Use of agents that modulate the creld1 gene in reducing pain or itching or neuroprotection and systems

Abstract

The present invention relates to the use of agents that modulate the Creld1 gene in reducing pain or itch or neuroprotection and systems, in particular the use of agents that inhibit or enhance the Creld1 gene and its expression products in pain, itch, and neuroprotection. The present invention reduces pain or itch and slows the recovery process of nerve damage in the body by inhibiting the expression of the Creld1 gene; enhances the sensitivity of the subject to acute pain and speeds up the repair after nerve damage by promoting the expression of the Creld1 gene; and determines whether the subject is sensitive or not to pain and / or itch by determining the expression level of the Creld1 gene in the subject.

Description

Technical Field

[0001] This invention relates to the field of medicine, and more specifically, to the application of agents that inhibit or enhance the Creld1 gene and its expression products in the treatment of pain, itching, and neuroprotection. Background Technology

[0002] Pain and itching have a significant impact on human quality of life. Pain is defined as an unpleasant sensory and emotional experience associated with actual or potential tissue damage. Pain has various types, and can be categorized by duration as acute or chronic pain. In mice, the administration of noxious compounds, temperature, and mechanical stimulation is commonly used for acute pain research, while chemically induced (e.g., capsaicin injection) inflammatory pain models and sciatic nerve injury models are used for chronic pain research. Pain management costs in the United States exceed $600 billion annually, and widely used opioid analgesics have serious side effects such as addiction, tolerance, and respiratory depression. Opioid abuse and addiction have caused an opioid crisis in American society. Therefore, the development of non-opioid analgesics has significant academic and economic value.

[0003] Itching is an unpleasant sensation that triggers the urge to scratch, encompassing sensory, emotional, and motivational components. Itching is an important protective mechanism, allowing animals to detect harmful substances invading the skin and remove them through scratching. Scratching behavior is driven by strong emotions and motivations, sometimes producing pleasure, thus leading to an itch-scratch cycle. Based on peripheral input, itching can be classified as mechanical or chemical. Chemical itch can be further divided into histamine-dependent and histamine-independent types based on the response to antihistamines. For patients with chronic pruritus, this itch-scratch cycle can lead to severe skin damage, imposing a significant economic burden and psychological stress.

[0004] The molecular mechanisms of nerve injury are complex processes involving multiple cellular and molecular pathways. Currently reported mechanisms influencing nerve injury recovery include: myelin regeneration, inflammatory responses, apoptosis and necrosis, axonal degeneration and regeneration, neurotrophic factors, and glial cell responses.

[0005] Dorsal root ganglion neurons play a crucial role in somatosensory perception, including pain and itching. These neurons exhibit pseudounipolarity, with their fiber terminals extending into the skin to sense external stimuli such as compounds, temperature, and touch. These stimuli are transmitted as action potentials to the spinal cord, which they connect to at the other end, and then ascend to the brain, forming sensations such as touch, pain, and itch. Damage to dorsal root ganglion neurons can cause somatosensory abnormalities, including pain sensitization or anesthesia.

[0006] The Creld1 gene, short for Cysteine ​​Rich With EGF Like Domains 1, is a membrane protein gene located in the endoplasmic reticulum and cell membrane. Mutations in the Creld1 gene are associated with atrial ventricular septal defect (AVSD) in humans. Currently, the Creld1 gene has been shown to have the following functions: regulating the proliferation of endocardial cushion mesenchymal cells, maintaining immune homeostasis, intervening in mouse brain development, and affecting the locomotion of nematodes and fruit flies. Given the high expression of Creld1 protein in dorsal root ganglion neurons and its important role in physiological and pathological conditions, there are currently no reports on the effects of Creld1 on pain, itching, or nerve damage repair. Summary of the Invention

[0007] The present invention relates to the effects of the Creld1 gene on pain, itching, and nerve damage, thereby providing a drug for treating pain, itching, and nerve damage by utilizing agents that regulate Creld1 gene expression.

[0008] Specifically, a first aspect of the present invention provides the use of a reagent in the preparation of a medicament for reducing pain or itching, said reagent inhibiting Creld1 gene expression or reducing the activity of Creld1 gene expression protein.

[0009] In one embodiment of the first aspect of the present invention, the reagent is an interfering RNA, microRNA, siRNA, or aptamer that inhibits the expression of the Creld1 gene.

[0010] In one embodiment of the first aspect of the invention, the reagent is required for a CRISPR-Cas9 system that knocks out or knocks down the Creld1 gene using Creld1 sgRNA.

[0011] In one embodiment of the first aspect of the invention, the reagent is required for the Cre-LoxP system that knocks out or knocks down the Creld1 gene.

