Oligonucleotide-ligand conjugate methods and their use in nucleic acid drugs
Patent Information
- Application Number
- CN202610172235.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-02-18
- Filing Date
- 2026-02-05
- Publication Date
- 2026-08-18
AI Technical Summary
然而,现有溶液相方法仍存在诸多局限,如酯基酰胺化依赖非商业化合成模块、铜催化点击化学存在毒性问题、SPAAC反应易产生手性中心影响纯化、天然化学连接(NCL)及巯基-烯点击反应产率较低
[0135]与现有技术相比,本发明的主要优点在于:
Smart Images

Figure SMS_50 
Figure SMS_51 
Figure SMS_52
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically relating to an oligonucleotide-ligand conjugation method and its application in nucleic acid drugs. The method is an oligonucleotide-ligand conjugation technique based on amide formation-photoclick chemical cyclization, used to synthesize oligonucleotide-ligand conjugates. Background Technology
[0002] In recent years, oligonucleotide therapy has shown great promise in the treatment of various genetic diseases, with several drugs already approved for marketing and numerous candidate molecules in clinical trials. Small interfering RNA (siRNA), as an important oligonucleotide drug, can specifically bind to and degrade target mRNA, thereby effectively inhibiting gene expression. Currently, siRNA therapy is widely used in the treatment of genetic diseases, rare diseases, cardiovascular diseases, neurological diseases, hypercholesterolemia, cancer, and viral infections.
[0003] Despite the immense potential of siRNA therapy, its development still faces challenges such as insufficient targeted delivery capability, poor metabolic stability, and low cellular uptake efficiency. To overcome these issues, researchers have developed various chemical modification strategies, among which siRNA-ligand conjugation (such as lipids, peptides, antibodies, and GalNAc) has become an important method for optimizing the therapeutic effects of siRNA. In particular, siRNA-GalNAc conjugates can target the ASGPR receptor on hepatocytes, promoting siRNA uptake and achieving highly efficient gene silencing. Currently, five of the six approved siRNA drugs employ the GalNAc conjugation strategy, demonstrating extremely high clinical value.
[0004] The main synthetic strategy for existing siRNA-GalNAc conjugates is solid-phase synthesis (SPS), but this method suffers from low coupling efficiency, low yield, numerous byproducts, and difficult purification, limiting the flexibility of industrial production and structure-activity relationship (SAR) studies. In contrast, post-solution-phase modification strategies can improve coupling efficiency, reduce costs, and provide greater flexibility in chemical modification. However, existing solution-phase methods still have many limitations, such as ester amidation relying on non-commercial synthetic modules, the toxicity issues of copper-catalyzed click chemistry, the tendency of SPAAC reactions to generate chiral centers affecting purification, and low yields of natural chemical linkages (NCL) and thiol-alkene click reactions. Furthermore, current research mainly focuses on the feasibility of coupling chemistry, with less evaluation of the impact of different linking groups on the bioactivity of siRNA-GalNAc conjugates. Therefore, there is an urgent need to develop efficient and universal siRNA-ligand coupling strategies to improve coupling efficiency and support large-scale synthesis. Photoinduced primary amine and o-nitrobenzyl alcohol cyclization (PANAC) chemistry exhibits high chemoselectivity, readily available primary amine-containing reactants, and rapid kinetics, achieving fast and efficient binding even at low reactant concentrations. Furthermore, the resulting artificial links are achiral (compared to SPAAC, etc.), thus eliminating stereochemical complexity and simplifying downstream purification processes. PANAC photoclick chemistry has applications in the modular functionalization of various small molecules, biomolecules, and biomaterials. Chem 2019, 5 , 2955-2968. Nat. Commun. 2020, 11 ,5472. Adv. Sci. 2024, 2400594.).
[0005] Therefore, there is an urgent need in this field to develop a universal modular conjugation platform that can overcome the limitations of traditional solid-phase synthesis and post-solution modification methods in terms of efficiency and scalability, and provide innovative solutions for siRNA drug development. Summary of the Invention
[0006] This invention provides an oligonucleotide-ligand coupling method based on a two-step efficient reaction of "amide coupling-photoclick chemical cyclization reaction". This method is the first to realize modular coupling technology of oligonucleotide-ligand, which has universality and excellent coupling effect.
[0007] In a first aspect, the present invention provides an oligonucleotide-ligand conjugate of Formula I or Formula II, or a pharmaceutically acceptable salt thereof, or a stereoisomer thereof, or a racemic mixture thereof. Formula I; Formula II; in, (or ONM) indicates an oligonucleotide molecule; (or TLM) indicates the target ligand portion; L is either absent or L is a linking group; R1 represents 0-3 substituents, each independently selected from the group consisting of: D, halogen, -NO2, -CN, -OH, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C2-C6 alkoxy, substituted or unsubstituted C1-C6 cycloalkyl, substituted or unsubstituted C3-C8 heterocycloalkyl, substituted or unsubstituted C3-C8 heterocycloalkyl containing 1-3 heteroatoms selected from N, O, or S, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 5-7 heteroaryl containing 1-3 heteroatoms selected from N, O, or S, -C(O)R6; the substitution refers to substitution by one or more substituents selected from the group consisting of: halogen, -CN, -NO2, C1-C6 alkyl, C1-C6 haloalkyl, -OH, C1-C6 alkoxy, oxo (=O); R6 is selected from the following group: H, -OH, -NH2, C1-C6 alkyl, C1-C6 alkoxy.
[0008] In another preferred embodiment, L is a divalent linker.
[0009] In another preferred embodiment, In this context, L represents either the absence of a component or a divalent linker selected from the following groups: , , , , , , , , , , , , , , , , , , , , , , , , , , ; n1, n3, n4, n6, n7, n8, n9, n 10 n 12 n 13 n 14 n 15 n 16 n 18 n 19 n 20 n 23 n 25 n 31 n 32 n 33 and n 41 Each is an independent integer from 0 to 10; n2, n5, n 11 n 17 n 21 n 22 n 24 n 26 n 27 n 28 n 29 n 30 n 34 n 35 n 36 n 37 n 38 n 39 n 40 and n 42 Each is an independent integer from 1 to 10; X1 and X2 are each independently selected from the following groups: -CH-, -N-; X3 is selected from the following group: -O-, -S-; X4 is selected from the following groups: -O-, -NH-; Y is selected from the following groups: -CH-, -N-; Z is selected from the following group: not present, -CH2-; m1, m2, and m3 are each independently selected from the following groups: 0, 1, and 2.
[0010] In another preferred embodiment, R1 and L have different substitution positions in the o-nitrobenzyl alcohol structure.
[0011] In another preferred embodiment, R1 is one or more substituents at any position (other than the L-substituted position) at the 2, 3, 4 or 5 position of the o-nitrobenzyl alcohol structure.
[0012] In another preferred embodiment, with multiple substitutions, each R1 may be the same or different.
[0013] In another preferred embodiment, the oligonucleotide-ligand conjugate is prepared by (a) an amide formation reaction and (b) a photoclick chemical cyclization reaction; In another preferred embodiment, the oligonucleotide is selected from the group consisting of: antisense oligonucleotides (ASO), small interfering RNA (siRNA), aptamers, microRNAs (miRNA), small activating RNAs (saRNA), CpG oligonucleotides, DNA oligonucleotides, peptide nucleic acids (PNA), or combinations thereof. In another preferred embodiment, the targeting ligand targets a receptor on the cell surface.
[0014] In another preferred embodiment, the targeting ligand is selected from the group consisting of lipophiles, carbohydrates, peptides, folic acid, aptamers, antibodies, or combinations thereof.
[0015] In another preferred embodiment, the targeting ligand is a ligand that binds to the desialyl glycoprotein receptor.
[0016] In another preferred embodiment, the oligonucleotide is selected from the group consisting of antisense oligonucleotides (ASO), small interfering RNA (siRNA), DNA oligonucleotides, peptide nucleic acids (PNA), or combinations thereof.
