Use of an agent that inhibits expression of a TPI1 gene or activity of a TPI1 protein in the manufacture of a medicament for treating a tumor

Abstract

The application discloses an application of a reagent for inhibiting TPI1 gene expression or TPI1 protein activity in preparation of a medicine for treating tumors, and relates to the technical field of biological medicines. The application discloses an application of a reagent for inhibiting TPI1 gene expression or TPI1 protein activity in preparation of a medicine for treating tumors. The application induces tumor cell aging by knocking down TPI1, thereby inhibiting the progression of tumors. It is found in a 301 kidney cancer cohort that TPI1 is highly expressed in tumors, and after knocking down TPI1, it is found that the proliferation of kidney cancer cells is inhibited. It is proved through a nude mouse xenogeneic subcutaneous tumor model that the subcutaneous tumor of the TPI1-knocked-down cells grows slowly. Under the hint of transcriptomics, it is verified through multiple ways that TPI1 knockdown can induce tumor cell aging, and the conclusion is further verified in prostate cancer, lung cancer and bladder cancer cell lines.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of a reagent that inhibits TPI1 gene expression or TPI1 protein activity in the preparation of drugs for treating tumors. Background Technology

[0002] Cellular senescence is a promising strategy in cancer treatment. It exhibits a double-edged sword effect in cancer therapy and is currently mainly applied to the following strategies:

[0003] Pro-senescence therapy: Radiotherapy, chemotherapy (such as cisplatin and docetaxel), and targeted drugs (such as CDK4 / 6 inhibitors and PARP inhibitors) can induce tumor cells into a senescent state, thereby inhibiting tumor growth. This strategy, by locking malignant cells in a state of growth arrest, has become an effective means of controlling tumors.

[0004] Senescent cell clearance therapy: Treatment-induced senescent cells, if left untreated for a long time, can create a pro-inflammatory microenvironment, promoting tumor recurrence and metastasis through SASP secretion. Therefore, a "combination punch" strategy is adopted: first, senescence is induced, then senescent cells are cleared using senescent cell lysing agents. Bcl-2 inhibitors, such as Navitoclax (ABT-263), can selectively clear senescent tumor cells; when used in combination with chemotherapy, they can improve efficacy and reduce metastasis. Novel targets: Research has found that some senescent cells depend on Mcl-1 for survival; Mcl-1 inhibitors can more thoroughly clear these cells.

[0005] Immunological microenvironment remodeling: The senescent tumor microenvironment has immunosuppressive properties, and senescent cells can be cleared by enhancing the function of immune cells. IL-15 can delay the senescence of CD8+ T cells and restore their anti-tumor activity. Combined with PARP inhibitors, CDK4 / 6 inhibitors and anti-PD-L1 therapy, it can remodel the tumor microenvironment and increase T cell / NK cell infiltration.

[0006] SASP-targeted regulation: Inhibiting key SASP factors (such as IL-1, IL-6, TGF-β) or regulating metabolic pathways (such as inhibiting NAMPT and glutamine metabolism) can weaken the tumor-promoting effect of senescent cells and enhance their sensitivity to apoptosis. Challenges and prospects.

[0007] The main challenges currently faced by this application include: incomplete clearance due to the heterogeneity of senescent cells, the risk of toxicity to normal tissues, and the need to accurately distinguish between treatment-induced senescent cells and normal senescent cells. Summary of the Invention

[0008] To address the technical problems existing in the prior art, this invention provides the application of a reagent that inhibits TPI1 gene expression or TPI1 protein activity in the preparation of drugs for treating tumors. The technical solution is as follows:

[0009] Application of reagents that inhibit TPI1 gene expression or TPI1 protein activity in the preparation of drugs for treating tumors.

[0010] Optionally, the tumor includes: kidney cancer, prostate cancer, lung cancer, and / or bladder cancer.

[0011] Optionally, the reagent treats tumors by inducing cellular senescence.

[0012] A shRNA for knocking down the TPI1 gene, the sequence of which is shown in SEQ ID No. 3 and SEQ ID No. 4, or the sequence of which is shown in SEQ ID No. 5 and SEQ ID No. 6.

[0013] An expression vector, lentivirus, and / or cell containing the sequence of the shRNA described above.