[0012] In one embodiment of the first aspect of the present invention, the Cre-LoxP system adds LoxP sites on both sides of the knockout or knockdown region formed by exons 3 and 4 of the Creld1 gene, and induces Cre enzyme expression through tamoxifen.

[0013] In one embodiment of the first aspect of the present invention, the reagent is an antibody that reduces the expression of the Creld1 gene protein.

[0014] In one embodiment of the first aspect of the present invention, the antibody is a single-chain antibody.

[0015] A second aspect of the invention provides the use of a reagent in the preparation of a medicament for repairing nerve damage, said reagent promoting Creld1 gene expression or increasing the activity of Creld1 gene expression protein.

[0016] In one embodiment of the second aspect of the present invention, the reagent is a vector carrying the Creld1 gene.

[0017] In one embodiment of the second aspect of the present invention, the vector is a viral vector carrying the Creld1 gene.

[0018] A third aspect of the present invention provides the use of a reagent for detecting Creld1 gene expression levels in the preparation of a kit for diagnosing the sensitivity of a subject to pain and / or pruritus, the reagent being used to determine the Creld1 gene expression level in a subject, wherein the subject is identified as sensitive to pain and / or pruritus when the Creld1 gene expression level in the subject is above the upper limit of a reference range; and the subject is identified as insensitive to pain and / or pruritus when the Creld1 gene expression level in the subject is below the lower limit of a reference range.

[0019] In one embodiment of the third aspect of the invention, the reference range is obtained by testing the general population.

[0020] A fourth aspect of the invention provides a system for screening drugs for treating pain and / or itching, the system being used as a drug for treating pain and / or itching by identifying agents that inhibit Creld1 gene expression levels or reduce Creld1 gene protein expression.

[0021] A fifth aspect of the invention provides a system for screening drugs for repairing nerve damage, the system being used as a drug for repairing nerve damage by identifying agents that promote Creld1 gene expression levels or increase Creld1 gene protein expression.

[0022] Beneficial effects:

[0023] This invention regulates Creld1-mediated pain and itching by knocking out or reducing Creld1 protein in dorsal root ganglion neurons using, for example, the CRISPR-Cas9 system, the Cre-LoxP system, or other reagents that inhibit Creld1 gene expression or reduce Creld1 gene expression protein activity.

[0024] This invention utilizes protein overexpression vectors such as AAV to achieve overexpression of Creld1 protein in dorsal root ganglion neurons, thereby regulating Creld1-mediated nerve damage repair function.

[0025] Based on the findings of this invention regarding the effects of the Creld1 gene on pain, itch, and nerve damage, the reagents described in this invention can identify individuals who are sensitive to pain and / or itch, and those who are insensitive to pain and / or itch, by determining the Creld1 gene expression level in the subjects. Attached Figure Description

[0026] Figure 1 This is a graph showing acute pain detection in sgCreld1 conditional knockout mice.

[0027] Figure 2 A is a schematic diagram of the construction of conditional knockout mice. Figure 2 B is the result of rat tail identification;

[0028] Figure 3 This is an immunofluorescence staining image of dorsal root ganglion neurons;

[0029] Figure 4 A is the cold plate behavioral test chart of conditional knockout mice. Figure 4 B is the hot plate behavioral test diagram of conditional knockout mice;

[0030] Figure 5 A is a behavioral assessment graph of conditional knockout mice in a capsaicin-induced inflammatory pain model. Figure 5 B is a pain detection graph in a conditional knockout mouse model of neural injury.

[0031] Figure 6 A is a graph showing the itch behavior of conditional knockout mice after injection of histamine. Figure 6 Figure B is a graph showing the itch behavior of conditional knockout mice after injection of chloroquine. Figure 6 C is a graph showing the itch behavior of conditional knockout mice after injection of compound 48 / 80;

[0032] Figure 7 A is a cold plate behavioral test image of mice injected with AAV virus. Figure 7 B is a hot plate behavioral test image of mice injected with AAV virus;

[0033] Figure 8 This is a pain detection graph in mice injected with AAV virus in a neurological injury model. Detailed Implementation

[0034] In the application of the preparation of a medicament for reducing pain or itching as described in the first aspect of the present invention, the agent for inhibiting Creld1 gene expression can be any agent capable of inhibiting Creld1 gene expression, such as interfering RNA, microRNA, siRNA, and aptamers that inhibit Creld1 gene expression.

[0035] In a preferred exemplary embodiment, specific knockout or knockdown of the Creld1 gene in dorsal root ganglion neurons inhibits acute pain.

[0036] In a preferred exemplary embodiment, specific knockout or knockdown of the Creld1 gene in dorsal root ganglion neurons inhibits chronic pain.

[0037] In a preferred exemplary embodiment, the agent that inhibits Creld1 gene expression reduces Creld1 gene expression by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, and 90%.

