obtain homogeneous cardamom stem and leaf powder. The cardamom stem and leaf powder is rich in volatile oils and flavonoids, natural antibacterial components, and also has excellent physical water absorption properties. In this invention, the Amomum villosum stem and leaf powder can quickly absorb the free water that seeps out during the initial stage of high-moisture silage, adjusting the humidity of the material to a suitable level for the proliferation of lactic acid bacteria, effectively reducing the loss of nutrients with the seepage liquid; at the same time, the natural antibacterial components in the Amomum villosum stem and leaf powder can selectively inhibit the excessive proliferation of putrefactive bacteria such as Enterobacter and Clostridium, as well as molds, while having little impact on the lactic acid bacteria community.

[0019] In this invention, the amount of dihydromyricetin added can be 0.007 parts, 0.008 parts, or 0.009 parts. The dihydromyricetin can be obtained through self-production or commercial purchase. The dihydromyricetin is a dihydroflavonol compound extracted from the grape plant *Tea japonica*, and is the main active ingredient of *Tea japonica*. The dihydromyricetin is preferably extracted from *Tea japonica* powder. This invention does not limit the source of the *Tea japonica* powder; commercially available *Tea japonica* powder can be used. The extractant is preferably an aqueous alcohol solution, more preferably an aqueous ethanol solution. The concentration of the aqueous ethanol solution is preferably 50%~70%, and can be 60%. In this embodiment, a 60% aqueous ethanol solution is used for extraction. The liquid-to-solid ratio of the extractant to the *Tea japonica* powder is preferably 9~15:1 (v / w), and can be 10:1, 11:1, or 13:1. In this embodiment, a liquid-to-solid ratio of 12:1 is used for extraction. The extractant and *Tea japonica* powder are preferably refluxed twice at 85°C, each time for 1~2 hours, to obtain the extract. The extract is concentrated under reduced pressure to remove most of the extractant, yielding a concentrated extract. Preferably, the concentrated extract is defatted with petroleum ether and then extracted three times with an equal volume of ethyl acetate to obtain an extract. The extracts are combined and concentrated under reduced pressure to obtain an extract containing dihydromyricetin. The extract is preferably dissolved in water. After dissolution, it is preferably eluted using a resin column to remove impurities, yielding an eluent. The resin column is preferably an AB-8 macroporous resin column. The impurity remover is preferably deionized water. The eluent is preferably an aqueous ethanol solution. The aqueous ethanol solution is preferably a 40% aqueous ethanol solution. In this embodiment, the extract is dissolved in water and loaded onto an AB-8 macroporous resin column. It is first eluted with 3 column volumes of deionized water to remove impurities, then eluted with 5 column volumes of 40% ethanol solution, and the target eluent is collected. Preferably, the eluent is removed to obtain concentrated dihydromyricetin. The method for removing the eluent is preferably concentration under reduced pressure. The concentrated dihydromyricetin is then freeze-dried. The freeze-drying is preferably vacuum freeze-drying. The vacuum freeze-drying process involves pre-freezing the concentrated dihydromyricetin and then sublimating it in a vacuum environment to remove moisture, yielding dihydromyricetin powder. The dihydromyricetin powder is preferably of a purity ≥85%. The dihydromyricetin powder is preferably stored at 4°C in a dry, light-protected environment to prevent moisture absorption, clumping, and oxidation loss of active ingredients. The dihydromyricetin exhibits excellent antioxidant activity; its multiple phenolic hydroxyl groups can efficiently scavenge reactive oxygen species, chelate metal ions, block lipid peroxidation chain reactions, and protect polyunsaturated fatty acids in silage from oxidative damage, thereby maintaining feed freshness.

[0020] In this invention, the silage additive further includes auxiliary materials; by weight, the auxiliary materials preferably contain 5-10 parts of carbon source and 3-7 parts of nitrogen source. The carbon source provides usable sugars and carbohydrates for lactic acid bacteria fermentation in the fermentation system, and is preferably any one or a combination of at least two of the following: corn flour, wheat flour, barley flour, sorghum flour, cassava flour, potato flour, sugarcane molasses, beet molasses, glucose, sucrose, whey powder, or starch and their hydrolysates. The nitrogen source provides essential amino acids, peptides, and proteins for lactic acid bacteria growth, and is preferably any one or a combination of at least two of the following: wheat bran, soybean meal, rapeseed meal, peanut meal, cottonseed meal, distiller's grains, yeast powder, corn gluten meal, or urea. The carbon source and nitrogen source in this invention can be added as single components, or agricultural by-products that simultaneously function as both carbon and nitrogen sources (such as malt root powder, brewer's grains, etc.) can replace part or all of the auxiliary materials. In practical applications, appropriate carbon and nitrogen sources and their ratios can be selected based on the characteristics of the silage raw materials and actual production conditions. In this embodiment, corn flour is used as the carbon source and wheat bran as the nitrogen source to prepare a silage feed additive. The corn flour is rich in easily fermentable carbohydrates such as starch, which are rapidly utilized by lactic acid bacteria in the early stages of silage, causing the pH value to drop rapidly to below 4.0. The wheat bran is rich in hemicellulose and a small amount of soluble sugars, and also contains high levels of natural buffering substances such as phytic acid and protein, providing a mild growth environment for lactic acid bacteria. At the same time, the good water absorption of wheat bran can further assist the adsorption of free water by the Amomum villosum stem and leaf powder. The corn flour and wheat bran can serve as a rapid carbon source and buffer regulator for silage fermentation, effectively promoting the rapid proliferation and acid production of lactic acid bacteria, and preventing the inhibition of the activity of some beneficial microorganisms due to excessively rapid pH drops. The preferred weight ratio of corn flour and wheat bran is 7 parts corn flour and 3 parts wheat bran. Under this ratio, the silage has the highest lactic acid yield (5.31%) and the lowest ammonia nitrogen content (0.28%), resulting in the best fermentation quality.