[0014] Optionally, the expression vector is a lentiviral expression vector;

[0015] And / or, the lentiviral expression vector is pLKO.1-puro;

[0016] And / or, the cells are kidney cancer cells, prostate cancer cells, lung cancer cells, and / or bladder cancer cells;

[0017] And / or, the renal cell carcinomas include A498 and OS-RC-2;

[0018] And / or, the prostate cancer cells include C4-2;

[0019] And / or, the lung cancer cells include A549;

[0020] And / or, the bladder cancer cells include T24.

[0021] A pharmaceutical composition for treating tumors, the pharmaceutical composition comprising: an agent that inhibits TPI1 gene expression or TPI1 protein activity.

[0022] Optionally, the tumor includes: kidney cancer, prostate cancer, lung cancer, and / or bladder cancer.

[0023] Optionally, the reagent treats tumors by inducing cellular senescence.

[0024] The beneficial effects of the technical solutions provided in the embodiments of the present invention include at least the following:

[0025] This invention discovers and validates that TPI1 is not only a potential prognostic biomarker but also a therapeutic target. Elucidating its mechanism can provide new strategies for tumor treatment. This invention inhibits tumor progression by inducing tumor cell senescence through TPI1 knockdown. In a 301 renal cell carcinoma cohort, this invention found that TPI1 is highly expressed in tumors, and knockdown of TPI1 inhibited renal cell proliferation. Using a nude mouse xenograft subcutaneous tumor model, it was confirmed that TPI1-knockdown subcutaneous tumors grow slowly. Guided by transcriptomics, we validated through various methods that TPI1 knockdown can induce tumor cell senescence, and further validated this conclusion in prostate cancer, lung cancer, and bladder cancer cell lines. Future directions include developing methods to induce tumor cell senescence, combining senescent cell scavengers with immunotherapy to prolong patient survival. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 This is a diagram illustrating the crucial role of TPI1 in the proliferation of renal cell carcinoma lines, as provided in this embodiment of the invention. Figure 1 A shows representative images of TPI1 staining in tumors and adjacent normal tissues in the 301 renal cell carcinoma cohort tissue microarray, along with a statistical graph of the tissue microarray staining results. Figure 1 Figure B is a diagram of constructing a TPI1 knockdown cell model; Figure 1 The middle C represents the graph showing the inhibition of cell proliferation by TPI1 knockdown; Figure 1 The graph in D shows the decrease in EdU positivity rate after TPI1 knockdown; Figure 1 The middle section (E) shows the ability of TPI1 knockdown to inhibit monoclonal antibodies. Figure 1 The middle F figure shows the slow growth of subcutaneous tumors due to TPI1 knockdown; Figure 1 The graph in G represents the low Ki67 positivity rate in subcutaneous tumors with TPI1 knockdown;

[0028] Figure 2 This is a diagram illustrating the effect of TPI1 knockdown on renal cell carcinoma cell senescence, as provided in an embodiment of the present invention. Figure 2 The diagram in A is a transcriptomic representation of TPI1 knockdown that exhibits multiple features of cellular senescence, such as SASP secretion, activation of inflammatory signaling pathways, and inhibition of the cell cycle. Figure 2 Figure B is a graph used to verify the upregulation of β-galactosidase activity by TPI1 knockdown through staining for aging-related β-galactosidase. Figure 2Figure C is a WB graph verifying that TPI1 knockdown induces upregulation of p-γH2AX-P53-P21 and downregulation of LMNB1; Figure 2 The middle image (D) is an immunofluorescence assay demonstrating TPI1 knockdown induction of MMP3, IL6, and HMGB1. Figure 2 The figure in E is a flow cytometry diagram verifying the production of reactive oxygen species induced by TPI1 knockdown; Figure 2 F is a graph demonstrating TPI1 knockdown-induced cell cycle arrest using flow cytometry. Figure 2 The graph in G is a liquid-phase suspension chip that confirms that TPI1 knockdown induces the secretion of multiple SASPs; Figure 2 The middle H figure is an ELISA-verified image showing increased IL6 / IL8 / TNF secretion after TPI1 knockdown;