[0038] In a preferred exemplary embodiment, the agent for inhibiting Creld1 gene expression is the same as that required by a CRISPR-Cas9 system that knocks out or down the Creld1 gene using Creld1 sgRNA. In a preferred exemplary embodiment, the CRISPR-Cas9 system reduces Creld1 gene expression by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, and 90%.

[0039] In a preferred exemplary embodiment, the agent that inhibits Creld1 gene expression is the agent required for the Cre-LoxP system that knocks out or down the Creld1 gene. In a preferred exemplary embodiment, the Cre-LoxP system reduces Creld1 gene expression by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, and 90%.

[0040] In a preferred exemplary embodiment, the present invention employs the following method to specifically knock out or knock down the Creld1 gene in dorsal root ganglion neurons: injecting a vector containing Creld1 sgRNA, such as an adenovirus containing Creld1 sgRNA, and using a CRISPR-Cas9 system to specifically knock out or knock down the Creld1 gene in dorsal root ganglion neurons.

[0041] In a preferred exemplary embodiment, the sequence of Creld1 sgRNA is as follows:

[0042] sgRNA1:TTCCACCCCCGAAGTTGTCC (SEQ ID No.:1);

[0043] sgRNA2: CCGCCTGCTCGAGCTGAGCG (SEQ ID No.: 2);

[0044] sgRNA3: AAGCCCCCGACCTCTTCCAG (SEQ ID No.: 3);

[0045] sgRNA4:ACAGGCCTCCGCCCCATAGC(SEQ ID No.:4);

[0046] sgRNA5: TGTACTCAGTGAGACCCGCC (SEQ ID No.: 5).

[0047] In a preferred exemplary embodiment, the present invention employs the following method to specifically knock out the Creld1 gene in dorsal root ganglion neurons: The Cre-LoxP system is used to specifically knock out the Creld1 gene in dorsal root ganglion neurons. The Creld1 gene has 10 exons; the ATG promoter is located in exon 1, the TAA stop codon is located in exon 10, and exons 3 and 4 are the knockout regions. Deletion of these exons results in a frameshift mutation, silencing the Creld1 gene.

[0048] In a preferred exemplary embodiment, the Cre-LoxP system adds LoxP sites on both sides of the knockout region formed by exons 3 and 4 of the Creld1 gene, and induces the expression of Cre enzyme through it.

[0049] For example, in a preferred exemplary embodiment, LoxP sites are added on both sides of the knockout region sequence, and the mice are bred with Advillin-CreERT2 mice to obtain Creld1. fl / fl and Creld1 fl / fl Advillin-CreERT2 genotype mice were injected with tamoxifen to induce Cre enzyme expression, thereby achieving specific knockout of the Creld1 gene in dorsal root ganglion neurons. Conditional knockout mice with specific Creld1 gene knockout in dorsal root ganglion neurons produced by this method can avoid the impact of Creld1 gene knockout on development.

[0050] Based on the above-mentioned conditional knockout subjects, such as mice, the inventors used a tactile-related behavioral paradigm to test these subjects, such as mice. They found that conditional knockout subjects, such as mice, responded significantly more strongly than wild-type subjects, such as mice, in acute pain models of cold and hot plates, capsaicin-induced inflammatory pain and chronic pain models of nerve damage, and three pruritus models including histamine, chloroquine, and the 48 / 80 compound. Specific deletion of the Creld1 gene in dorsal root ganglion neurons can inhibit pain and pruritus.

[0051] In the application of the preparation of a medicament for reducing pain or itching as described in the first aspect of the invention, the agent for reducing the activity of Creld1 gene expression protein can be an actual substance that specifically binds to Creld1 gene expression protein, such as an antibody that binds to Creld1 gene expression protein.

[0052] In a preferred exemplary embodiment, the agent for reducing the activity of Creld1 gene expression protein reduces the activity of Creld1 gene expression protein by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, and 90%.

[0053] In a preferred exemplary embodiment, the antibody is a single-chain antibody, or an antibody that effectively binds to a fragment of the Creld1 gene-expressed protein.

[0054] The term "fraction of antibody that effectively binds to Creld1 gene expression protein" refers to a portion of an antibody that can bind to the antigen, i.e., the Creld1 gene expression protein. Those skilled in the art will recognize that such a fragment may be, for example, a variable region of the antibody.

[0055] In the application of the preparation of a medicament for repairing nerve damage as described in the second aspect of the present invention, the agent for promoting Creld1 gene expression or increasing the activity of Creld1 gene expression protein is a vector carrying the Creld1 gene.

[0056] In a preferred exemplary embodiment, the vector is a viral vector carrying the Creld1 gene. The viral vector includes, but is not limited to, lentiviral vectors, retroviral vectors, adenovirus vectors, adeno-associated virus vectors, poxvirus vectors, and herpesvirus vectors.