[0017] In another preferred embodiment, the targeting ligand is selected from the group consisting of: cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecanyl, palmitic acid, myristic acid, O3(oleoyl)lithocholic acid, O3(oleoyl)cholenic acid, dimethoxytribenzyl, and phenoxazine. Allose, arabinose, cladinose, erythrose, erythritol, fructose, D-fucoitol, L-fucoitol, fucose, fucose, fucosyl glycosylamine, galactosamine, D-galactosamine, N-acetylgalactosamine (GalNAc), galactose, glucosamine, N-acetylglucosamine, glucosamine alcohol, glucose, glucose 6-phosphate, gulose glyceraldehyde, L-glycerol, D-mannose heptose, glycerol, glycerone, gulose, idose, lyseose, mannosamine, mannoose, mannoose 6-phosphate, allulose, quinose, quinofuridine, rhamnitol, rhamnose glycosamine, rhamnose, ribose, ribulose, sedulose heptose, sorbose, tagatose, tartaric acid, threose, xylose and xylulose, nucleic acid aptamers, folic acid, polypeptides.
[0018] In another preferred embodiment, the targeting ligand is selected from the group consisting of: cholesterol, lithocholic acid, N-acetylgalactosamine (GalNAc), nucleic acid aptamer, folic acid, and polypeptide; In another preferred embodiment, the nucleic acid aptamer in the targeting ligand is selected from the group consisting of AS1411, AntikIT, and Anti-MUC1; wherein AS1411, AntikIT, and Anti-MUC1 are each selected from the nucleotide sequences (5'→3') of the group consisting of: AS1411: TTGGTGGTGGTGGTTGTGGTGGTGGTGG (SEQ ID No: 1); AnticKIT:ATTGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGAC (SEQ ID No: 2); Anti-MUC1:GAAGTGAAAATGACAGAACACAACA (SEQ ID No: 3).
[0019] In another preferred embodiment, the structure of the targeting ligand is selected from the group consisting of: , , , , , , , , , , , , , ; Among them, p1, p2, p3, p4, p5, p6, p7, p8, p9, p 10 Each is an independent integer from 0 to 7; Wavy lines ( () refers to the position where the target ligand is connected to the rest of the oligonucleotide-ligand conjugate; This refers to antibodies (such as conventional antibodies, single-chain antibodies, nanobodies, or their active fragments); In another preferred embodiment, Indicates antibody.
[0020] In another preferred embodiment, the antibody refers to a unit capable of binding, reactively associating with, or chelating a receptor or antigen.
[0021] In another preferred embodiment, the structure of the oligonucleotide-ligand conjugate is selected from the group consisting of: in, Indicates a single-stranded oligonucleotide; This indicates a double-stranded oligonucleotide.
[0022] In another preferred embodiment, This refers to single-stranded DNA oligonucleotides; This indicates a double-stranded DNA oligonucleotide or a double-stranded RNA oligonucleotide.
[0023] This indicates a single-stranded oligonucleotide modified with a primary amine. This indicates a primary amine-modified double-stranded oligonucleotide.
[0024] In another preferred embodiment, This refers to a single-stranded DNA oligonucleotide modified with a primary amine. This refers to a primary amine-modified double-stranded DNA oligonucleotide or a double-stranded RNA oligonucleotide.
[0025] In another preferred embodiment, the The nucleotide sequence (5'→3') is as follows: .
[0026] In another preferred embodiment, the The following siRNA is formed by the sense and antisense strands with the following nucleotide sequence (5'→3'): Chain of Justice: AACAGUGUUCUUGCUCUAUAATT(SEQ ID No: 4) antisense chain: UUAUAGAGCAAGAACACUGUUUU(SEQ ID No: 5) Chain of Justice: AGAUCAAGAUCUACAUCGATT(SEQ ID No: 10) antisense chain: UCGAUGUAGAUCUUGAUCUUU(SEQ ID No: 11) Chain of Justice: UGUGGAGAUUUGAACUUUGTT(SEQ ID No: 12) antisense chain: UAAAGUUCAAAUCUCCACAGA(SEQ ID No: 13) Chain of Justice: GUUGCUGCAAUUUCAAAUGTT(SEQ ID No: 14) antisense chain: UAUUUGAAAUUGCAGCAACCA(SEQ ID No: 15) Chain of Justice: GUGGAGAUUUGAACUUUGA(SEQ ID No: 16) antisense chain: UCAAAGUUCAAAUCUCCACAG(SEQ ID No: 17) Chain of Justice: UUGCUGCAAUUUCAAAUGUTT(SEQ ID No: 18) antisense chain: ACAUUUGAAAUUGCAGCAACC(SEQ ID No: 19) Wherein, C, G, U, A, and T represent cytidine-3'-phosphate, guanosine-3'-phosphate, uridine-3'-phosphate, adenosine-3'-phosphate, and deoxythymidine-3'-phosphate, respectively. At least one nucleotide in the sense strand and the antisense strand is a modified nucleotide. The primary amine linker is located at the 3'-end, 5'-end, or middle of the base sequence of the nucleotide, and together with the desired target sequence oligonucleotide, forms a primary amine-modified oligonucleotide.
[0027] In another preferred embodiment, at least one nucleotide in the sense strand and the antisense strand is a modified nucleotide.
[0028] In another preferred embodiment, the modified nucleotide is selected from: 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxynucleotides, 2'-fluorine, 2'-deoxynucleotides, 2'-methoxyethyl modified nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 2'-alkoxy modified nucleotides, 2'-F-arabinonucleotides, phosphate thioester modified nucleotides, debased nucleotides, morpholinonucleotides and locked nucleotides, and primary amine modified nucleotides.
[0029] In another preferred embodiment, the The nucleotide sequences (5'→3') of the sense and antisense strands are selected from the following group: STtr1, STtr2, STtr3, siSmpd3-1, siSmpd3-2, siSmpd3-03, siSmpd3-13, siSmpd3-14, siSmpd3-19 or combinations thereof. in, The justice chain and antithesis chain of STtr1 are as follows: Chain of Justice: mA*mA*mCAfGmUfGfUfUmCmUmUmGmCmUmCmUmAmUmAmAdTdT-C-NH2 antisense chain: mU*fU*mAmUmAfGmAfGfCmAmAmGmAfAmCfAmCmUmGmUmU*mU*mU The justice chain and antithesis chain of STtr2 are as follows: Chain of Justice: mA*mA*mCmAfGmUfGfUfUmCmUmUmGmCmUmCmUmAmUmAmA(Int NH2-C-dT)dT antisense chain: mU*fU*mAmUmAfGmAfGfCmAmAmGmAfAmCfAmCmUmGmUmU*mU*mU The justice chain and antithesis chain of STtr3 are as follows: Chain of Justice: mA*mA*mCmAfGmUfGfUfUmCmUmUmGmCmUmCmUmAmUmAmAdT(NH2-C-dT) antisense chain: mU*fU*mAmUmAfGmAfGfCmAmAmGmAfAmCfAmCmUmGmUmU*mU*mU The justice chain and antisense chain of siSmpd3-1 are as follows: Chain of Justice: mA•mG•mAmUfCmAfAfGfAmUmCmUmAmCmAmUmCmGmAdT (NH2-C-dT) antisense chain: mU•fC•mGmAmUfGmUfAfGmAmUmCmUfUmGfAmUmCmU•mU•mU The justice chain and antisense chain of siSmpd3-2 are as follows: Chain of Justice: mA•mG•mAmUfCmAfAfGfAmUmCmUmAmCmAmUmCmGmA(NH2-C-dT)dT antisense chain: mU•fC•mGmAmUfGmUfAfGmAmUmCmUfUmGfAmUmCmU•mU•mU The justice chain and antisense chain of siSmpd3-03 are as follows: Chain of Justice: mU*mG*mUmGfGmAfGfAfUmUmUmGmAmAmCmUmU*mU*mGdT (NH2-C-dT) antisense chain: mU*fA*mAmAmGfUmUfCfAmAmAmUmCfUmCfCmAmCmA*mG*mA The justice chain and antisense chain of Smpd3-13 are as follows: Chain of Justice: mG*mU*mUmGfCmUfGfCfAmAmUmUmUmCmAmAmA*mU*mGdT (NH2-C-dT) antisense chain: mU*fA*mUmUmUfGmAfAfAmUmUmGmCfAmGfCmAmAmC*mC*mA The justice chain and antisense chain of Smpd3-19 are as follows: Chain of Justice: mU*mU*mGmCfUmGfCfAfAmUmUmUmCmAmAmAmU*mG*mUdT (NH2-C-dT) antisense chain: mA*fC*mAmUmUfUmGfAfAmAmUmUmGfCmAfGmCmAmA*mC*mC The justice chain and antisense chain of Smpd3-14 are as follows: Justice chain: mG*mU*mGmGfAmGfAfUmUmGmAmAmCmUmUmU*mG*mA-(C-NH2) antisense chain: mU*fC*mAmAmAfGmUfUfCmAmAmAmUfCmUfCmCmAmC*mA*mG in, m indicates that the nucleotide adjacent to the right of the letter m is a nucleotide modified with 2'-O-methyl; f indicates that the nucleotide adjacent to the right of the letter f is a 2'-fluorine modified nucleotide; * indicates that the connection between the two nucleotides adjacent to * is a thiophosphate group connection; The letter 'd' indicates that the nucleotide adjacent to the right of the letter 'd' is a 2' deoxyribonucleotide.