[0021] The present invention provides an application of the silage additive in at least one of the following: improving the quality of silage, inhibiting the production of drug-resistant bacteria or harmful bacteria carrying mobile genetic elements in silage, blocking the horizontal spread of drug-resistant genes, and reducing the activity of gene exchange at the microbial community level.

[0022] In this invention, the improvement of silage quality preferably includes at least one of the following: improving the nutritional components of silage, improving the fermentation quality of silage, and regulating the balance of the silage microbial community.

[0023] In this invention, the improvement of silage nutritional composition preferably includes at least one of the following: increasing dry matter (DM) content, increasing crude protein (CP) content, decreasing neutral detergent fiber (NDF) content, and decreasing acid detergent fiber (ADF) content. Dry matter refers to the total amount of solid matter in silage after deducting moisture; its content directly reflects the degree of preservation of nutrients such as soluble carbohydrates during silage. Crude protein is the general term for nitrogenous substances in feed and is the primary indicator reflecting the protein nutritional level of feed. An increase in dry matter content indicates that acid production and osmotic pressure are properly balanced during silage, effectively reducing solid loss due to exudate; an increase in crude protein content indicates that the compound formulation effectively inhibits the activity of plant proteases and putrefactive microorganisms such as Clostridium, slowing down the process of protein deamination and degradation into ammonia nitrogen. Neutral detergent fiber contains hemicellulose, cellulose, and lignin from plant cell walls, while acid detergent fiber contains cellulose and lignin; both are core indicators reflecting the fiber composition and digestibility of feed. In this embodiment of the invention, the fermentation product of the silage additive showed a significant increase in dry matter content and crude protein content, reaching 30.01% and 10.56% respectively, which were significantly higher than those of the fresh sedge group and the control group of 100% silage raw material alone; and the content of neutral detergent fiber and acid detergent fiber was significantly reduced, decreasing to 54.63% and 29.95% respectively, which were significantly lower than those of the control group, proving that the silage additive can effectively reverse the nutritional loss in the conventional silage process and optimize the fiber structure of the feed.

[0024] In this invention, the improvement of silage fermentation quality preferably includes at least one of the following: reducing pH value, reducing ammonia nitrogen (NH3-N) content, increasing lactic acid (LA) content, and reducing butyric acid (BA) content. pH value is the most direct indicator of the acidity and preservation quality of silage; a rapid decrease in pH value can effectively inhibit the proliferation of harmful microorganisms (such as Enterobacteriaceae and Clostridium putrefactive bacteria). Ammonia nitrogen is a nitrogenous product produced by the degradation of proteins during silage through plant proteases and microbial deammoniation. Its percentage of dry matter content is a key indicator for assessing the degree of protein hydrolysis; the lower the ammonia nitrogen content, the better the protein preservation. Lactic acid is the main organic acid produced by lactic acid bacteria utilizing sugars during silage fermentation; its content directly reflects the efficiency of the dominant fermentation pathway. The higher the lactic acid content, the faster the pH value decreases, and the better the silage stability. Butyric acid is an undesirable product produced by the fermentation of amino acids and sugars by putrefactive bacteria such as Clostridium butyricum. Butyric acid accumulation not only leads to energy and nutrient loss but also produces a pungent odor, reducing feed palatability. In the embodiments of the present invention, the pH value of the fermentation product using the silage additive was significantly reduced to 3.92, the ammonia nitrogen content was as low as 0.28%, the lactic acid content was greatly increased to 5.31%, and the butyric acid content was significantly reduced to 0.47%, which was significantly better than the control group of 100% silage raw material alone. This proves that the application can effectively promote homolactic fermentation, create a strongly acidic storage environment, and strongly inhibit protein decomposition and butyric acid-type putrefaction fermentation.

[0025] In this invention, regulating the microbial community balance of silage preferably includes inhibiting putrefactive bacteria and / or promoting the formation of a dominant community of beneficial lactic acid bacteria. The putrefactive bacteria preferably include Klebsiella spp. Klebsiella ) and Pseudomonas spp. ( Pseudomonas The *Klebsiella* and *Pseudomonas* genera are common epiphytic pathogens and spoilage bacteria in the early stages of silage cultivation. Their rapid proliferation competitively consumes fermentable sugars and produces harmful metabolites such as biogenic amines through decarboxylation. The beneficial lactic acid bacteria preferably include *Lactobacillus* genus (…). Lactiplantibacillus Lactococcus spp. Lactococcus ) and Leuconostoc genus ( LevilactobacillusThe *Lactobacillus* genus (such as *Lactobacillus plantarum*) is a representative of homofermentative lactic acid bacteria, possessing high acid-producing capacity and broad-spectrum antibacterial activity; *Lactococcus* genus has a fast fermentation rate and can quickly initiate acidification; *Leuconostoc* genus can utilize citric acid and other substances to produce flavor compounds. The formation of a dominant community refers to a significant increase in the relative abundance of the aforementioned beneficial bacteria genera in the total bacterial population, making them the core functional bacteria that dominate the fermentation process. In this embodiment of the invention, Alpha diversity analysis (Chao1 index and observed species number decreased, Shannon index and Simpson index increased) proved that the community structure tended to be simplified and stable. Combined with LEfSe analysis and species relative abundance map, it was confirmed that the combination group fermented with the silage additive successfully constructed a dominant microbial community with Lactobacillus, Lactococcus, and Leuconostoc as the core, while significantly inhibiting Chytridiomycota in fresh silage raw materials and Klebsiella and Pseudomonas in the control group of 100% silage raw materials alone. This proves that the silage additive can directionally reshape the microbial community structure and improve the safety and stability of fermentation.