[0057] On the other hand, by injecting AAV-Creld1 adenovirus into the lateral ventricle of subjects, such as mice, overexpressing Creld1 protein in dorsal root ganglion neurons was achieved. Tactile-related behavioral paradigms were also tested on the overexpressing subjects, such as mice. The reaction time and pain recovery in the acute pain behavioral tests on cold and hot plates in the neuropathic pain model were faster in the overexpressing subjects, such as mice, compared to those injected with AAV-GFP adenovirus. Therefore, overexpression of Creld1 protein can enhance pain perception in subjects, such as mice, and accelerate pain recovery in the neuropathic pain model.

[0058] In a preferred exemplary embodiment, the present invention achieves overexpression of AAV-Creld1 adenovirus by injecting the subject, thereby repairing nerves.

[0059] In a preferred exemplary embodiment, nerve repair manifests as accelerated recovery of pain sensation in acute nerve injury pain.

[0060] In a preferred exemplary embodiment, nerve repair manifests as accelerated recovery of pain sensation in chronic nerve injury pain.

[0061] The dosage of the AAV-Creld1 adenovirus used in the lateral ventricle can be 10. 10 Up to 10 15 AAV-Creld1 adenovirus, for example 10 11 Up to 10 14 AAV-Creld1 adenovirus, preferably 10 12 Up to 10 13 10 preferred 13 AAV-Creld1 adenovirus.

[0062] In the application of the third aspect of the invention in the preparation of a kit for diagnosing a subject's sensitivity to pain and / or pruritus, the reagent for detecting Creld1 gene expression level is used to determine the Creld1 gene expression level in the subject. When the Creld1 gene expression level in the subject is higher than the upper limit of the reference range, the subject is determined to be sensitive to pain and / or pruritus; when the Creld1 gene expression level in the subject is lower than the lower limit of the reference range, the subject is determined to be insensitive to pain and / or pruritus.

[0063] In one embodiment of the third aspect of the invention, the reference range is obtained by testing the general population.

[0064] The reference range is a range of values ​​measured for a population that has been identified as neither overly sensitive nor overly insensitive to pain and / or itching.

[0065] For example, it can be described as the mRNA or protein content of Creld1 contained in body fluids, tissues, and cells.

[0066] In a system for screening drugs for treating pain and / or itching in the fourth aspect of the present invention, the system identifies agents that inhibit Creld1 gene expression levels or reduce Creld1 gene protein expression as drugs for treating pain and / or itching.

[0067] In a preferred embodiment, the system can screen for candidate drugs or lead compounds for treating pain and / or itching.

[0068] In a preferred embodiment, the system can screen for effective siRNA sequences for treating pain and / or itching.

[0069] In a preferred embodiment, the system can validate compounds that have been screened through other methods and may have the potential to treat pain and / or itching.

[0070] In a system for screening drugs for repairing nerve damage in a fifth aspect of the invention, the system identifies agents that promote Creld1 gene expression levels or increase Creld1 gene protein expression as drugs for repairing nerve damage.

[0071] In a preferred embodiment, the system can screen for candidate drugs or lead compounds that repair nerve damage.

[0072] In a preferred embodiment, the system can screen for nucleotide sequences effective in repairing nerve damage. These nucleotide sequences may, for example, regulate the function of elements involved in Creld1 gene expression through trans-interactions, such as inhibiting promoter activation.

[0073] In a preferred embodiment, the system can validate compounds that have been screened through other methods and may have the potential to repair nerve damage.

[0074] In other embodiments of the invention, the invention provides a novel function and application of the Creld1 gene relating to pain and itching.

[0075] Based on these potential new functions, the Creld1 gene can be applied in the following aspects:

[0076] 1. Pain Management: Develop novel pain management drugs based on Creld1, which may regulate the transmission of pain signals by inhibiting or activating the expression of this gene.

[0077] 2. Antipruritic treatment: Reduce symptoms of chronic itching by modulating the function of Creld1, especially in itching associated with skin diseases.

[0078] 3. Gene therapy: Utilizing AAV delivery to overexpress Creld1 in vivo, providing a strategy for repairing nerve damage.

[0079] 4. Diagnostic tools: Develop diagnostic tools to detect Creld1 gene expression levels to assess an individual’s sensitivity to pain and itching, thereby enabling personalized treatment management.

[0080] The following detailed embodiments illustrate the implementation process and beneficial effects of the present invention, aiming to help readers better understand the essence and characteristics of the present invention, and are not intended to limit the scope of implementation of this case.

[0081] Example 1

[0082] This example provides the Creld1 sgRNA-related sequence and the guide RNA for injecting Creld1 AAV virus into the lateral ventricle of Cas9 mice, and uses the Cas9-CRISPR method to create Creld1 gene knockout mice in dorsal root ganglion neurons.