[0029] Figure 3 This is a diagram illustrating the effect of TPI1 knockdown on senescence in various tumor cells, as provided in an embodiment of the present invention. Figure 3 The image in section A shows the high expression of TPI1 in various tumors. Figure 3 Figure B is a Western blot diagram verifying that TPI1 knockdown induces upregulation of p-γH2AX-P53-P21 and downregulation of LMNB1. Figure 3 The middle C figure is a graph demonstrating that EdU's TPI1 knockdown inhibits cell proliferation. Figure 3 The image in diagram D is an ELISA-verified image showing increased IL6 / IL8 / TNF secretion after TPI1 knockdown. Figure 3 The image shows the results of staining for aging-related β-galactosidase to verify TPI1 knockdown and upregulation of β-galactosidase activity, and flow cytometry to verify TPI1 knockdown-induced reactive oxygen species production. Figure 3 The middle F plot is a pan-cancer overall survival data from TCGA, suggesting that high TPI1 expression is associated with a poor prognosis. Detailed Implementation

[0030] The technical solution of the present invention will now be described with reference to the accompanying drawings.

[0031] In embodiments of the present invention, words such as "exemplarily," "for example," etc., are used to indicate that something is an example, illustration, or description. Any embodiment or design described as "exemplary" in the present invention should not be construed as being more preferred or advantageous than other embodiments or designs. Specifically, the use of the word "exemplary" is intended to present the concept in a concrete manner. Furthermore, in embodiments of the present invention, the meaning expressed by "and / or" can be both, or either one.

[0032] TPI1 (triose phosphate isomerase 1) is a key enzyme in glycolysis, catalyzing the interconversion of dihydroxyacetone phosphate (DHAP) and glyceraldehyde-3-phosphate (GAP). Under physiological conditions, it unidirectionally catalyzes the conversion of DHAP to GAP. It is significantly highly expressed in various tumors, including lung adenocarcinoma, breast cancer, gastric cancer, and pancreatic cancer, and is closely associated with poor prognosis. Currently, research on the direct involvement of TPI1 in cellular senescence is very limited.

[0033] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.

[0034] Unless otherwise specified, the experimental methods described in the following embodiments are conventional experimental methods well known to those skilled in the art, and are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Where specific conditions are not specified in the experimental methods, they are generally operated under conventional conditions.

[0035] Unless otherwise specified, all materials and reagents described in the following examples are commercially available.

[0036] Example 1: Construction of a Lentiviral-Mediated TPI1 Gene Knockdown System

[0037] 1.1 shRNA Design and Vector Construction

[0038] For the human TPI1 gene (NCBI Gene ID: 7167), targeting specific sequences:

[0039] TGATGTGGATGGCTTCCTTGT (SEQ ID No. 1); and

[0040] CTCAGAGAGAAGGCATGTCTT (SEQ ID No. 2);

[0041] Design short hairpin RNA (shRNA). The sequence of the shRNA is shown below:

[0042] First shRNA introductory sequence:

[0043] CCGGTGATGTGGATGGCTTCCTTGTCTCGAGACAAGGAAGCCATCCACATCATTTTTG (SEQ ID No. 3).

[0044] Backquote sequence:

[0045] AATTCAAAAATGATGTGGATGGCTTCCTTGTCTCGAGACAAGGAAGCCATCCACATCA (SEQ ID No. 4).

[0046] The second shRNA introductory sequence:

[0047] CCGGCTCAGAGAGAAGGCATGTCTTCTCGAGAAGACATGCCTTCTCTCTGAGTTTTTG (SEQ ID No. 5).

[0048] Backquote sequence:

[0049] AATTCAAAAACTCAGAGAGAAGGCATGTCTTCTCGAGAAGACATGCCTTCTCTCTGAG (SEQ ID No. 6).

[0050] The designed shRNA oligonucleotides were annealed to form double-stranded DNA, which was then cloned into the AgeI / EcoRI restriction sites of the lentiviral expression vector pLKO.1-puro (Addgene) and placed under the regulation of the U6 promoter. Simultaneously, a control vector containing a meaningless scramble shRNA sequence was constructed. This vector contained a puromycin resistance gene for screening.