[0026] In this invention, the drug-resistant bacteria preferably include bacteria resistant to quinolone and / or glycopeptide antibiotics. Quinolone antibiotics are a class of widely used synthetic antibacterial drugs that exert their bactericidal effect primarily by inhibiting bacterial DNA gyrase; their corresponding resistance genes are widely present in environmental microorganisms. Glycopeptide antibiotics target peptidoglycan precursors from the cell walls of Gram-positive bacteria, and their resistance genes are important clinical markers of drug resistance. During conventional silage fermentation, opportunistic pathogens (such as *Pseudomonas* and *Enterococcus*) carrying the above two types of resistance genes proliferate significantly due to competitive pressure or oxidative stress, leading to a sharp increase in the abundance of their corresponding antibiotic resistance genes. In this embodiment of the invention, quantitative analysis using metagenomic sequencing and BLASTX alignment revealed that the abundance of quinolone and glycopeptide antibiotic resistance genes in the combination group fermented with the silage additive was significantly lower than that in the control group using 100% silage raw material alone. This demonstrates that the application can achieve the effect of specifically reducing specific types of resistance genes by inhibiting the proliferation of harmful bacteria (such as Pseudomonas) carrying these specific drug resistance genes.

[0027] In this invention, the silage additive can also significantly reduce the abundance of mobile genetic elements (MGEs) in silage by inhibiting the production of harmful bacteria carrying mobile genetic elements. Mobile genetic elements refer to DNA fragments capable of moving within or between genomes, mainly including insertion sequences, transposons, transposases, integrases, ISCR elements, and plasmids. MGEs are the core driving force behind the horizontal gene transfer of antibiotic resistance genes (ARGs) in bacterial communities, enabling the transfer of ARGs from one bacterium to another, and even the spread between different bacterial species. Existing research shows that more than half of the ARGs in silage are mobile and can be associated with MGEs; transposases are the most abundant type of MGE in silage samples, and the natural silage process significantly promotes the proliferation and spread of MGEs. This invention demonstrates the synergistic effect of Amomum villosum stem and leaf powder and dihydromyricetin, which can effectively inhibit the activity and proliferation of MGEs. On the one hand, the volatile oil components (such as bornyl acetate and camphor) in Amomum villosum stem and leaf powder have broad-spectrum antibacterial activity. They can inhibit the proliferation of putrefactive bacteria (such as Klebsiella, Pseudomonas, and Enterococcus) carrying MGEs by disrupting the integrity of bacterial cell membranes and interfering with bacterial quorum sensing systems. On the other hand, dihydromyricetin, as a flavonoid compound, can effectively interfere with the catalytic function of transposases and integrases, inhibit the transposition activity of transposons and insertion sequences, and block the plasmid-mediated ARGs conjugation transfer pathway by inhibiting the expression of bacterial conjugation-related genes. The embodiments of this application show that, compared with the control group of 100% silage raw materials alone, the abundance of microorganisms carrying total MGEs, transposons, transposases and plasmids in the fermentation products using the silage additive is significantly reduced. This proves that the silage additive has a significant inhibitory effect on microorganisms carrying key mobile genetic elements. It can effectively reduce gene exchange activity at the microbial community level and block the spread of antibiotic resistance genes at the level by interfering with the transposon mechanism and reducing plasmid load, thereby blocking the diffusion chain of antibiotic resistance genes in the silage microbial community at the source.

[0028] As can be seen, the silage additive provided by this invention uses Amomum villosum stem and leaf powder and dihydromyricetin as its main functional components. Amomum villosum stem and leaf powder can adsorb free water and slowly release natural active ingredients. Together with the carbon and nitrogen sources provided by the excipients, it can promote the rapid proliferation of lactic acid bacteria and dominate the fermentation process, effectively inhibiting the metabolic activity of putrefactive bacteria and significantly improving the nutritional value and fermentation quality of silage. Simultaneously, dihydromyricetin can increase the permeability of the outer membrane of Gram-negative putrefactive bacteria, enhance the antibacterial efficacy of Amomum villosum stem and leaf essential oil, and block the horizontal transfer of antibiotic resistance genes at the molecular level by inhibiting transposase and integrase activity, thus reducing the risk of antibiotic resistance gene transmission at the source. Therefore, the additive can significantly improve silage quality while reducing the production of drug-resistant bacteria and harmful bacteria carrying mobile genetic elements. The embodiments of this application show that after fermentation using this additive, the dry matter and crude protein content in silage significantly increased to 30.01% and 10.56%, respectively; the pH value decreased to 3.92; the lactic acid content increased to 5.31%; and the ammonia nitrogen and butyric acid content decreased to 0.28% and 0.47%, respectively. All these indicators were significantly better than the control group (100% silage raw material alone). Simultaneously, compared to the control group, putrefactive bacteria were effectively inhibited, and beneficial lactic acid bacteria such as *Lactobacillus* and *Lactococcus* formed a dominant community, optimizing fermentation quality. The abundance of resistance genes such as quinolones and glycopeptides, as well as mobile genetic elements, significantly decreased, reducing the risk of drug resistance gene transmission and the possibility of drug-resistant bacteria development from the source.

[0029] The present invention provides a silage feed, which is obtained by fermentation using the aforementioned silage feed fermentation system; the fresh weight of the silage feed is 60-70 parts; the weight is the same as the weight of the silage feed additive.