[0083] The sequence of Creld1 sgRNA is as follows:

[0084] sgRNA1:TTCCACCCCCGAAGTTGTCC;

[0085] sgRNA2: CCGCCTGCTCGAGCTGAGCG;

[0086] sgRNA3:AAGCCCCCGACCTCTTCCAG;

[0087] sgRNA4:ACAGGCCTCCGCCCCATAGC;

[0088] sgRNA5:TGTACTCAGTGAGACCCGCC.

[0089] The inventors designed five sgRNAs and constructed them on five pAV-U6-spgRNA-CAGmini-GFP vectors. They then created an AAV mixed virus containing five different Creld1 sgRNAs and injected the virus into the lateral ventricle of Cas9 mice two days after birth. The following pain-related behavioral tests were then performed on the eight-week-old male mice.

[0090] (1) Cold plate test

[0091] Two days prior to the test, mice were acclimatized to the instrument by placing them on a temperature-controlled device for 10 minutes at room temperature (25°C). In the actual laboratory setting, the cold plate temperature was 0°C. The time it took for mice to shake their front paws, lick their hind paws, or jump after being placed on the cold plate was observed and recorded. 60 seconds was taken as the maximum value to prevent frostbite. Each mouse was tested three times, with half-hour intervals between tests. The average reaction time was taken as the mouse's cold plate response value. Compared to the control group, AAV-sgCreld1 mice showed a more sluggish response to noxious cold stimuli. Figure 1 (A).

[0092] (2) Hot plate experiment

[0093] Two days prior to the test, mice were acclimatized to the instrument by placing them on a hot plate for 10 minutes at a room temperature of 25°C. During the actual test, the temperature of the test plate was set to 50°C, with a maximum duration of 1 minute, to prevent burns. Mice were gently placed on the test plate, and their behaviors such as hind paw withdrawal, licking of the hind paw, or jumping were observed and recorded as reaction times. Each mouse was tested three times, with half-hour intervals between tests, and the average reaction time was used as the mouse's cold plate response value. Compared to control mice, AAV-sgCreld1 mice showed a more sluggish response to noxious heat stimuli. Figure 1 (B).

[0094] The two animal behavioral tests above demonstrate that specific knockout of the Creld1 gene in dorsal root ganglion neurons inhibits acute pain.

[0095] Example 2

[0096] This example demonstrates the creation of conditional knockout mice with specific knockout of the Creld1 gene in dorsal root ganglion neurons using the Cre-LoxP system.

[0097] (1) The mouse Creld1 gene has the NCBI number NM_133930 and consists of 10 exons. The ATG promoter is located in exon 1, and the TAA stop codon is located in exon 10. Exons 3 and 4 were selected as the knockout region. Deletion of these exons would result in a frameshift mutation, silencing the Creld1 gene. When designing the targeting vector, LoxP sites were added on both sides of the knockout region. The neomycin resistance gene (Neo) was used as a positive selection marker, and self-deletion anchor sites (SDA) were added on both sides of Neo. The diphtheria toxin A subunit (DTA) was selected as a negative selection marker. Figure 2 (A).

[0098] (2) Construct the targeting vector according to the design scheme, and select the correct targeting vector for electroporation of embryonic stem cells. Use polymerase chain reaction and Southern blotting to screen clones with correct loxP insertion to confirm that homologous recombination occurs at the target gene site.

[0099] (3) Selected ES cells were injected into blastocysts to form chimeric embryos. These chimeric embryos were then implanted into pseudopregnant female mice. Chimeric mice were identified by coat color or genotype analysis. These chimeric mice were then mated with wild-type mice to obtain F1 generation mice. The presence of the loxP site in the F1 generation mice was confirmed by polymerase chain reaction (PCR) and Southern blotting. Primers were designed flanking the loxP site, with a WT band of 270 bp and a Flox band of 369 bp. Figure 2 (B).

[0100] (4) Advillin-CreERT2 mice were mated with F1 generation conditional knockout mice to obtain Creld1 mice in F2 generation mice. fl / fl and Creld1 fl / fl Advillin-CreERT2 has two genotypes.

[0101] Example 3

[0102] This example provides the biochemical identification of conditional knockout mice with specific knockout of the Creld1 gene in dorsal root ganglion neurons.

[0103] Experimental materials: two-month-old Creld1 fl / fl and Creld1 fl / fl Advillin-CreERT2 mice were injected three times with tamoxifen at a concentration of 150 mg / kg into both genotypes at a age of 6 weeks or older, and samples were collected 14 days later.