[0030] In another preferred embodiment, the primary amine-modified oligonucleotide contains the following structures: (dT-C-NH2), (Int NH2- C-dT), (NH2-C-dT), (C-NH2), , , , ; Where q1 and q2 are integers from 0 to 10.
[0031] In another preferred example, q1 is 4 and q2 is 5.
[0032] A second aspect of the present invention provides a method for preparing oligonucleotide-ligand conjugates, comprising the following steps: (a) Provides a primary amine-modified oligonucleotide ON (also known as an ONM reactant) and a primary amine-modified targeting ligand TL (also known as a TLM reactant), wherein the primary amine-modified oligonucleotide ON has a first coupling reactive group -NH2, and the primary amine-modified targeting ligand TL (also known as a TLM reactant) has a second coupling reactive group -NH2. (b) The primary amine-modified oligonucleotide ON (also known as the ONM reactant) and the primary amine-modified targeting ligand TL (also known as the TLM reactant) are reacted with a coupling molecule to form an oligonucleotide-ligand conjugate. The coupling molecule has a third coupling reactive group. , and the fourth coupling reactive group .
[0033] In another preferred embodiment, the coupling molecule has a structure of formula I-a1 or I-a2: , ; In the formula, L and R1 are defined as above.
[0034] In another preferred embodiment, the first coupling reactive group reacts with the third coupling reactive group; while the second coupling reactive group reacts with the fourth coupling reactive group.
[0035] In another preferred embodiment, the reaction of the first coupling reactive group (R1) with the third coupling reactive group and the reaction of the second coupling reactive group (R2) with the fourth coupling reactive group are carried out sequentially or simultaneously.
[0036] In another preferred embodiment, the first coupling reactive group reacts with the fourth coupling reactive group; while the second coupling reactive group reacts with the third coupling reactive group.
[0037] In another preferred embodiment, the reaction of the first coupling reactive group (R3) with the fourth coupling reactive group and the reaction of the second coupling reactive group (R4) with the third coupling reactive group are carried out sequentially or simultaneously.
[0038] In another preferred embodiment, the primary amine-modified oligonucleotide ON (also known as the ONM reactant) first reacts with the coupling molecule to form a first coupling intermediate; and the first coupling intermediate reacts with the primary amine-modified targeting ligand TL (also known as the TLM reactant) to form the oligonucleotide-ligand conjugate.
[0039] In another preferred embodiment, the primary amine-modified oligonucleotide ON (also known as the ONM reactant) first reacts with a third coupling reactive group to form a first coupling intermediate; and the first coupling intermediate reacts with a primary amine-modified targeting ligand TL (also known as the TLM reactant) to form the oligonucleotide-ligand conjugate.
[0040] In another preferred embodiment, the first coupling intermediate has a structure of formula Ib: (Ib) In the formula, L and R1 are defined as above.
[0041] In another preferred embodiment, the primary amine-modified targeting ligand TL (also known as the TLM reactant) first reacts with the coupling molecule to form a second coupling intermediate; and the second coupling intermediate reacts with the primary amine-modified oligonucleotide ON (also known as the ONM reactant) to form the oligonucleotide-ligand conjugate.
[0042] In another preferred embodiment, the primary amine-modified targeting ligand TL (also known as the TLM reactant) first reacts with a third coupling reactive group to form a second coupling intermediate; and the second coupling intermediate reacts with a primary amine-modified oligonucleotide ON (also known as the ONM reactant) to form the oligonucleotide-ligand conjugate.
[0043] In another preferred embodiment, the second coupling intermediate has a structure of formula II-b: (II-b) In the formula, L and R1 are defined as above.
[0044] In another preferred embodiment, the II-b structure is selected from the following structures: , , , , , , , , , , , , , ; In the formula, L and R1 are defined as above.
[0045] p1, p2, p3, p4, p5, p6, p7, p8, p9, p 10 , As defined above; In another preferred embodiment, the primary amine-modified oligonucleotide ON (also known as the ONM reactant) first reacts with a fourth coupling reactive group to form a third coupling intermediate; and the third coupling intermediate reacts with a primary amine-modified targeting ligand TL (also known as the TLM reactant) to form the oligonucleotide-ligand conjugate.
[0046] In another preferred embodiment, the third coupling intermediate has a structure of formula III-b: III-b In the formula, L and R1 are defined as above.
[0047] In another preferred embodiment, the primary amine-modified targeting ligand TL (also known as the TLM reactant) first reacts with a fourth coupling reactive group to form a fourth coupling intermediate; and the fourth coupling intermediate reacts with a primary amine-modified oligonucleotide ON (also known as the ONM reactant) to form the oligonucleotide-ligand conjugate.
[0048] In another preferred embodiment, the fourth coupling intermediate has a structure of formula IV-b: IV-b In the formula, L and R1 are defined as above.
[0049] In another preferred embodiment, the IV-b structure is selected from the following structures: , , , , , , , , , , , , , ; In the formula, L and R1 are defined as above.
[0050] p1, p2, p3, p4, p5, p6, p7, p8, p9, p 10 , As defined above; In another preferred embodiment, the oligonucleotide-ligand conjugate is coupled via a linker group derived from the conjugate molecule.
[0051] In another preferred embodiment, the linking group has a structure of formula V: (V) In the formula, L and R1 are defined as above.
[0052] In another preferred embodiment, step (b) includes the following steps: (b1) A primary amine-modified oligonucleotide ON (also known as an ONM reactant) is coupled with a compound of formula I-a1 or I-a2 to prepare a compound of formula Ib; and (b2) Compound Ib is prepared by photoclick chemical cyclization reaction with a primary amine-modified targeting ligand TL (also known as TLM reactant); In another preferred embodiment, step (b) includes the following steps: (b1) The primary amine-modified targeting ligand TL (also known as TLM reactant) is coupled with compound I-a1 or I-a2 to prepare compound II-b. (b2) Compound II-b is prepared by photoclick chemical cyclization reaction with primary amine-modified oligonucleotide ON (also known as ONM reactant).
[0053] In another preferred embodiment, step (b) includes the following steps: (b1) The primary amine-modified targeting ligand TL (also known as TLM reactant) is subjected to a photoclick chemical cyclization reaction with the compound of formula I-a2 to prepare the compound of formula III-b; (b2) Compound III-b is coupled with a primary amine-modified oligonucleotide ON (also known as an ONM reactant) to prepare compound I.