[0051] 1.2 Lentiviral Packaging, Concentration, and Titer Determination

[0052] The recombinant plasmid, along with the packaging plasmid psPAX2 (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) and the envelope plasmid pMD2.G (purchased from Wuhan Miaoling Biotechnology Co., Ltd.), were co-transfected into HEK 293T cells (purchased from the Cell Bank of the Chinese Academy of Sciences) at a mass ratio of 4:3:1. The culture medium was replaced with the appropriate medium 6 hours after transfection, and the supernatant containing virus particles was collected at 48 and 72 hours. After filtration through a 0.45 μm filter membrane, the virus was concentrated by ultracentrifugation (50,000 × g, 4℃, 2 hours).

[0053] 1.3 Tumor cell transfection and stable line selection

[0054] Renal cell carcinoma cell lines (A498, OS-RC-2), prostate cancer cell line (C4-2), lung cancer cell line (A549), and bladder cancer cell line (T24) were divided into groups of 1×10⁻⁶ cells. 5Cells were seeded at a density of 70%-80% confluence in 6-well plates. The cell lines were purchased from the Cell Bank of the Chinese Academy of Sciences. Lentiviral solution containing 8 μg / mL polybrene was added, and the medium was replaced with complete medium 12-16 hours after infection. Puromycin (1-3 μg / mL) was added 72 hours after infection for selection. The medium was changed every 2-3 days, and selection was continued for 7-14 days until all control cells died. The knockdown efficiency of the stable strains obtained was verified by Western blot.

[0055] Experimental results:

[0056] See the experimental results. Figure 1 China B and Figure 3 B. From Figure 1 China B and Figure 3 As can be seen from Figure B, the corresponding TPI1 knockdown cell line was successfully constructed.

[0057] Example 2: Cell proliferation capacity detection

[0058] 2.1 CCK-8 cell viability assay

[0059] The TPI1 knockdown stable cell line constructed in Example 1 and its control cells were digested with trypsin to prepare a single-cell suspension. The suspension was prepared at a ratio of 2 × 10⁻⁶ cells / cells. 3 -5×10 3 Cells were seeded at a density of 100 μL of complete culture medium per well into 96-well plates, with 5-6 replicates per group. The plates were incubated at 37°C in a 5% CO2 incubator, and assays were performed at 0, 24, 48, 72, 96, and 120 hours post-seeding. For assays, 10 μL of CCK-8 reagent (Cell Counting Kit-8, Dojindo) was added to each well, and incubation continued for 2 hours. Absorbance was measured at 450 nm (reference wavelength 650 nm) using a microplate reader. Cell viability was calculated as: (Experimental group absorbance - Blank control absorbance) / (Control group absorbance - Blank control absorbance) × 100%. Experiments were independently repeated at least three times. Results are expressed as mean ± standard deviation and statistically analyzed using Students' t-test or ANOVA.

[0060] 2.2 EdU cell DNA replication detection

[0061] The TPI1 knockdown group and the control group were divided into groups of 1×10. 4 -2×10 4Cells were seeded at a density of 10-50 μM into 48-well plates and cultured to 60-70% confluence. EdU (5-ethynyl-2'-deoxyuridine) working solution was added to a final concentration, and the cells were cultured for another 2 hours. The culture medium was discarded, and the cells were fixed with 4% paraformaldehyde for 30 minutes and permeabilized with 0.3% Triton X-100 for 10 minutes. A click chemistry reaction was performed according to the EdU detection kit (RiboBio) instructions: an azide reaction solution labeled with Alexa Fluor 594 was added, and the cells were incubated in the dark for 30 minutes. Cells were then washed three times with 1×PBS, and nuclear staining was performed with 1 μg / mL DAPI dye for 10 minutes. Images were acquired using a fluorescence microscope or a high-content imaging system, and 5-10 fields of view were randomly selected to count the number of EdU-positive cells and the total number of cells. Cell proliferation rate = (Number of EdU-positive cells / Total number of DAPI-positive cells) × 100%. Each experiment was repeated at least three times.

[0062] 2.3 Plate colony formation experiment

[0063] The TPI1 knockdown stable cell line constructed in Example 1 and its control cells were digested with trypsin to prepare a single-cell suspension. Cells were counted using an automated cell counter to ensure cell viability >95%. The suspension was prepared at a concentration of 1×10⁻⁶ cells / cells. 3 Seed cells at a density of 2 mL of complete culture medium per well into 6-well plates. Gently agitate the plate to evenly disperse the cells. Incubate the plates at 37°C with 5% CO2 for 10–14 days, changing the medium every 3 days and observing cell growth to prevent the medium from drying out. Stop culture when visible clones (generally containing more than 50 cells) appear in the plate. Discard the culture medium, gently wash the cells twice with 1×PBS, fix with 4% paraformaldehyde for 30 minutes, discard the fixative, and stain with 0.1% crystal violet at room temperature for 15–30 minutes. Slowly rinse the plate with running water to remove unbound dye and allow it to air dry. Image the plate using a digital camera or scanner.