[0104] Experimental reagents: Primary antibodies included Anti-Rabbit TUBB3 and Anti-Goat Creld1; Secondary antibodies included AlexaFluor-647donkey anti-goat secondary antibody and AlexaFluor-568goat anti-rabbit secondary antibody; OCT embedding medium, PBST (Phosphate Buffered Saline with Tween-20), and mounting medium.

[0105] Experimental methods:

[0106] 1. Tissue fixation and preparation of frozen sections

[0107] (1) Anesthetize 1-2 month old mice and decapitate them. Under stereoscopic guidance, remove the dorsal root ganglion tissue, treat it with 4% paraformaldehyde for two hours, then replace it with 30% sucrose solution and treat it at 4°C for more than 12 hours.

[0108] (2) Embedded with OCT reagent, the position of the dorsal root ganglion was adjusted, and the section was quick-frozen at -80℃ before slicing.

[0109] (3) Set the thickness of frozen sections to 5-8 μM and the temperature of the microtome to -20℃.

[0110] (4) Frozen slices are dried at room temperature for more than 1 hour and can be stored in a -20℃ refrigerator for a long time.

[0111] 2. Immunofluorescence staining

[0112] (1) After freezing the sections, treat them in 4% paraformaldehyde for 15 minutes (operate on ice), then punch them with TBST (TBST + 0.2% Triton X-100) for 30 minutes.

[0113] (2) Once the slices have just dried, use a hydrophobic pen to draw circles around the tissue.

[0114] (3) Prepare a blocking solution containing 3% fetal bovine serum using PBST (PBS + 0.1% Tween-20). Place the frozen sections in a humidified chamber, gently drop the blocking solution around the tissue, and incubate at room temperature for 30 minutes.

[0115] (4) Dilute the primary antibody with blocking solution, drop the primary antibody dilution solution around the tissue after discarding the blocking solution, place it in a humidified chamber, and incubate overnight at 4°C.

[0116] (5) Wash frozen sections with PBST, gently shake on a shaker, wash three times, 10 minutes each time.

[0117] (6) Dry the frozen sections, prepare the fluorescent secondary antibody with PBST, and incubate at room temperature in the dark for 1 hour.

[0118] (7) Wash the slides with PBST, gently shake on a shaker, wash three times, 10 minutes each time.

[0119] (8) Dry the frozen section, drop mounting medium around the tissue, cover with a coverslip, and apply nail polish to the edge of the coverslip.

[0120] 3. Observation was performed under a laser confocal fluorescence microscope using two excitation bands: 561 nm and 647 nm. Figure 3 ).

[0121] Example 4

[0122] This example demonstrates the application of conditional knockout mice, which are generated using the Cre-LoxP method and have the Creld1 gene specifically knocked out in dorsal root ganglion neurons, in the treatment of acute pain.

[0123] Adult male mice (8-16 weeks old) were used for tactile behavioral analysis.

[0124] (1) Cold plate test

[0125] Two days prior to the test, mice were acclimatized to the instrument by placing them on a temperature-controlled device for 10 minutes at room temperature (25°C). In the actual laboratory setting, the cold plate temperature was 0°C. The time it took for mice to shake their front paws, lick their hind paws, or jump after being placed on the cold plate was observed and recorded. 60 seconds was taken as the maximum value to prevent frostbite. Each mouse was tested three times, with half-hour intervals between tests. The average reaction time was taken as the mouse's cold plate response value. Compared to WT mice, KO mice showed a more sluggish response to noxious cold stimuli. Figure 4 (A).

[0126] (2) Hot plate experiment

[0127] Two days prior to the test, mice were acclimatized to the instrument by placing them on a hot plate for 10 minutes at a room temperature of 25°C. During the actual test, the temperature of the test plate was set to 50°C, with a maximum duration of 1 minute, to prevent burns. Mice were gently placed on the test plate, and their behaviors such as hind paw withdrawal, licking of the hind paw, or jumping were observed and recorded as reaction times. Each mouse was tested three times, with half-hour intervals between tests, and the average reaction time was used as the mouse's cold plate response value. Compared to WT mice, KO mice showed a more sluggish response to noxious heat stimuli. Figure 4 (B).

[0128] The two animal behavioral tests above demonstrate that specific knockout of the Creld1 gene in dorsal root ganglion neurons inhibits acute pain.

[0129] Example 5

[0130] This example demonstrates the application of conditional knockout mice with specific knockout of the Creld1 gene in dorsal root ganglion neurons for chronic pain.

[0131] (1) Inflammatory pain model

[0132] Mice were acclimatized to an electronic von Frey instrument for at least half an hour beforehand. The force (maximum) was 25g, and the time of change was 10s. The threshold of the foot was tested without drug injection. 10 μl of 0.5 mM capsaicin was injected into the right hind paw of the mice, and the test was repeated three times after 15 minutes. Comparison between WT mice and KO mice revealed that KO mice had a more subdued pain response in the capsaicin-induced inflammatory pain model. Figure 5 (A).