[0054] In another preferred embodiment, step (b) includes the following steps: (b1) Primary amine-modified oligonucleotides ON (also known as ONM reactants) are subjected to photoclick chemical cyclization reaction with compound I-a2 to prepare compound IV-b; (b2) Compound IV-b is coupled with a primary amine-modified targeting ligand TL (also known as a TLM reactant) to prepare compound II.
[0055] In each formula, R1, L, ONM and TLM are defined as described above.
[0056] In another preferred embodiment, the method is synthesis method one, two, three, or four: The synthesis method one includes the following steps: (M1a) The primary amine-modified oligonucleotide ON (also known as ONM reactant) is coupled with a compound of formula I-a1 or I-a2 in a buffer system via an amide condensation reaction to form a compound of formula Ib. (M1b) The buffer solution of compound Ib and primary amine-modified targeting ligand TL (also known as TLM reactant) is placed under ultraviolet light to undergo photoclick chemical cyclization reaction, forming the oligonucleotide-ligand conjugate shown in Formula I; Synthesis method two includes the following steps: (M2a) The primary amine-modified targeting ligand TL (also known as TLM reactant) is coupled with a compound of formula I-a1 or I-a2 in a buffer system via an amide condensation reaction to form an o-nitrobenzyl alcohol-modified oligonucleotide intermediate of formula II-b. (M2b) The intermediate compound of formula II-b is placed under ultraviolet light and reacted with a primary amine-modified oligonucleotide ON (also known as ONM reactant) to undergo a photoclick chemical cyclization reaction, forming an oligonucleotide-ligand conjugate of formula II. Synthesis method three includes the following steps: (M3a) The primary amine-modified targeting ligand TL (also known as TLM reactant) reacts with compound of formula I-a2 to form compound of formula III-b, under the same reaction conditions as step (M1b) of the synthetic method. (M3b) Compound I is formed by reacting the III-b compound with a primary amine-modified oligonucleotide ON (also known as an ONM reactant) under the same reaction conditions as step (M1a) of the synthetic method.
[0057] Synthesis Method Four: (M4a) The oligonucleotide ON (also known as the ONM reactant) modified with a primary amine reacts with a compound of formula I-a2 to form a compound of formula IV-b, under the same reaction conditions as step (M1b) of the synthetic method. (M4b) Compound of formula IV-b is formed by reacting the primary amine-modified targeting ligand TL (also known as TLM reactant) with the reaction conditions as in step (M1a) of the synthesis method. In each formula, R1, L, ONM and TLM are defined as described above.
[0058] A third aspect of the present invention provides a pharmaceutical composition comprising: (i) oligonucleotide-ligand conjugates as described in the first aspect of the invention, or pharmaceutically acceptable salts thereof, or stereoisomers thereof, or racemates thereof; and (ii) Pharmaceutically acceptable carriers.
[0059] A fourth aspect of the invention provides the use of the oligonucleotide-ligand conjugate of the invention for the preparation of a medicament for the prevention and / or treatment of a specific gene-mediated disease or condition.
[0060] In another preferred embodiment, the gene is selected from the group consisting of: genes related to hereditary diseases, genes related to metabolic diseases, genes related to viral infections, genes related to cardiovascular diseases, genes related to liver diseases, genes related to cancer, genes related to nervous system diseases, genes related to ophthalmic diseases, genes related to immune diseases, genes related to kidney diseases, and genes related to rare diseases.
[0061] In another preferred embodiment, the gene is selected from the group consisting of: Genes associated with hereditary diseases: TTR (transthyretin), ATTR, F12 (coagulation factor XII), HFE (hereditary hemochromatosis gene); Metabolic disease-related genes: PCSK9 (proprotein convertase subtilisin 9), ALAS1 (δ-aminolevulinic acid synthase 1), ANGPTL3 (angiopoietin-like protein 3), ApoC3 (apolipoprotein C3); Virus infection-related genes: HBV (conserved region of the hepatitis B virus genome), HIV (key replication gene of human immunodeficiency virus), HCV (hepatitis C virus genome); Cardiovascular disease-related genes: LPA (lipoprotein a gene), Apo(a) (apolipoprotein a); Liver disease-related genes: HSD17B13 (hydroxysteroid 17-β dehydrogenase 13), PNPLA3 (patatin-like phospholipase domain protein 3); Cancer-related genes: KRAS, EGFR, MYC, BCL2, VEGF (vascular endothelial growth factor); Genes associated with nervous system diseases: HTT (huntington protein), SOD1 (superoxide dismutase 1), MAPT (microtubule-associated protein tau); Genes associated with ophthalmic diseases: VEGFA (vascular endothelial growth factor A), C3 (complement component 3); Genes associated with immune diseases: IL-4Rα (interleukin-4 receptor α), IL-5 (interleukin-5), IL-13 (interleukin-13); Kidney disease-related genes: COL4A3 / COL4A4 / COL4A5 (type IV collagen genes); Rare disease-related genes: CFTR (cystic fibrosis transmembrane conduction regulator) and SMN2 (survival motor neuron 2).
[0062] In another preferred embodiment, the disease is selected from the group consisting of: hereditary diseases, metabolic diseases, viral infections, cardiovascular diseases, liver diseases, cancer, nervous system diseases, ophthalmic diseases, immune diseases, kidney diseases, and rare diseases.
[0063] In another preferred embodiment, the disease is selected from the group consisting of: Hereditary diseases: hereditary transthyretin amyloidosis (hATTR), hereditary angioedema (HAE), hemochromatosis; Metabolic diseases: familial hypercholesterolemia, acute hepatic porphyria, hyperlipoprotein(a)emia, hypertriglyceridemia; Viral infections: chronic hepatitis B, HIV infection, hepatitis C; Cardiovascular diseases: atherosclerosis, coronary heart disease, myocardial infarction, ischemic stroke; Liver diseases: non-alcoholic steatohepatitis (NASH), alcoholic liver disease, liver fibrosis; Cancer: Solid tumors (lung cancer, colorectal cancer, pancreatic cancer), hematologic malignancies (leukemia, lymphoma), tumor metastasis suppression; Neurological disorders: Huntington's disease, amyotrophic lateral sclerosis (ALS), tau protein diseases (such as Alzheimer's disease); Ophthalmic diseases: neovascular age-related macular degeneration (nAMD), diabetic retinopathy, geographic atrophy; Immunological diseases: asthma, atopic dermatitis, rheumatoid arthritis, eosinophilic disorders; Kidney diseases: Alport syndrome, diabetic nephropathy, focal segmental glomerulosclerosis (FSGS); Rare diseases: cystic fibrosis, spinal muscular atrophy (SMA), Duchenne muscular dystrophy.
[0064] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Detailed Implementation
[0065] Through extensive and in-depth research, the inventors unexpectedly discovered a novel oligonucleotide-ligand coupling method. This method combines amide formation and photoclick chemical cyclization for the first time. Oligonucleotide-ligand conjugates can be efficiently prepared using oligonucleotides modified with -NH2 or targeting ligands as the reaction starting point, thus realizing the universality of coupling technology.
[0066] the term To facilitate a clearer understanding of this invention, certain technical terms are specifically defined below. Unless otherwise expressly defined elsewhere in this document, the technical terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. The singular forms used herein (including the claims) include their corresponding plural forms, unless otherwise expressly specified herein. Furthermore, it should be noted that whenever a numerical value or range of a parameter is listed, it means that the intermediate values of the listed values and ranges are also part of this invention.
[0067] The terms “including” or “contains” are intended to be used interchangeably with the phrase “including but not limited to”.
[0068] The term "carbohydrate" refers to monosaccharides, disaccharides, trisaccharides, or polysaccharides.
[0069] The term "salt" refers to a molecule that forms a corresponding salt with an organic acid, inorganic acid, or organic base, such as hydrochloric acid, formic acid, trifluoroacetic acid, succinic acid, and methanesulfonate.