[0064] Experimental results:

[0065] See the experimental results. Figure 1 C, D, E and Figure 3 C. From Figure 1 C, D, E and Figure 3 As can be seen from the data in the C-cell model, after TPI1 knockdown, cell viability, EDU positivity rate, and colony formation ability decreased in the corresponding cell lines, and proliferation capacity was impaired.

[0066] The above results indicate that TPI1 knockdown impairs cell viability and slows cell proliferation.

[0067] Example 3: Construction of a mouse subcutaneous xenograft model

[0068] 3.1 Laboratory Animals and Ethics

[0069] Six-week-old male BALB / c nude mice weighing 18-22 g (available from Yaokang Biotechnology Co., Ltd.) were selected and housed in an SPF-grade barrier environment (temperature 22-25℃, humidity 50%-60%, 12-hour diurnal cycle). All animal experiments were approved by the institution's animal ethics committee and conducted in accordance with the 3R principle for laboratory animals.

[0070] 3.2 Preparation of cell suspension

[0071] Tumor cells from the TPI1 knockdown group and control group in logarithmic growth phase were digested with trypsin and washed three times with sterile PBS or physiological saline. After centrifugation, the cells were resuspended in sterile PBS and the cell concentration was adjusted to 1×10⁻⁶. 7 -2×10 7 Cells / mL, preferably 1×10 7 Cells / mL. Place the cell suspension on ice and inject over 1 hour.

[0072] 3.3 Subcutaneous injection and tumor formation observation

[0073] The skin on the right back of the mice was disinfected with 75% ethanol, and 100 μL of the above cell suspension was subcutaneously injected using a 1 mL sterile syringe. After injection, the injection site was gently pressed for 10-15 seconds to prevent cell leakage. The mice were randomly divided into 3 groups (n≥5 / group): control group, TPI1 knockdown #1 group, and TPI1 knockdown #2 group. Four weeks later, the mice were humanely euthanized by cervical dislocation, and the tumor tissue was dissected, weighed, and photographed for recording.

[0074] 3.4 Histopathological analysis of tumor tissue

[0075] A portion of the excised tumor tissue was fixed in 4% paraformaldehyde or 10% neutral formalin solution for 48 hours. After dehydration with graded ethanol and clearing with xylene, it was embedded in paraffin. Serial sections with a thickness of 4-5 μm were prepared for subsequent immunohistochemistry and immunofluorescence detection.

[0076] Experimental results:

[0077] See the experimental results. Figure 1 Middle F. From Figure 1 As can be seen from the data in the middle F, the growth of subcutaneous tumors slowed down after TPI1 knockdown.

[0078] The above results indicate that TPI1 knockdown leads to slow growth of xenograft tumors.

[0079] Example 4 Immunohistochemical staining

[0080] 4.1 Tissue section pretreatment

[0081] Paraffin-embedded tumor tissue sections were baked in a 60°C oven for 60 minutes, then dewaxed twice in xylene for 10 minutes each, followed by hydration with a gradient of ethanol (100%, 95%, 85%, 70%) for 5 minutes each. The sections were then placed in 0.01 M sodium citrate buffer (pH 6.0) and subjected to antigen retrieval using microwave heating (95-98°C, 15-20 minutes). After naturally cooling to room temperature, the sections were washed three times with PBS for 5 minutes each time.

[0082] 4.2 Antibody incubation and color development

[0083] Block with 10% normal goat serum (same species as the secondary antibody) for 60 minutes at room temperature to eliminate nonspecific binding. After blocking, discard the blocking solution and add diluted primary antibody working solution (rabbit anti-human TPI1 antibody, 1:200 dilution), incubate overnight at 4°C. The next day, wash three times with PBS, add horseradish peroxidase (HRP)-labeled secondary antibody (goat anti-rabbit IgG, 1:1000 dilution), and incubate at room temperature for 60 minutes. After washing again with PBS, add freshly prepared DAB chromogenic solution (3,3'-diaminobenzidine), and observe the color development under a microscope. Positive signals appear brownish-yellow or brownish-red. The color development time should be controlled between 1 and 10 minutes. Terminate the color development reaction with distilled water.