[0030] In this invention, the silage raw material preferably includes gramineous forage grasses, such as elephant grass, American foxtail grass, king grass, or oat grass. The silage raw material has high water content in its stems and leaves, relatively fine fibers, low lignin content, and high carbohydrate content, which is conducive to the reproduction and fermentation of lactic acid bacteria. However, precisely because of its high water content, the gramineous forage grasses often suffer from problems such as severe exudate loss, high risk of butyric acid fermentation, and significant protein degradation when ensiled alone, resulting in unstable silage quality. King grass is a preferred silage raw material. In this embodiment, King grass No. 4 from Reyan is used as the silage raw material. The fresh sample moisture content of King grass is typically ≥80%, making it a typical high-moisture silage raw material and the most representative silage raw material for testing the effectiveness of silage additives.

[0031] In this invention, the preferred method for preparing silage includes the following steps: cutting the silage raw material into 2-3 cm lengths after harvesting; adding additives; thoroughly mixing the compound additives with the cut silage raw material; filling the mixture into silage bags; vacuum sealing; and fermenting at room temperature to obtain the silage. The fermentation temperature is preferably controlled at 25-35°C. The fermentation time is preferably 28-32 days. The fermentation time can be adjusted reasonably according to the actual ambient temperature and the scale of silage production.

[0032] In this invention, the fresh weight of the silage is 60-70 parts; this weight is the same as the weight of the silage additive. If the amount of silage added is higher than 70 parts, the moisture content of the high-moisture forage cannot be effectively reduced to the suitable range for silage. A large amount of exudate will still be generated during the silage process, resulting in a serious loss of dry matter and soluble nutrients, and making it difficult to drive rapid lactic acid fermentation and effectively inhibit the proliferation of putrefactive bacteria. If the amount of silage raw material added is lower than 60 parts, the excessively high dry matter content will reduce the compaction density of the silage material, leading to excessive residual oxygen after sealing, which is not conducive to the rapid initiation of anaerobic fermentation and increases feed costs. In this embodiment of the invention, using 60 parts of silage raw material and 40 parts of silage additive (30 parts of cardamom stems and leaves, 0.005 parts of dihydromyricetin, 7 parts of corn flour and 3 parts of wheat bran) can achieve better fermentation results, increasing the final dry matter content of the silage material to about 30.01%, reducing the final pH value to 3.92, achieving a lactic acid content of 5.31%, ammonia nitrogen content as low as 0.28%, and butyric acid content of only 0.47%. At the same time, the total abundance of antibiotic resistance genes is significantly lower than that of the control group (100% silage raw material alone), achieving a dual improvement in silage quality and biosafety.

[0033] This invention provides an application of the silage in animal husbandry, wherein the animal husbandry includes improving animal growth performance and / or reducing the spread of drug resistance genes in animals.

[0034] In this invention, the improvement of animal growth performance preferably includes at least one of the following: increasing average daily weight gain (ADG), increasing average daily feed intake (ADFI), reducing feed conversion ratio (F / G), and improving the animal's basic antioxidant metabolic level. Average daily weight gain refers to the average increase in body weight per unit time, which is the core production indicator for measuring animal growth rate and feed conversion efficiency. Average daily feed intake reflects the palatability of the feed and the animal's feeding enthusiasm; increased feed intake is the material basis for increased weight gain. The feed conversion ratio refers to the amount of feed consumed per unit of weight gain; the lower the value, the higher the feed conversion efficiency. In an embodiment of this invention, through a 56-day sheep feeding trial, the group fed the silage provided by this invention showed a significantly higher average daily weight gain (14.12%) and a significantly higher average daily feed intake (10.94%) compared to the control group (silage made from 100% silage raw materials alone), while the feed conversion ratio was slightly lower, demonstrating that the silage can promote animal growth. Improving the basic antioxidant physiological metabolic level of animals can enhance normal physiological antioxidant indicators, maintain the body's basic metabolic balance, optimize feed nutrient absorption efficiency, promote animal growth and development, and improve overall growth performance.

[0035] In this invention, the enhancement of the animal's basic antioxidant physiological metabolic level preferably includes at least one of the following: serum total antioxidant level (T-AOC), glutathione peroxidase (GSH-Px) activity, increased superoxide dismutase (SOD) activity, and malondialdehyde (MDA) content. The serum total antioxidant level reflects the body's overall ability to scavenge free radicals and is a comprehensive indicator for measuring the body's oxidative stress level. Glutathione peroxidase is an important selenium-containing antioxidant enzyme in the body, which can specifically catalyze the decomposition of peroxides by reduced glutathione, protecting cell membranes from oxidative damage. Superoxide dismutase is the first line of defense against superoxide anion free radicals, and its activity directly reflects the cell's ability to resist oxygen free radical damage. Malondialdehyde is the end product of lipid peroxidation of polyunsaturated fatty acids, and its content directly reflects the degree of cell membrane lipid peroxidation damage, making it a classic biomarker for assessing oxidative stress damage. In this embodiment of the invention, serum biochemical index detection demonstrated that the serum T-AOC, GSH-Px, and SOD activities of goats fed the silage combination group were significantly increased by 60.61%, 50.12%, and 25.81%, respectively, compared with the control group (fed silage made from 100% silage raw materials alone). At the same time, the MDA content was significantly reduced by 39.14%. This indicates that after the silage was ingested by the animals, it effectively scavenged free radicals in the body, significantly enhanced the body's oxidative defense capacity, and reduced lipid peroxidation damage. This is beneficial for stabilizing the basic redox balance, avoiding oxidative metabolic imbalance that interferes with normal anabolic metabolism, reducing endogenous nutrient loss, and allowing more nutrients to be used for body weight gain and tissue development, thereby increasing daily weight gain, reducing feed conversion ratio, and improving animal growth performance.