[0070] The term "isomer" refers to structural isomers that can easily interconvert through chemical reactions that are isomers of each other. These reactions generally result in the movement of hydrogen atoms or protons, accompanied by the transformation of single bonds and adjacent double bonds.
[0071] The term "monosaccharide" includes allose, maltose, arabinose, cladinose, brown sugar, erythrose, fructose, D-fucoitol, L-fucoitol, fucose succinate, fucose, fucose, galactosamine, D-galactosamine alcohol, N-acetyl-galactosamine, galactose, glucosamine, N-acetyl-glucosamine, glucosamine alcohol, glucose, glucose-6-phosphate, glucose glyceraldehyde, L-glycerol-D-mannose-heptose, glycerol, glycerol, glucose, iodosucrose, lythose, mannose succinate, mannose, mannose-6-phosphate, allose, quinovose, quinovosamine, rhamnitol, rhamnose, ribose, ribulose, heptose, sorbose, tagatose, tartaric acid, threose, xylose, and xylose. Monosaccharides can be D- or L-configured. Monosaccharides can also be deoxyglucoses (hydroxyl groups replaced by hydrogen), aminoglucoses (hydroxyl groups replaced by amino groups), thioglucoses (hydroxyl groups replaced by thiols), CO replaced by CS (or cyclic epoxides replaced by sulfur), selenoglucans, telluroses, azoses (cyclic carbons replaced by nitrogen), iminoglucoses (epoxides replaced by nitrogen), phosphosugars (epoxides replaced by phosphorus), phosphoses (cyclic carbons replaced by phosphorus), C-substituted monosaccharides (hydrogen on non-terminal carbon atoms replaced by carbon), unsaturated monosaccharides, sugar alcohols (carbonyl groups replaced by CHOH groups), aldonic acids (aldehyde groups replaced by carboxyl groups), ketaluronic acids, uronic acids, etc. Amino sugars include monosaccharides, preferably galactosamine, glucosamine, mannosamine, fucose, quinvosamine, neuraminic acid, muramamic acid, lactosidine, acosamine, saccharin, donosamine, desaccharides, froloxamine, carbamosiderin, carnosamine, mannosamine, trehalose, mycosamine, peroxidase, pneumosamine, purine nucleoamine, and rhodamine. It should be understood that monosaccharides, etc., can be further substituted.
[0072] The terms "disaccharide," "trisaccharide," and "polysaccharide" include abequinone sugars, aclabosose, glucosamine, amylopectin, amylose, apigenin, glucosamine, ascomycin, ascorbic acid, flavonoids, cellobiose, cellotrisaccharide, cellulose, chachotrisaccharide, thioethers, chitin, collagen, cyclodextrin, melamine, dextrin, 2-deoxyribose, 2-deoxyglucose, disaccharide, maltose, ketose, evalose, evodia, fructooligosaccharides, galactooligosaccharides, gentianose, gentiobiose, glucan, and sugars. Original, witch hazel, heparin, inulin, isoeuropinogen, isomaltose, isomalttriose, isopentose, polysaccharide, lactose, lactosamine, lactosidine, layered arabinose, levoglucan, levoglucanone, maltose, maltose, mannan oligosaccharide, mannantriose, melibiose, muramamic acid, trehalose, neuraminic acid, black glucose, nigerilamide, sophorose, stachyose, streptococcal sugar, sucrose, trehalose, trehalose. Furthermore, it should be understood that "disaccharide," "trisaccharide," and "polysaccharide" can be further substituted. Disaccharides also include amino sugars and their derivatives, particularly mycosamine sugars derived at the C-4' position or 4-deoxy-3-amino-glucose derived at the C-6' position.
[0073] The term "buffer solution" refers to a solution prepared by a buffer pair consisting of a weak acid and its conjugate base or a weak base and its conjugate acid, which can slow down the change in pH when a certain amount of other substances are added. Including: phosphate-buffered saline (PBS), trimethylolpropanesulfonic acid (TAPS), N,N-bis(2-hydroxyethyl)glycine (Bicine), trimethylolaminomethane (Tris), N-tris(hydroxymethyl)methylaminoacetic acid (Tricine), half-sodium (2-hydroxyethyl)-1-piperazine ethanesulfonate (HEPES4), tri(hydroxymethyl)methyl-2-aminoethanesulfonic acid (TES), (N-morpholino)ethanesulfonic acid (MOPS), piperazine-N,N'-di(2-ethanesulfonic acid) (PIPES), cacodylate, sodium citrate (SSC), 2-morpholinoethanesulfonic acid (MES); or a mixture of one or more of the above buffer solutions with an organic solvent (such as dimethyl sulfoxide, acetonitrile, methanol, etc.); The term "condensing agent" refers to a class of chemical reagents used to promote the condensation reaction between carboxylic acids (or carboxylic acid derivatives) and amines (or ammonia) to form amide bonds (—CO—NH—). Their core function is to activate the carboxyl group (—COOH) of the carboxylic acid, making it more readily react with the nucleophilic amino group (—NH2) of the amine, while reducing side reactions (such as racemization or byproducts caused by overactivation). Examples include: N,N'-dicyclohexylcarbodiimide (DCC), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI), N,N'-diisopropylcarbodiimide (DIC), 1-hydroxybenzotriazole (HOBT), BOP (benzotriazole-1-yloxytris(dimethylamino)phosphonium hexafluorophosphate), 1H-benzotriazole-1-yloxytripyrrolidinyl hexafluorophosphate (PyBOP), and O-(7-azabenzotriazole-1-yl)hexafluorophosphate. -N,N,N',N'-Tetramethylurea (HATU), benzotriazole-N,N,N',N'-tetramethylurea hexafluorophosphate (HBTU), 2-(1H-benzotriazo-L-1-yl)-1,1,3,3-tetramethylurea tetrafluoroborate (TBTU), 1-cyano-2-ethoxy-2-oxoethyleneaminooxy)dimethylaminomorpholinium hexafluorophosphate (COMU), chloro-N,N,N',N'-tetramethylurea (HCTU), etc. The term "modified nucleotide" refers to a nucleotide whose sugar, base, or phosphate backbone has been modified through chemical modification, thereby altering its chemical properties, biological activity, or stability. The modified nucleotide can be selected from the following types: 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxynucleotides, 2'-fluorine, 2'-deoxynucleotides, 2'-methoxyethyl modified nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 2'-alkoxy modified nucleotides, 2'-F-arabinonucleotides, phosphate thioester modified nucleotides, debased nucleotides, morpholinonucleotides and locked nucleotides, and primary amine modified nucleotides.
[0074] The term "primary amine linker at the 3' end of a nucleotide" refers to a nucleotide at the 3' end of an oligonucleotide chain, where the sugar molecule of this nucleotide is attached to a primary amine group at the 3' position via a chemical linker. For example: , Where q1 is an integer from 0 to 10.
[0075] The term "primary amine linker at the 5' end of a nucleotide" refers to a nucleotide at the 5' end of an oligonucleotide chain, where the phosphate group on the sugar molecule is located at the 5' position and linked to a primary amine group via a chemical linker. For example: Where q1 is an integer from 0 to 10.
[0076] The term "primary amine linker located in the middle of the nucleotide's base sequence" refers to the portion of an oligonucleotide chain that is not located at either end, but typically within the region of the nucleotide's base sequence. In this region, the primary amine group is linked to the two phosphate groups of the nucleotide's base portion via a chemical linker. For example: Where q1 is an integer from 0 to 10.
[0077] The term "primary amine-modified oligonucleotide" refers to an oligonucleotide with a primary amine linker located at the 3'-end, 5'-end, or middle of the base sequence of the nucleotide, forming a primary amine-modified oligonucleotide with the desired target sequence (Oligo). The primary amine modification is selected from the following group: , , , ; Where q1 is an integer from 0 to 10.