[0084] 4.3 Counterstaining, dehydration and mounting

[0085] After staining, the sections are immersed in hematoxylin staining solution for nuclear counterstaining for 1-3 minutes, followed by rapid differentiation with 1% hydrochloric acid-alcohol differentiation solution (1-3 seconds), and then blued with tap water for 5-10 minutes. The sections are then dehydrated by gradient ethanol (70%, 85%, 95%, 100%) for 5 minutes each, and cleared with xylene for 10 minutes twice. A suitable amount of neutral resin is added, and the sections are mounted with coverslips. After drying in a fume hood, the sections are observed and images are acquired under an optical microscope.

[0086] Experimental results:

[0087] See the experimental results. Figure 1 A and G in the middle. From Figure 1 As can be seen from Figure A, TPI1 expression in tumor tissue is higher than in adjacent normal tissue. From... Figure 1 As can be seen from the data, the Ki67 positivity rate is low and the proliferation is slow in subcutaneous tumors with TPI1 knockdown.

[0088] Example 5: Validation of tumor cell senescence phenotype

[0089] 5.1 SA-β-gal senescence staining

[0090] TPI1 knockdown group and control group cells were seeded into 6-well plates and cultured to 80%-90% confluence. The culture medium was discarded, and the cells were washed twice with PBS, then fixed with β-galactosidase fixative for 15 minutes. After rinsing with PBS, 1 mL of freshly prepared SA-β-gal staining working solution (containing 1 mg / mL X-gal, pH 6.0) was added to each well, and the cells were incubated overnight at 37°C (12-16 hours, CO2-free). Cells were observed and photographed under a light microscope; senescent cells appeared blue-green.

[0091] 5.2 Western blot detection of aging biomarkers

[0092] Total protein was extracted from cells, and protein concentration was determined by the BCA method. 30 μg of protein was subjected to SDS-PAGE electrophoresis, transferred to a PVDF membrane, and blocked with 5% skim milk powder for 1 hour. The membrane was then incubated with antibodies against TPI1, P21, p-H2AX, LMNB1, P53, and the internal control β-actin overnight at 4°C. The following day, after incubation with secondary antibody (HRP-labeled, 1:5000), the membrane was developed using ECL chemiluminescence.

[0093] 5.3 Cell immunofluorescence detection

[0094] The TPI1 knockdown group and the control group were divided into groups of 2×10. 4 -5×10 4 Cells were seeded at a density of 60%-70% confluence in 24-well plates containing cell spreaders. The culture medium was discarded, and the cells were washed three times with PBS, fixed with 4% paraformaldehyde at room temperature for 15 minutes, permeabilized with 0.3% Triton X-100 at room temperature for 10 minutes, and blocked with 5% BSA at room temperature for 30 minutes. Primary antibody (1:200-1:500 dilution) was added, and the cells were incubated overnight in a humidified chamber at 4°C. The next day, the cells were washed three times with PBS, and fluorescent secondary antibody (Alexa Fluor 594 labeled, 1:500 dilution) was added and incubated at room temperature in the dark for 1 hour. After washing with PBS, 1 μg / mL DAPI staining solution was added and incubated at room temperature in the dark for 10 minutes for nuclear staining. The cells were mounted with anti-fluorescence quenching mounting medium, and images were acquired using a laser confocal microscope (Zeiss LSM 880).

[0095] 5.4 Detection of Reactive Oxygen Species in Cells and Cell Cycle

[0096] Cells from the TPI1 knockdown group and the control group were seeded in 6-well plates and cultured to the logarithmic growth phase. For reactive oxygen species (ROS) detection, 1×10⁻⁶ cells were collected. 6Cells were washed with serum-free medium, and then incubated with DCFH-DA probe at a final concentration of 10 μM at 37°C in the dark for 30 minutes. Cells were washed three times with PBS to remove any probe that had not entered the cells. Fluorescence intensity was detected using a flow cytometer (BD FACSCanto II) at an excitation wavelength of 488 nm and an emission wavelength of 525 nm. For cell cycle analysis, cells were collected, washed with pre-cooled PBS, fixed overnight with 70% ice-cold ethanol at 4°C, and centrifuged the next day to remove the fixative. Staining solution containing 50 μg / mL propidium iodide (PI) and 100 μg / mL RNase A was added, and the cells were incubated at room temperature in the dark for 30 minutes. DNA content was detected using a flow cytometer at an excitation wavelength of 488 nm and an emission wavelength of 617 nm. The proportions of cells in G0 / G1, S, and G2 / M phases were calculated using ModFit LT software.