[0133] (2) Chronic pain model of nerve injury

[0134] To create a mouse model of chronic pain due to nerve damage, the specific method is as follows: under a stereoscope, the sciatic nerve of the left leg of the mouse is dissected, held with smooth forceps for 30 seconds, and then the sciatic nerve is returned to its original position. The muscles and skin are then sutured together with tissue glue.

[0135] Mice were acclimatized to von Frey's box for half an hour beforehand. A No. 2 needle was used to touch the left hind paw. The sole of the left hind paw was divided into five equal areas from heel to toe, and needles were applied sequentially from sole to toe, repeated twice. A response was recorded when the mouse exhibited hind paw withdrawal, trembling, or licking of the hind paw; if no such response was observed within 5 seconds of touching the hind paw, it was recorded as no response. The same procedure was performed on the right hind paw, serving as a control. Records were taken before surgery and continuously from day 3 to day 14 post-surgery. Results showed that in the left hind paw corresponding to the surgically treated left sciatic nerve, the recovery of pain sensation in KO mice was significantly slower than in WT mice. However, in the contralateral right hind paw (the control), there was almost no difference in pain response between WT and KO mice. Figure 5 (B) indicates that in a model of chronic pain due to nerve injury, the absence of the Creld1 gene inhibits the recovery of pain sensation in chronic pain.

[0136] Example 6

[0137] This example demonstrates the application of conditional knockout mice with specific knockout of the Creld1 gene in dorsal root ganglion neurons to itch.

[0138] Adult male mice (8-16 weeks old) were used for tactile behavioral analysis.

[0139] (1) Injecting histamine to establish an itch model

[0140] Mice were placed indoors for half an hour, and two days prior, they were placed in a box on a von Frey electronic claw for half an hour to acclimatize. Hair was removed from their right cheek. On the third day, 10 μl of histamine (50 μg) was injected into their right cheek. The video was recorded for 30 minutes, and the number of times the mice scratched their right cheek with their hind paws was counted. Compared to WT mice and KO mice, KO mice showed almost no scratching behavior after histamine injection. Figure 6 (A).

[0141] (2) Injecting chloroquine to establish an itch model

[0142] Two days prior to the event, mice were acclimatized for half an hour in a von Frey electronic claw. One day prior, neck hair was shaved. 50 μl of chloroquine (totaling 200 μg) was injected subcutaneously into the scapula on the back of the mice. The mice were video-recorded for 30 minutes, and the number of times they scratched their necks with their hind paws was recorded. Compared to WT mice, KO mice showed a significant reduction in scratching behavior after chloroquine injection. Figure 6 (B).

[0143] (3) Injecting 48 / 80 compound to construct an itch model

[0144] Two days prior to the event, mice were acclimatized for half an hour in a von Frey electronic claw. One day prior, neck hair was shaved. 50 μl of compound 48 / 80 (totaling 100 μg) was injected subcutaneously into the scapula of the back of the mice. The mice were video-recorded for 30 minutes, and the number of times they scratched their necks with their hind paws was counted. The results showed that, compared to WT mice, KO mice significantly exhibited reduced scratching behavior after injection of compound 48 / 80. Figure 6 (C).

[0145] Example 7

[0146] This example demonstrates the application of mice overexpressing Creld1 protein in dorsal root ganglion neurons for acute pain.

[0147] In B6 background mice two days after birth, approximately 3 μl of 1 x 10⁻⁶ ... 13 AAV-Creld1 adenovirus was used, and mice injected with AAV-GFP virus served as the control group. Adult male mice (8-16 weeks old) were used for tactile behavioral analysis.

[0148] (1) Cold plate test

[0149] Two days prior to the test, mice were acclimatized to the instrument by placing them on a temperature-controlled device for 10 minutes at room temperature (25°C). In the actual laboratory setting, the cold plate temperature was 0°C. The time it took for mice to shake their front paws, lick their hind paws, or jump after being placed on the cold plate was observed and recorded, with 60 seconds considered the maximum value to prevent frostbite. Each mouse was tested three times, with half-hour intervals, and the average reaction time was taken as the mouse's cold plate response value. Compared to the control group, mice overexpressing Creld1 protein were more sensitive to noxious cold stimuli. Figure 7 (A).

[0150] (2) Hot plate experiment

[0151] Two days prior to the test, mice were acclimatized to the instrument by placing them on a hot plate for 10 minutes at a room temperature of 25°C. During the actual test, the temperature of the test plate was set to 50°C, with a maximum duration of 1 minute, to prevent burns. Mice were gently placed on the test plate, and their behaviors such as hind paw withdrawal, licking of the hind paw, or jumping were observed and recorded as reaction times. Each mouse was tested three times, with half-hour intervals between tests, and the average reaction time was used as the mouse's response value on the cold plate. Compared to the control group, mice overexpressing Creld1 protein showed a more sensitive response to noxious heat stimulation. Figure 7 (B).