[0078] The terms "interfering RNA" or "RNAi" or "interfering RNA sequence" include single-stranded RNA (e.g., mature miRNA, ssRNAi oligonucleotide, ssDNAi oligonucleotide) or double-stranded RNA (i.e., double-stranded RNA such as siRNA, dsRNA, shRNA, aiRNA, or precursor miRNA) that, when the interfering RNA is in the same cell as the target gene or sequence, can reduce or inhibit the expression of the target gene or sequence (e.g., by mediating degradation and inhibiting the translation of mRNA complementary to the interfering RNA sequence). Interfering RNA therefore refers to a single-stranded RNA complementary to the target mRNA sequence or a double-stranded RNA formed by two complementary strands or a single self-complementary strand.
[0079] Interfering RNA includes “small interfering RNA” or “siRNA”, each strand of which contains about 15 to about 60 nucleotides (e.g., about 15-60, 15-50, 15-40, 15-30, 15-25, 17-25, 19-25, 17-23, 17-21, 19-23, or 19-21 nucleotides, or 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides). The ranges and lengths listed above, as well as intermediate values, are also conceivable to be part of this invention. In one specific embodiment, the siRNA is chemically synthesized. The siRNA of this invention is capable of silencing the expression of target sequences in vitro and / or in vivo. In other embodiments, the siRNA contains at least one modified nucleotide, for example, the siRNA contains one, two, three, four, five, six, seven, eight, nine, ten, or more modified nucleotides in the double-stranded region.
[0080] Based on their chemical modifications or structural characteristics, antisense oligonucleotides (ASOs) can include, but are not limited to, the following types of chemical modifications: phosphate thioates (PS), which enhance resistance to nucleases and prolong half-life by replacing the oxygen atom in the phosphodiester bond between nucleotides with a sulfur atom; 2'-modified nucleotides, including 2'-O-methyl (2'-OMe), which improves binding affinity; and 2'-fluorine (2'-F), which is often used to enhance RNA binding ability; locked nucleic acids (LNAs), which significantly improve thermal stability and target affinity by "locking" the 2'-oxygen and 4'-carbon of the ribose ring through a methylene bridge; morpholine oligonucleotides (PMOs), which form an electrically neutral backbone by replacing the ribose with a morpholine ring, do not activate RNase H, but have higher stability; and peptide-conjugated ASOs (PPMOs), which enhance cellular uptake efficiency by coupling PMOs with cell-penetrating peptides (CPPs).
[0081] As used herein, the term "pharmaceutically acceptable salt" refers to a salt formed by the compounds of the present invention with an acid or base that is suitable for use as a medicine. Pharmaceutically acceptable salts include both inorganic and organic salts. A preferred class of salts are those formed by the compounds of the present invention with an acid. Suitable acids for forming salts include, but are not limited to: inorganic acids such as hydrochloric acid, hydrobromic acid, hydrofluoric acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, benzoic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, benzenesulfonic acid, and naphthalenesulfonic acid; and amino acids such as proline, phenylalanine, aspartic acid, and glutamic acid.
[0082] Another preferred class of salts are salts formed by the compounds of the present invention with a base, such as alkali metal salts (e.g., sodium or potassium salts), alkaline earth metal salts (e.g., magnesium or calcium salts), ammonium salts (such as lower alkanol ammonium salts and other pharmaceutically acceptable amine salts), such as methylamine salts, ethylamine salts, propylamine salts, dimethylamine salts, trimethylamine salts, diethylamine salts, triethylamine salts, tert-butylamine salts, ethylenediamine salts, hydroxyethylamine salts, dihydroxyethylamine salts, trihydroxyethylamine salts, and amine salts formed from morpholine, piperazine, and lysine, respectively.
[0083] Oligonucleotide-ligand conjugates As used herein, the terms "oligonucleotide-ligand conjugate of the present invention" and "oligonucleotide conjugate of the present invention" are used interchangeably and both refer to the compound of formula I or formula II described in the first aspect.
[0084] This invention provides an oligonucleotide-ligand conjugate of Formula I or Formula II, or a pharmaceutically acceptable salt thereof, or a stereoisomer thereof, or a racemic mixture thereof. Formula I; Formula II; The definitions of R1, L, ONM (oligonucleotides) and TLM (targeting ligands) are as described above.
[0085] Preferably, the oligonucleotide is selected from the group consisting of antisense oligonucleotides (ASO), small interfering RNA (siRNA), DNA oligonucleotides, peptide nucleic acids (PNA), or combinations thereof.
[0086] Preferably, the targeting ligand is selected from the group consisting of lipophiles, carbohydrates, peptides, folic acid, aptamers, antibodies, or combinations thereof.
[0087] Preferably, the targeting ligand targets a receptor on the cell surface; for example, the targeting ligand is a ligand that binds to the desialyl glycoprotein receptor.
[0088] In another preferred embodiment, the nucleotides in the ONM (oligonucleotide) may be modified or unmodified. Furthermore, the backbone of the oligonucleotide may be natural or non-natural.
[0089] Preparation method of oligonucleotide-ligand conjugates The embodiments of this invention specifically describe the preparation methods of the structural compounds of this invention, but these specific methods do not constitute any limitation on this invention. The compounds of this invention can also be conveniently prepared by optionally combining various synthetic methods described in this specification or known in the art, such combinations being readily performed by those skilled in the art.
[0090] Typically, the preparation process of the compounds of the present invention is as follows, wherein the raw materials and reagents used can be purchased commercially unless otherwise specified.
[0091] The present invention provides a method for preparing oligonucleotide-ligand conjugates, the method comprising (R1) amide formation reaction and (R2) photoclick chemical cyclization reaction.
[0092] The method includes the following steps: (a) Providing an ONM reactant and a TLM reactant, wherein the ONM reactant has a first coupling reactive group -NH2, and the TLM reactant has a second coupling reactive group -NH2; (b) The ONM reactant and TLM reactant are reacted with the coupling molecule to form an oligonucleotide-ligand conjugate. The coupling molecule has a third coupling reactive group. , and the fourth coupling reactive group .
[0093] The oligonucleotide-ligand conjugates can be prepared using linking techniques one through six.
[0094] Linkage Technique 1: The oligonucleotide-ligand conjugate shown in Formula I is prepared via the following amide formation-photoclick chemical cyclization reaction linkage technique, comprising the following steps: Oligonucleotides are coupled to o-nitrobenzyl alcohol linker chains containing active esters via amide formation reaction, and then coupled to target ligands via photoclick chemical cyclization reaction to synthesize oligonucleotide-ligand conjugates of Formula I containing indazole backbone linker chains. The definitions of L and R1 are as described above.
[0095] Specifically, the steps of the first connection technology are as follows: (a) A primary amine-modified oligonucleotide is coupled to an o-nitrobenzyl alcohol linker containing an active ester via an amide condensation reaction in a buffer system.
[0096] After the reaction was monitored by HPLC to ensure its completeness, the product was purified by ultrafiltration centrifugation to effectively remove unreacted linker molecules and byproducts.
[0097] (b) The purified product and the buffer containing the primary amine targeting ligand were placed under ultraviolet light to undergo a photoclick chemical cyclization reaction, and then incubated at room temperature to finally obtain the oligonucleotide-ligand conjugate shown in Formula I.
[0098] Linkage Technique 2: The oligonucleotide-ligand conjugate represented by Formula II is prepared via the following amide formation-photoclick chemical cyclization reaction linkage technique 2, comprising the following steps: The targeting ligand is coupled to the o-nitrobenzyl alcohol linker chain containing the active ester via amide formation, and then coupled to the oligonucleotide via photoclick chemical cyclization reaction to synthesize the oligonucleotide-ligand conjugate shown in Formula II with an indazole ketone backbone linker chain. The definitions of L and R1 are as described above.
[0099] Specifically, the steps of the second connection technology are as follows: (a) A primary amine-modified targeting ligand is coupled to an o-nitrobenzyl alcohol linker containing an active ester via an amide condensation reaction in a buffer system at room temperature.