[0036] In this invention, reducing animal drug resistance preferably refers to reducing the total abundance of antibiotic resistance genes (ARGs) in the animal's intestines or feces. Conditional pathogens can acquire ARGs in the intestines and transform into drug-resistant bacteria, easily causing refractory endogenous infections when animals are stressed or have weakened immunity. Therefore, reducing ARG abundance reduces the risk of drug-resistant bacterial infection in animals at the source. Secondly, high abundance of ARGs in feces is a major channel for the export of resistance genes from farms to soil and water bodies. This invention, by significantly reducing the abundance of fecal ARGs, effectively blocks the diffusion of resistance genes into the environment, reducing the drug resistance pollution load on the surrounding environment. In this embodiment of the invention, metagenomic sequencing analysis of goat feces showed that the total ARGs abundance of the combination group using the silage feed described in this invention was significantly lower than that of the control group (silage feed fed with 100% silage raw materials alone). This demonstrates that the application effectively reduces the accumulation level of resistance genes in the animal intestine by reducing the intake of resistance genes in feed and regulating the intestinal microecology, which can effectively reduce the drug resistance of animals and alleviate drug resistance pollution in the environment.

[0037] In this invention, the drug resistance gene preferably includes a resistance gene for at least one antibiotic selected from tetracyclines, β-lactams, macrolides, lincosamides, and streptozotocins. Tetracycline antibiotics (such as oxytetracycline and chlortetracycline) are among the most commonly used growth-promoting and therapeutic antibiotics in livestock farming, and their resistance genes are widely disseminated through ribosomal protective proteins and efflux pump mechanisms. β-lactam antibiotics (such as penicillins and cephalosporins) are the most widely used antibacterial drugs in clinical practice, and their resistance genes encode... β - Lactamases can hydrolyze the active structure of drugs. The macrolides, lincosamides, and streptozotocins mentioned are MLS antibiotics. These three types exhibit cross-resistance due to their similar binding sites on the 50S ribosomal subunit, and are among the most frequently detected types of drug-resistant bacteria in animal-derived organisms. In this invention, the reduction of animal drug resistance is specifically manifested in a significant reduction of the abundance of the above three types of ARGs in animal feces, with the reduction of MLS resistance genes being particularly prominent. P <0.01). Simultaneously, the silage significantly reduced the abundance of microorganisms carrying insertion sequences and integrases closely related to horizontal gene transfer in the animal gut, and significantly reduced the total mobile genetic element (MGE) load. This indicates that the silage, by inhibiting the activity of the transposition and integration system, mechanistically blocks the key pathways of the horizontal spread of the aforementioned drug resistance genes among the gut microbiota, effectively reducing the risk of drug resistance transmission in animals and the breeding environment.

[0038] In summary, the silage provided by this invention, obtained by fermenting silage raw materials with the silage additives, can significantly improve animal growth performance, enhance antioxidant capacity, and reduce drug resistance when used in animal feeding. The embodiments of this application show that, compared with the control group fed silage made from 100% silage raw materials alone, the experimental group of goats showed increased final body weight and average daily feed intake of 18.29% and 10.94%, respectively, and a significant increase in average daily weight gain of 14.12%, indicating that the silage has good palatability and growth-promoting effects. Regarding antioxidant capacity, the total antioxidant capacity, glutathione peroxidase, and superoxide dismutase activities in the serum of the experimental group animals significantly increased by 60.61%, 50.12%, and 25.81%, respectively, while the malondialdehyde content, reflecting lipid peroxidation damage, significantly decreased by 39.14%, indicating that feeding this silage can effectively scavenge free radicals in the animal body, enhance the body's oxidative defense capacity, and reduce oxidative damage. Regarding antibiotic resistance control, the abundance of total antibiotic resistance genes in the feces of the experimental group was significantly lower than that of the control group. Specifically, the abundance of tetracycline, β-lactam, and MLS resistance genes all decreased significantly. Simultaneously, the abundance of insertion sequences and integrases, which are closely related to horizontal gene transfer, also showed a significant decrease. This indicates that the silage can reduce the accumulation of antibiotic resistance genes in the animal gut at the source and block their spread among the gut microbiota. In summary, the silage provided by this invention achieves excellent effects in promoting growth, providing antioxidant protection, and controlling antibiotic resistance in animal husbandry. It is a high-quality fermented feed that combines production performance and biosafety.

[0039] Unless otherwise specified, the materials and equipment used in this invention are all commercially available products in the field.

[0040] To further illustrate the present invention, the solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0041] Example 1 Preparation of functional components in silage additives 1. Preparation of Amomum villosum stem and leaf powder The stems and leaves of Amomum villosum are harvested within 48-72 hours after the fruit is harvested. After physical crushing and cutting by a double-roll mill, they are placed in an electric heating drying oven and dried using a three-stage variable temperature process: drying at 50 ℃ for 2 hours, then raising the temperature to 55 ℃ for 3 hours, and finally lowering the temperature to 45 ℃ for 1 hour, until the moisture content of the material is ≤10%. The dried material is then pulverized using a pulverizer and passed through a 40-mesh sieve to obtain homogeneous Amomum villosum stem and leaf powder, which is then sealed for later use.

[0042] 2. Extraction and purification of dihydromyricetin Method for extracting dihydromyricetin (DMY) from vine tea: Take vine tea powder and add 60% ethanol aqueous solution at a material-to-liquid ratio of 1:12 (w / v). Reflux and extract twice at 85 °C, 1.5 hours each time. Combine the extracts and concentrate under reduced pressure until no alcohol odor remains. Defatt the concentrate with petroleum ether and extract three times with ethyl acetate. Combine the ethyl acetate extract phases and concentrate under reduced pressure to recover the solvent, obtaining a crude extract. Disperse and dissolve the obtained extract thoroughly in pure water and load it onto an AB-8 macroporous adsorption resin column. Perform gradient elution sequentially: first, elute with 3 column volumes of deionized water to remove water-soluble impurities (such as polysaccharides and proteins); then elute the target product with 5 column volumes of 40% ethanol aqueous solution. Collect the ethanol eluent from this step, concentrate under reduced pressure to recover the ethanol, and freeze-dry the concentrate to obtain dihydromyricetin (DMY) powder with a purity of over 85%. Store at 4 °C in a sealed container away from light for later use.