[0097] 5.5 Detection of Age-Related Secretory Phenotypes (SASP) using Liquid-Phase Suspension Chip

[0098] The TPI1 knockdown group and the control group were divided into groups of 1×10. 5 -5×10 5 After seeding cells at a density of 24-48 mL and culturing for 24-48 hours, the medium was replaced with serum-free medium and cultured for another 12-24 hours. The culture supernatant was collected and centrifuged at 500 × g for 10 minutes at 4°C to remove cell debris. In a 96-well plate, 50 μL of a microsphere suspension containing 2500 fluorescently encoded magnetic beads (covalently coupled to anti-cytokine capture antibody) was added to each well. Then, 50 μL of diluted cell supernatant or serially concentrated standards were added. The plate was incubated at 800 r / min for 60 minutes at room temperature to allow the microspheres to capture target cytokines. The plate was placed on a magnetic rack and magnetically aspirated for 2 minutes, then the supernatant was discarded. After washing three times with PBST, 25 μL of a biotin-labeled detection antibody mixture was added to each well. The plate was incubated at room temperature with shaking for 30 minutes, followed by three magnetic washes. Then, 50 μL of streptavidin-phycoerythrin working solution was added, and the plate was incubated in the dark for 15 minutes, followed by three magnetic washes. Finally, 150 μL of analysis buffer was added to each well to resuspend the microspheres. Luminex 20 was used. TM Alternatively, the Bio-Plex system uses a 635nm laser to identify the microsphere code and a 532nm laser to detect the PE fluorescence signal. At least 50 events are read for each type of microsphere. The concentration of each cytokine in the cell supernatant is automatically calculated (pg / mL) by fitting the relationship between the concentration of the standard and the fluorescence intensity through a five-parameter logistic curve.

[0099] 5.6 Cytokine ELISA Detection

[0100] The TPI1 knockdown group and the control group were divided into groups of 1×10. 5 -2×10 5Cells were seeded at a density of 6-well plates and cultured to the logarithmic growth phase. The cell culture supernatant was collected by centrifugation, centrifuged at 3000 rpm for 10 minutes at 4°C to remove cell debris, aliquoted, and stored at -80°C or immediately for detection. Cytokine concentrations were detected using a double-antibody sandwich ELISA kit (Human IL-6 / IL-8 / TNF-α ELISA Kit): Standards were serially diluted according to the instructions, and samples were appropriately diluted and added to 96-well plates pre-coated with cytokine-specific antibodies, incubated at room temperature for 2 hours; after washing, biotin-labeled detection antibodies were added, and incubated at room temperature for 1 hour; after washing, HRP-labeled streptavidin was added, and incubated at room temperature for 30 minutes; TMB chromogenic solution was used for color development at room temperature in the dark for 15-20 minutes, and the reaction was terminated by adding stop solution. The absorbance at 450 nm was measured using a microplate reader, and the concentrations (pg / mL) of IL-6, IL-8, and TNF-α in the samples were calculated based on the standard curve. Each group had 3 replicates, and the experiment was independently repeated 3 times. The results are expressed as mean ± standard deviation, and statistical analysis was performed using Student's t-test or ANOVA.

[0101] Experimental results:

[0102] See the experimental results. Figure 2 B to H and Figure 3 From B to E. Figure 2 China B and Figure 3 As can be seen from E, TPI1 knockdown increased the positive rate of SA-β-gal senescence staining in the corresponding cell lines. Figure 2 C and Figure 3 As can be seen from Figure B, after TPI1 knockdown, cellular senescence markers such as P21, p-H2AX, LMNB1, and P53 increased in the corresponding cell lines. Figure 2 As can be seen from the data in the middle D, after TPI1 knockdown, the expression levels of MMP3, IL6, HMGB1, and p-H2AX increased. From... Figure 2 As can be seen in E and F, TPI1 knockdown increased reactive oxygen species and arrested the cell cycle in the G1 phase. Figure 2 G, H and Figure 3 As can be seen from D, TPI1 knockdown induces the corresponding cell lines to secrete SASP.