[0100] The reaction was monitored by HPLC and found to be complete, forming an o-nitrobenzyl alcohol-modified oligonucleotide intermediate.
[0101] (b) The intermediate and a commercially available oligonucleotide modified with a primary amine were subjected to photoclick chemical cyclization under ultraviolet light and incubated at room temperature. The resulting oligonucleotide-ligand conjugate was finally obtained.
[0102] Linkage Technique 3: The oligonucleotide-ligand conjugate shown in Formula I is prepared via the following amide formation-photoclick chemical cyclization reaction linkage technique 3, including the following steps: Oligonucleotides are coupled to carboxyl-containing o-nitrobenzyl alcohol linker chains via amide formation reaction, and then coupled to target ligands via photoclick chemical cyclization reaction to synthesize oligonucleotide-ligand conjugates of Formula I containing indazole backbone linker chains. The definitions of L and R1 are as described above.
[0103] Specifically, the steps of the third connection technology are as follows: (a) A primary amine-modified oligonucleotide is coupled to a carboxyl-containing o-nitrobenzyl alcohol linker chain by adding a condensation reagent to a buffer system at room temperature and coupling via an amide condensation reaction.
[0104] After the reaction was monitored by HPLC to ensure its completeness, the product was purified by ultrafiltration centrifugation to effectively remove unreacted linker molecules and byproducts.
[0105] (b) The purified product and a buffer containing a primary amine-based targeting ligand were placed under ultraviolet light to undergo a photoclick chemical cyclization reaction, ultimately yielding the oligonucleotide-ligand conjugate shown in Formula I.
[0106] Linkage Technique Four: The oligonucleotide-ligand conjugate shown in Formula II is prepared via the following amide formation-photoclick chemical cyclization reaction linkage technique four, including the following steps: The targeting ligand is coupled to the carboxyl-containing o-nitrobenzyl alcohol linker chain via an amide formation reaction, and then coupled to the oligonucleotide via a photoclick chemical cyclization reaction to synthesize the oligonucleotide-ligand conjugate shown in Formula II with an indazole ketone backbone linker chain. The definitions of L and R1 are as described above.
[0107] Specifically, the steps of the fourth connection technology are as follows: (a) A primary amine-modified targeting ligand is coupled to a carboxyl-containing o-nitrobenzyl alcohol linker chain by adding a condensation reagent to a buffer system at room temperature via an amide condensation reaction.
[0108] After the reaction was monitored by HPLC and found to be complete, an oligonucleotide intermediate modified with o-nitrobenzyl alcohol was formed.
[0109] (b) The intermediate and a commercially available oligonucleotide containing a primary amine were placed in an ice bath under ultraviolet light to undergo a photoclick chemical cyclization reaction. After incubation at room temperature, the oligonucleotide-ligand conjugate shown in Formula II was finally obtained.
[0110] Linkage Technique 5: The oligonucleotide-ligand conjugate shown in Formula I is prepared via the following photoclick chemical cyclization reaction-amide formation linking technique 5, comprising the following steps: Oligonucleotides are coupled to a carboxyl-containing o-nitrobenzyl alcohol linker chain via a photoclick chemical cyclization reaction, and then coupled to a target ligand via an amide formation reaction to synthesize an oligonucleotide-ligand conjugate containing an indazolone backbone linker chain. The definitions of L and R1 are as described above.
[0111] (a) The primary amine-modified targeting ligand and the carboxyl-containing o-nitrobenzyl alcohol linker were dissolved in a buffer solution, placed in an ice bath, and irradiated with ultraviolet light to undergo a photoclick chemical cyclization reaction, followed by incubation at room temperature.
[0112] (b) After the reaction was completed by HPLC monitoring, a primary amine oligonucleotide ligand and a condensation reagent were added, and the mixture was coupled by amide condensation reaction to finally obtain the oligonucleotide-ligand conjugate shown in Formula I.
[0113] Linkage Technique Six: The oligonucleotide-ligand conjugate represented by Formula II is prepared via the following chemical cyclization reaction – amide formation linkage technique six, comprising the following steps: Oligonucleotides are coupled to a carboxyl-containing o-nitrobenzyl alcohol linker chain via a photoclick chemical cyclization reaction, and then coupled to a target ligand via an amide formation reaction to synthesize an oligonucleotide-ligand conjugate with an indazolone backbone linker chain of formula II. The definitions of L and R1 are as described above.
[0114] Specifically, the steps of the sixth connection technology are as follows: (a) A primary amine-modified oligonucleotide was linked to a carboxyl-containing o-nitrobenzyl alcohol chain, and the chain was placed in an ice bath and irradiated with ultraviolet light to induce a photoclick chemical cyclization reaction, followed by incubation at room temperature. After the reaction was monitored by HPLC to ensure complete reaction, the product was purified by ultrafiltration centrifugation to effectively remove unreacted linker molecules and byproducts.
[0115] (b) The purified product was mixed with a primary amine-containing targeting ligand, and a condensation reagent was added to the buffer system to couple the product via an amide condensation reaction, ultimately obtaining the oligonucleotide-ligand conjugate shown in Formula II.
[0116] Preferably, the primary amine-modified oligonucleotide has a primary amine linker located at the 3'-end, 5'-end, or middle of the base sequence of the nucleotide, forming a primary amine-modified oligonucleotide with the desired target sequence oligonucleotide (Oligo). The primary amine modification is selected from the following group: , , , ; Where q1 and q2 are integers from 0 to 10.
[0117] Preferably, q1 is 4 and q2 is 5.
[0118] Preferably, the primary amine-modified oligonucleotide contains the following structures: (dT-C-NH2), (Int NH2- (C-dT) and (NH2-C-dT), , , ; Where q1 and q2 are integers from 0 to 10.
[0119] Preferably, q1 is 4 and q2 is 5.
[0120] Pharmaceutical Compositions and Administration The pharmaceutical compositions of the present invention comprise, within a safe and effective range, the compound of the present invention or a pharmacologically acceptable salt thereof and a pharmacologically acceptable carrier. "Safe and effective range" refers to an amount of the compound sufficient to significantly improve the condition without causing serious side effects. Typically, the pharmaceutical composition contains 1-2000 mg of the compound of the present invention per dose, more preferably, 10-1000 mg of the compound of the present invention per dose. Preferably, "one dose" is one capsule or tablet.
[0121] In this invention, the pharmaceutical composition comprises an effective amount of a compound of formula I or II according to the invention (as the active ingredient), and at least one pharmaceutically acceptable carrier. In preparation, the active ingredient is typically encapsulated in a carrier that may be in capsule or pouch form.
[0122] "Pharmaceutically acceptable carriers" refers to one or more compatible solid or liquid fillers or gelling substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with and with the compounds of the present invention without significantly reducing the efficacy of the compounds. Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (such as Tween®), wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.
[0123] The pharmaceutical composition is an injection, capsule, tablet, pill, powder, or granule.
[0124] There are no particular limitations on the administration of the compounds or pharmaceutical compositions of the present invention. Representative administration methods include (but are not limited to): oral, intratumoral, rectal, parenteral (intravenous, intramuscular or subcutaneous), and local administration.
[0125] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active compound is mixed with at least one carrier, such as sodium citrate or dicalcium phosphate, or with the following components: (a) fillers or compatibilizers, such as starch, lactose, sucrose, glucose, mannitol, and silica; (b) binders, such as hydroxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and gum arabic; (c) humectants, such as glycerin; (d) disintegrants, such as agar, calcium carbonate, potato starch or cassava starch, alginate, certain complex silicates, and sodium carbonate; (e) slowing agents, such as paraffin wax; (f) absorption accelerators, such as quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glyceryl monostearate; (h) adsorbents, such as kaolin; and (i) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium dodecyl sulfate, or mixtures thereof. Buffers may also be included in capsules, tablets, and pills.