[0043] Example 2 Optimization of silage additive formulations based on orthogonal experiments 1. Preparation of silage raw materials Select Reyan No. 4 king grass with a plant height of 1.8~2.0 m (fresh sample moisture content ≥80%), and cut it to a length of 2~3 cm using a chaff cutter after harvesting. All additives were weighed and compounded according to the mass percentage of the fresh king grass.

[0044] 2. Orthogonal experimental design Dihydromyricetin, Amomum villosum stem and leaf powder, corn flour, and wheat bran were premixed and then thoroughly mixed with chopped licorice root to form a silage fermentation system. The total mass of this silage fermentation system was taken as 100%. To optimize the formula, a 3-factor, 3-level orthogonal experiment was conducted. The following three factors were investigated: Factor A (Additives): The mass percentage of corn flour and wheat bran in the silage fermentation system. The total amount of corn flour and wheat bran added is fixed at 10% of the mass of the silage fermentation system.

[0045] Factor B (Functional Component 1): The amount of Amomum villosum stem and leaf powder added, expressed as a percentage of the mass of the silage fermentation system.

[0046] Factor C (Functional Component Two): The amount of dihydromyricetin added, expressed as a percentage of the mass of the silage fermentation system.

[0047] The specific levels of each factor and L9(3) 4 The orthogonal experimental arrangement is shown in Table 1. After each component was thoroughly mixed with the king grass, it was placed into silage bags, vacuum-sealed, and stored. After fermentation at room temperature for 30 days, the color, odor, texture, moisture content, and pH value of the silage were comprehensively evaluated by sensory evaluation, and the silage was mainly divided into 4 grades. The specific standards are shown in Table 2.

[0048] Table 1 Orthogonal Experimental Design Table

[0049] Table 2 Sensory Evaluation Criteria for Silage

[0050] 3. Results of orthogonal experiments with different formulations The sensory quality scores of the silage are shown in Table 3. The control group and group A1B1C1 had a combined score of less than 50, indicating a fair sensory evaluation level. Groups A3B2C2 and A3B3C3 both scored ≥76, with little difference, indicating a superior sensory evaluation level. Considering production costs, group A3B2C2 was selected as the optimal combination for analysis. The specific formula for this combination is as follows (by weight): 70 parts of *Gnaphalium affine*, 7 parts of corn flour, 3 parts of wheat bran, 20 parts of *Amomum villosum* stem and leaf powder, and 0.005 parts of dihydromyricetin.

[0051] Table 3 Sensory evaluation results of orthogonal experiments

[0052] Example 3 Effects of silage additives on the nutritional components, fermentation quality, microbial community structure, and antibiotic resistance genes of *Cynanchum paniculatum* silage. 1. Experimental Methods Three groups of samples were selected: fresh *Gnaphalium affine* raw materials from the same batch, a control group (100% *Gnaphalium affine* silage alone), and a combination group (fermented using the silage additive formulation A3B2C2 from Example 2). The nutritional components and fermentation quality of the three groups were determined to quantify the improvement effect of the silage additive on the conventional quality of silage. Simultaneously, metagenomic sequencing was performed on the three groups of samples. Bioinformatics analysis was used to analyze the structure and dynamic changes of the microbial community (especially the bacterial community) during silage production, and the types, abundance, and associations of antibiotic resistance genes (ARGs) with mobile genetic elements (MGEs) in the samples were quantitatively analyzed.

[0053] 2. Methods for testing nutritional components and fermentation quality Dry matter (DM) content was determined according to the "Feed Analysis and Feed Quality Testing Technology" compiled by Zhang Liying; crude protein (CP) was determined using a Kjeldahl nitrogen analyzer; and the contents of neutral detergent fiber (NDF) and acid detergent fiber (ADF) were determined using the Pantheon fiber method. After opening the silage bags, 20 g of each sample was weighed, added to 180 mL of distilled water, mixed thoroughly, and extracted at 4 ℃ for 24 h. The extract was then filtered through four layers of gauze and qualitative filter paper to obtain the silage sample extract. The pH value was determined using a precision pH meter; the ammonia nitrogen content was determined using the phenol-hypochlorite colorimetric method; and the contents of lactic acid, acetic acid, propionic acid, and butyric acid were determined using the method in DB15 / T1458-2018. The effects of different treatments on the nutritional composition and fermentation quality of *Gnaphalium affine* silage are shown in Table 4. Regarding nutritional composition, the DM and CP contents in the control group were significantly lower than those in fresh *Gnaphalium affine*, indicating dry matter loss and protein degradation during conventional silage production. In contrast, the DM and CP contents in the combined group were significantly higher than those in fresh *Gnaphalium affine* and the control group, while the NDF and ADF contents were significantly lower. This indicates that the combined formulation not only effectively reverses the nutritional losses during conventional silage production but also optimizes the fiber structure of the feed through exogenous addition, thereby enhancing its nutritional value. Regarding fermentation quality, the pH value in the control group was significantly lower than that in the fresh raw material, and the accumulation of fermentation products such as lactic acid, acetic acid, propionic acid, and butyric acid was detected, with butyric acid content reaching 1.04%, reflecting protein degradation and butyric acid fermentation during the fermentation process. The pH value in the combined group was significantly lower than that in the control group, the lactic acid content was significantly increased, while the ammonia nitrogen and butyric acid contents were significantly decreased. This indicates that the combined formulation effectively promotes lactic acid fermentation, creates a strongly acidic storage environment, and simultaneously inhibits protein decomposition and butyric acid formation.