[0103] The above results indicate that TPI1 knockdown induces tumor cell senescence.

[0104] Example 6 Bioinformatics Analysis

[0105] 6.1 Transcriptome differential expression and functional enrichment analysis

[0106] Total RNA samples were collected from TPI1 knockdown group and control group cells (or tumor tissues). After quality control, cDNA libraries were constructed for high-throughput sequencing (RNA-seq). FastQC was used for raw data quality control, Trimmomatic was used to remove adapter sequences and low-quality reads, Hisat2 was used to align clean reads to the human reference genome (GRCh38), and FeatureCounts was used to calculate the read count for each gene. Based on the obtained RNA-seq expression profile data, gene set enrichment analysis was performed using GSEA software (v4.3.0, Broad Institute). First, all genes output by DESeq2 were sorted in descending order according to log2 FoldChange value to construct a ranked gene list. Hallmark gene sets (h.all.v2023.1.symbols.gmt) and KEGG gene sets (c2.cp.kegg.v2023.1.symbols.gmt) were downloaded from the MSigDB database (v2023.1) as reference gene sets. Parameter settings: 1000 permutation tests, weighted enrichment statistic, gene set size limited to 15-500 genes. Calculate the normalized enrichment score (NES) for each gene set.

[0107] 6.2 Expression profile and survival analysis in pan-cancer tissues

[0108] The expression characteristics of TPI1 in pan-cancer was analyzed using the GEPIA2 (http: / / gepia2.cancer-pku.cn / ) database system. GEPIA2 was used to integrate TCGA and GTEx data to obtain differential expression box plots and expression profile-overall survival plots between TCGA tumor types and paired normal tissues.

[0109] Experimental results:

[0110] See the experimental results. Figure 2 China A and Figure 3 A and F in the middle. From Figure 2 As shown in Figure A, TPI1 knockdown transcriptomics exhibits multiple characteristics of cellular senescence, such as SASP secretion, activation of inflammatory signaling pathways, and cell cycle inhibition. From... Figure 3 As can be seen from A and F, TPI1 is highly expressed in a variety of tumors, and high TPI1 expression is associated with a poor prognosis in pan-cancer.

[0111] The above results indicate that TPI1 is associated with cellular senescence and is highly expressed in pan-cancer cells with poor prognosis.

[0112] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. Application of reagents that inhibit TPI1 gene expression or TPI1 protein activity in the preparation of drugs for treating tumors.

2. The application according to claim 1, characterized in that, The tumors include: kidney cancer, prostate cancer, lung cancer, and / or bladder cancer.

3. The application according to claim 1, characterized in that, The reagent treats tumors by inducing cellular senescence.

4. A shRNA for knocking down the TPI1 gene, characterized in that, The sequence of the shRNA is shown in SEQ ID No. 3 and SEQ ID No. 4, or the sequence of the shRNA is shown in SEQ ID No. 5 and SEQ ID No.

6.

5. An expression vector, lentivirus, and / or cell containing the sequence of the shRNA according to claim 4.

6. The expression vector, lentivirus, and / or cell according to claim 5, characterized in that, The expression vector is a lentiviral expression vector; And / or, the lentiviral expression vector is pLKO.1-puro; And / or, the cells are kidney cancer cells, prostate cancer cells, lung cancer cells, and / or bladder cancer cells; And / or, the renal cell carcinomas include A498 and OS-RC-2; And / or, the prostate cancer cells include C4-2; And / or, the lung cancer cells include A549; And / or, the bladder cancer cells include T24.

7. A pharmaceutical composition for treating tumors, characterized in that, The pharmaceutical composition includes: a reagent that inhibits TPI1 gene expression or TPI1 protein activity.

8. The pharmaceutical composition according to claim 7, characterized in that, The tumors include: kidney cancer, prostate cancer, lung cancer, and / or bladder cancer.

9. The pharmaceutical composition according to claim 7, characterized in that, The reagent treats tumors by inducing cellular senescence.

Images