[0152] The two animal behavioral experiments above demonstrate that overexpression of Creld1 protein in dorsal root ganglion neurons can enhance acute pain sensation.

[0153] Example 8

[0154] This example demonstrates the application of Creld1 protein overexpression in mouse sensory nerve injury repair in dorsal root ganglion neurons.

[0155] In B6 background mice two days after birth, approximately 3 μl of 1 x 10⁻⁶ ... 13 AAV-Creld1 adenovirus (the Creld1 expression gene is the cDNA sequence of wild-type Creld1, as shown in SEQ ID No.:6), and mice injected with AAV-GFP virus served as the control group. Adult male mice (8-16 weeks old) were used for tactile behavioral analysis.

[0156] To create a mouse model of chronic pain due to nerve damage, the specific method is as follows: under a stereoscope, the sciatic nerve of the left leg of the mouse is dissected, held with smooth forceps for 30 seconds, and then the sciatic nerve is returned to its original position. The muscles and skin are then sutured together with tissue glue.

[0157] Mice were acclimatized to von Frey's box for half an hour beforehand. A No. 2 needle was used to touch the mouse's left hind paw, taking care not to puncture it. The sole of the left hind paw was divided into five equal areas from heel to toe, and needles were applied sequentially from sole to toe, repeated twice. A response was recorded when the mouse exhibited hind paw withdrawal, trembling, or licking of the hind paw; if no such response was observed within 5 seconds of touching the hind paw, it was recorded as no response. The same procedure was performed on the right hind paw, serving as a control. Records were taken before surgery and continuously from day 3 to day 14 post-surgery. Results showed that in the left hind paw corresponding to the surgically treated left sciatic nerve, AAV-Creld1 mice recovered pain sensation faster and achieved faster recovery after nerve injury than AAV-GFP mice. However, in the contralateral right hind paw (the control), the pain response in AAV-Creld1 mice was almost indistinguishable from that in AAV-GFP mice. Figure 8 This indicates that in a model of chronic pain caused by nerve injury, overexpression of the Creld1 protein can accelerate the recovery of pain sensation.

Claims

1. The use of a reagent in the preparation of a medicament for reducing pain or itching, said reagent inhibiting Creld1 gene expression or reducing the activity of Creld1 gene-expressing protein.

2. The use of claim 1, wherein, The reagents are interfering RNA, microRNA, siRNA, and aptamers that inhibit Creld1 gene expression.

3. The use according to claim 1, wherein, The reagents described are those required for the CRISPR-Cas9 system that knocks out or reduces the Creld1 gene using Creld1sgRNA.

4. The application as described in claim 1, wherein, The reagents are those required for the Cre-LoxP system that knocks out or down the Creld1 gene.

5. The application as described in claim 4, wherein, The Cre-LoxP system adds LoxP sites on both sides of the knockout or knockdown region formed by exons 3 and 4 of the Creld1 gene, and induces Cre enzyme expression through itmoxifen.

6. The application as described in claim 1, wherein, The reagent is an antibody that reduces the expression of the Creld1 gene protein.

7. The application as described in claim 6, wherein, The antibody is a single-chain antibody.

8. The use of a reagent in the preparation of a medicament for repairing nerve damage, said reagent promoting Creld1 gene expression or increasing the activity of Creld1 gene expression protein.

9. The application as described in claim 8, wherein, The reagent is a vector carrying the Creld1 gene.

10. The application as described in claim 9, wherein, The vector is a viral vector carrying the Creld1 gene.

11. The use of a reagent for detecting Creld1 gene expression levels in the preparation of a kit for diagnosing the sensitivity of a subject to pain and / or pruritus, the reagent being used to determine the Creld1 gene expression level in the subject, wherein the subject is identified as sensitive to pain and / or pruritus when the Creld1 gene expression level in the subject is above the upper limit of a reference range; and the subject is identified as insensitive to pain and / or pruritus when the Creld1 gene expression level in the subject is below the lower limit of a reference range.

12. The application as described in claim 11, wherein the reference range is obtained by testing on a general population.

13. A system for screening drugs for treating pain and / or pruritus, said system being used as a drug for treating pain and / or pruritus by identifying agents that inhibit Creld1 gene expression levels or reduce Creld1 gene protein expression.

14. A system for screening drugs for repairing nerve damage, the system identifying agents that promote Creld1 gene expression levels or increase Creld1 gene protein expression as drugs for repairing nerve damage.

Images