[0054] Table 4. Effects of different treatments on the nutrient composition and fermentation quality of *Cynanchum paniculatum* silage.

[0055] Note: The letters a, b, and c following the data in the same row in the table represent the significance levels between each treatment group. In the same row, treatment groups marked with completely different letters indicate significant differences. P <0.05); treatment groups marked with the same letter (including combinations of letters) indicate no significant difference.

[0056] 3. Microbial community structure analysis After opening the silage bags, 0.50 g of each silage sample was placed in a 1.5 mL extraction tube. DNA was extracted using the magnetic bead method. The purity and concentration of the DNA were determined by 1% agarose gel electrophoresis. An appropriate amount of sample was then transferred to a centrifuge tube and diluted to 1 ng / µL. The bacterial microbial composition and diversity were analyzed by sequencing the V3-V4 region of 16S rRNA using 338F (ACTCCTACGGGAGGCAGCAG, SEQ ID NO: 1) and 806R (GGACTACHVGGGTWTCTAAT, SEQ ID NO: 2), respectively. PCR products were mixed at equal concentrations and purified by 1×TAE 2% agarose gel electrophoresis. The target band was then extracted. Libraries were constructed using a kit. After Qubit quantification and library detection, and if qualified, the libraries were sequenced using a NovaSeq 6000PE250.

[0057] The results of Alpha diversity analysis of the microbial community are shown in Table 5. The Chao1 index and the number of observed species in the combined group showed a trend of being lower than those in the control group, while the Shannon index and Simpson index showed a trend of being higher than those in the control group. These results indicate that the silage additive of this invention screened and remodeled the original complex microbial community of *Cynanchum paniculatum* silage, forming a more stable and functionally specific community. Further LEfSe analysis and relative species abundance analysis (…) Figure 1 Studies A and B confirmed that the original epiphytic microbial community of fresh *Gnaphalium affine* is complex, containing fungi such as *Chytridactycetes* and environmental microorganisms such as *Actinomycetes*. The control group's microbial community was characterized by potential putrefactive bacteria such as *Klebsiella* and *Pseudomonas*, along with the presence of *Lactobacillus*, indicating insufficient natural fermentation. In contrast, the combined group successfully constructed a dominant community of beneficial lactic acid bacteria centered on *Lactobacillus*, *Lactococcus*, and *Leuconostoc*. It also significantly inhibited the main putrefactive bacteria in the control group. This result demonstrates that the silage additive described in this invention can effectively inhibit the proliferation of harmful bacteria and promote the growth of beneficial lactic acid bacteria by directionally regulating the microbial community, thereby optimizing the silage fermentation process and improving fermentation quality and safety.

[0058] Table 5. Results of Alpha diversity analysis of microbial communities

[0059] 4. Metagenomic detection of antibiotic resistance genes Metagenomic sequencing of silage fermentation and goat manure samples was performed using the Illumina NovaSeq 6000 sequencing platform. Illumina PE libraries were constructed using the NEBNext® Ultra™ DNA library preparation kit. After sequencing, the raw sequences were aligned to a reference genome using bowtie2, and host-derived sequence contamination was removed. Subsequently, high-quality clean reads were used for species annotation and identification and abundance prediction of antibiotic resistance genes (ARGs). In the quantitative analysis of ARGs, the UBLAST algorithm was first used for preliminary screening of potential ARG sequences in the metagenomic dataset, followed by precise alignment and classification annotation using BLASTX. Sequences with an amino acid similarity ≥90% and a coverage ≥25 amino acids were identified as ARG-positive sequences. For annotation of mobile genetic elements (MGEs), clean reads are directly aligned to the MGEs database. Sequences are annotated as plasmids, integrons, transposases, insertion sequence transposases, and insertion sequence genes, using a similarity >90% and coverage of ≥25 amino acids as a threshold. Detection results are as follows: Figure 2 and Figure 3 As shown.

[0060] like Figure 2 As shown, metagenomic sequencing analysis revealed eight main ARGs in fresh *Gnaphalium affine* and various silage fermentation samples: β-lactams, multidrug efflux pumps (MAPs), quinolones, glycopeptides, aminoglycosides, chloramphenicol, fosfomycins, and tetracyclines. Overall, the abundance of ARGs in fresh raw materials was low, while conventional silage fermentation significantly promoted the enrichment of resistance genes. This effect was mainly driven by the dominant amplification of β-lactam and MAP genes. In contrast, while the combination group with the added compound additive failed to completely reverse the drug resistance risk from fermentation (its total ARG abundance was still significantly higher than that of fresh raw materials), it effectively inhibited the proliferation of specific ARG categories. Compared with the control group, the abundance of quinolones and glycopeptides ARGs in the combination group was significantly reduced, while the upward trend of β-lactams and MAPs was also somewhat curbed, indicating that the compound additive has a targeted reduction effect on specific types of resistance genes.

[0061] like Figure 3As shown, major mobile genetic elements (MGEs), including inserted sequences, transposons, transposases, integrases, ISCR elements, and plasmids, were detected in both fresh and silage samples. Analysis revealed that the abundance of various MGEs in fresh raw materials was generally low, while the abundance of total MGEs significantly increased after silage fermentation. This confirms that silage fermentation significantly promoted the proliferation of MGE-carrying microorganisms and the spread of MGEs, with the enrichment effect of transposons and transposases being particularly prominent, suggesting their key driving role in the horizontal transfer of resistance genes. Compared with the control group, the abundance of total MGEs, transposons, transposases, and plasmids in the combined additive treatment group was significantly reduced, indicating that this silage additive has a significant inhibitory effect on MGE-carrying microorganisms and key MGEs, thereby interfering with transposon activity and reducing the risk of horizontal gene transfer.

[0062] Example 4 Effects of different treatment groups on silage on animal husbandry 1. Sheep feeding experiment Thirty-six 6-month-old Leizhou goats of similar weight were selected and randomly divided into two groups, with three replicates per group and six goats per replicate. The control group was fed 100% Wangcao silage fermented feed, while the combination group was fed the silage fermented feed prepared in Example 3. After a 7-day pre-feeding period, a formal feeding trial lasting 56 days was conducted. During the trial, the goats had free access to feed, and their daily feed intake and uneaten feed were recorded. All goats were individually marked, and they were weighed on an empty stomach at the beginning and end of the trial for growth performance calculation.

[0063] The results of the growth performance test are shown in Table 6. Compared with the control group, the final body weight and average daily feed intake of goats in the combined treatment group increased by 18.29% and 10.94%, respectively, and the average daily weight gain increased significantly by 14.12%. This indicates that the combined treatment group had a positive effect on the growth performance of goats.

[0064] Table 6 Effects of different treatments on the growth performance of goats

[0065] 2. Detection of serum antioxidant indicators After the sheep feeding trial concluded, blood was collected from the jugular vein of all sheep before morning feeding. Blood samples were allowed to stand at room temperature for 30 minutes, then centrifuged at 3000 r / min for 15 minutes to separate serum, which was then aliquoted and stored at -80℃ for later analysis. Serum samples were measured using reagent kits from Nanjing Jiancheng Bioengineering Institute. Total antioxidant capacity (FRAP method), glutathione peroxidase (DTNB method), catalase (ammonium molybdate method), superoxide dismutase (WST-1 method), and malondialdehyde (TBA method) were determined strictly according to the manufacturer's instructions.

[0066] The results of the antioxidant index detection are shown in Table 7. Compared with the control group, the total antioxidant capacity, glutathione peroxidase, and superoxide dismutase activities in the serum of goats in the combined group were significantly increased by 60.61%, 50.12%, and 25.81%, respectively; at the same time, the malondialdehyde content, a key indicator reflecting lipid peroxidation damage, was significantly reduced by 39.14%. This indicates that the combined treatment can significantly enhance the oxidative defense capacity of goats and reduce oxidative damage.

[0067] Table 7 Effects of different treatments on antioxidant indices in goat serum

[0068] 3. Effects of different treatments on the composition of antibiotic resistance genes in goat feces Before the end of the sheep feeding trial, fecal samples were collected from sheep in each replicate group for five consecutive days, and samples within the same replicate were mixed thoroughly. Subsequently, metagenomic sequencing was performed on the mixed fecal samples to systematically analyze the composition and abundance changes of major ARGs. Simultaneously, comprehensive annotation and quantitative analysis were performed on MGEs, including insert sequences, transposons, transposases, integrases, ISCR elements, and plasmids, to assess the impact of different silage diets on the emission and horizontal translocation potential of ARGs in the goat gut. The results are shown below. Figure 4 and Figure 5 .

[0069] like Figure 4 As shown, compared with the control group, the abundance of total ARGs in the feces of goats in the combined treatment group was significantly reduced, with significant decreases in the abundance of tetracyclines, β-lactams, and MLS (macrolides / lincosamides / streptomycins) ARGs, especially the reduction in MLS. These results indicate that the combined additive treatment can effectively reduce the accumulation levels of major ARG classes in the goat intestines, which is of positive significance for controlling the spread of drug resistance genes.

[0070] like Figure 5 As shown, compared with the control group, the abundance of inserted sequences and integrases in the goat feces of the combined group was significantly reduced, while the abundance of ISCR elements and transposons also showed a significant decreasing trend, and the overall MGEs load was reduced. These results indicate that silage additive treatment can effectively inhibit the core driving force of bacterial gene horizontal transfer, and can weaken the diffusion of resistance genes among bacterial communities by reducing the activity of transposon and integrator systems.

[0071] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A silage additive, characterized in that, The additive contains functional ingredients; By weight, the functional ingredients include 20-30 parts of Amomum villosum stem and leaf powder and 0.0050-0.01 parts of dihydromyricetin.

2. The silage additive according to claim 1, characterized in that, It also includes auxiliary materials; The excipients comprise 5-10 parts by weight of carbon source and 3-7 parts by weight of nitrogen source.

3. The use of the silage additive according to claim 1 or claim 2 in at least one of the following: Improve the quality of feed silage; Inhibit the growth of drug-resistant bacteria or harmful bacteria carrying mobile genetic elements in silage; Block the horizontal spread of drug resistance genes; And reduce gene exchange activity at the microbial community level.

4. The application according to claim 3, characterized in that, The improvement of silage quality includes at least one of the following: improving the nutritional composition of silage, improving the fermentation quality of silage, and regulating the balance of the silage microbial community.

5. The application according to claim 3, characterized in that, The drug-resistant bacteria include bacteria resistant to quinolone and / or glycopeptide antibiotics.

6. The application according to claim 3, characterized in that, The mobile genetic elements include transposons, transposases, and plasmids.

7. A type of silage, characterized in that, It is obtained by fermenting silage raw materials using the silage additive described in claim 1 or claim 2; The fresh weight of the silage raw material is 60-70 parts; The weight percentages are the same as those in claim 1.

8. The silage according to claim 7, characterized in that, The silage raw materials include at least one of king grass, elephant grass, and American foxtail grass.

9. The application of the silage according to claim 7 or 8 in animal husbandry, characterized in that, The animal husbandry practices include improving animal growth performance and / or reducing the spread of drug resistance genes in animals.

10. The application according to claim 9, characterized in that, The drug resistance genes include resistance genes to at least one of the following antibiotics: tetracyclines, β-lactams, macrolides, lincosamides, and streptozotocins.

Images