[0126] Solid dosage forms such as tablets, sugar pills, capsules, pellets, and granules can be prepared using coatings and shells, such as casings and other materials known in the art. They may contain opacifying agents, and the release of the active compound or compound from such compositions can be delayed in a portion of the digestive tract. Examples of encapsulating components that can be used are polymeric substances and waxes. If necessary, the active compound may also be formed into microcapsules with one or more of the excipients described above.
[0127] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, or tinctures. In addition to the active compound, liquid dosage forms may contain inert diluents conventionally used in the art, such as water or other solvents, solubilizers and emulsifiers, e.g., ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butanediol, dimethylformamide, and oils, particularly cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil, and sesame oil, or mixtures of these substances.
[0128] In addition to these inert diluents, the composition may also contain auxiliaries such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents and fragrances.
[0129] In addition to the active compound, the suspension may contain suspending agents such as ethoxylated isooctadecyl alcohol, polyoxyethylene sorbitol and dehydrated sorbitol esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these substances.
[0130] Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions, or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents, or excipients include water, ethanol, polyols, and suitable mixtures thereof.
[0131] Dosage forms of the compounds of the present invention for topical administration include ointments, powders, patches, sprays, and inhalers. The active ingredient is mixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants that may be necessary.
[0132] The compounds of this invention can be administered alone or in combination with other pharmaceutically acceptable compounds.
[0133] The treatment method of the present invention can be used alone or in combination with other treatment methods or drugs.
[0134] When using the pharmaceutical composition, a safe and effective amount of the compound of the present invention is applied to the mammal (such as a human) requiring treatment. The dosage administered is the pharmaceutically considered effective dose. For a person weighing 60 kg, the daily dose is typically 1–2000 mg, preferably 50–1000 mg. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of the skills of a skilled physician.
[0135] Compared with the prior art, the main advantages of the present invention are: 1. Improved construction efficiency and accessibility: By adopting PANAC photoclick chemistry, this invention provides an efficient (conversion rate ≥90%), rapid and modular construction strategy that can directly link tGalNAc with commercially available primary amine-modified siRNA, overcoming the problems of low coupling efficiency and byproduct accumulation caused by the large size and branched structure of tGalNAc linkers in traditional solid-phase synthesis methods.
[0136] 2. Reduced production costs: The direct assembly strategy of this invention avoids the complex steps required in traditional solid-phase synthesis to organize linkers on a solid support in advance, simplifying the synthesis process and reducing production costs.
[0137] 3. Enhanced bioactivity: The siRNA-tGalNAc conjugate synthesized using the method of this invention showed comparable or better activity to the reported positive control in experiments targeting the mouse transthyretin (Ttr) gene, demonstrating the potential of this method to improve the therapeutic effect of siRNA.
[0138] 4. Applicable to assembly of a variety of ligands: Due to the mild reaction conditions of PANAC photoclick chemistry and its adaptability to a variety of primary amines, the method of the present invention can be used for post-annealing assembly synthesis with a variety of potential heat-sensitive ligands (such as antibodies, proteins and aptamers), thus broadening the application range of therapeutic oligonucleotide conjugates.
[0139] 5. Overcoming the limitations of existing post-solution phase modification methods: Compared with traditional post-solution phase modification methods, the method of the present invention has the following advantages: 1) Avoid reliance on non-commercial synthesis modules: Existing solution-phase methods, such as ester amidation, often rely on non-commercial synthesis modules, which limits their widespread application.
[0140] 2) Avoid using toxic metal catalysts: For example, copper-catalyzed click chemistry reactions may involve toxic metal catalysts, while PANAC photoclick chemistry does not require such catalysts, reducing potential toxicity risks.
[0141] 3) Avoiding purification complexity caused by the generation of chiral centers: SPAAC reaction may generate chiral centers, which increases the complexity of subsequent purification, while the linker generated by PANAC photoclick chemistry is achiral, which simplifies the purification process.
[0142] 4) Improved yield: Natural chemical linkage (NCL) and mercapto-alkene click reactions may result in moderate yields in some cases, while PANAC photoclick chemistry offers higher conversion and efficiency.
[0143] In summary, this invention provides an efficient, flexible, and cost-effective construction strategy that overcomes many limitations of the prior art and has broad application prospects.
[0144] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only. This invention is intended to illustrate the present invention but not to limit its scope. Experimental methods in the following examples, where specific conditions are not specified... Methods are generally performed under standard conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: ColdSpring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.
[0145] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the methods of this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0146] Solvents and chemicals were purchased commercially. ssDNA was purchased from Sangon Biotech Co., Ltd. (Shanghai, China). siTtr-P, siTtr1, siTtr2, siTtr3, and tGalNAc-1 were purchased from Glycogene (Wuhan, China). Photoinduced reactions were performed using a ZF-7A 365 nm UV lamp (16W, Shanghai Gucun Optical Instrument Factory, Shanghai, China). 1 H NMR spectra and 13 C10 NMR spectra were obtained on a Bruker AVANCE III 400 (400 MHz) and Bruker AVANCE III 500 (500 MHz) NMR spectrometer. Chemical shifts are expressed in parts per million (ppm) on the δ-scale, compared with an internal standard (NMR description: s, singlet; d, doublet; t, triplet; q, quartet; m, multiplet; br, broad peak). Coupling constant J is in Hertz. LC-MS analysis of oligonucleotide molecules was performed on an Agilent 1260 UPLC coupled to an Agilent 6230 QTOF-MS using a Titank C18 column (3 μm, 50 × 2.1 mm, FLM, Guangzhou, China). HR-MS analysis of small molecules was performed using an Agilent 1290-6545 UPLC-QTOF. LC-MS analysis of small molecules was performed using a Waters UPLC-MS (UPLC: Waters HPLC H-CLASS, MS: Waters SQ Detector 2) and an ACQUITYUPLC BEH C18 column (1.7 μm, Waters).
[0147] Preparation of Linker Molecules Example 1: Synthesis of Linker 1 (L1) Compounds 1-2 (800 mg, 3.43 mmol), compound 1-1 (676 mg, 3.43 mmol), and HATU (1.3 g, 3.43 mmol) were dissolved in a dry DMF solution (20 mL), followed by the addition of DIPEA (1.8 mL, 10.29 mmol). The reaction mixture was stirred at room temperature for 2 hours. Water (30 mL) was then added, and the mixture was extracted with ethyl acetate (2 × 50 mL). The combined organic phases were washed sequentially with saturated brine (4 × 40 mL). The resulting organic phase was dried over anhydrous Na₂SO₄ and filtered. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol) to give compounds 1-3 as a yellow oil (922 mg, 73% yield). 1 H NMR (500 MHz, CDCl3) δ 8.48 (d, J = 1.7 Hz, 1H), 8.07 (dd, J = 8.1, 1.7 Hz, 1H), 7.79 (d, J = 8.1 Hz, 1H), 7.52 (s, 1H), 4.99 (s, 2H), 3.70 (t, J = 5.7 Hz, 2H), 3.66 (d, J = 2.2 Hz, 4H), 2.49 (t, J = 5.7 Hz, 2H), 1.39 (s, 9H). 13 C NMR (126 MHz, CDCl3) δ 171.96, 165.57, 147.14, 140.43,134.65, 132.35, 129.35, 123.82, 81.35, 69.08, 65.89, 61.87, 39.90, 35.87,28.10.
[0148] Compounds 1-3 (368 mg, 1 mmol) were dissolved in dichloromethane (5 mL), and trifluoroacetic acid (2 mL) was added. The reaction mixture was stirred at room temperature for 3 hours. The mixture was concentrated under reduced pressure to give compounds 1-4, which were used directly in the next reaction without further purification.
[0149] Subsequently, intermediates 1-4 (1 mmol) were redissolved in dichloromethane (5 mL), and N-hydroxysuccinimide (127 mg, 1.1 mmol), TEA (278 μL, 2 mmol), and EDCI (230 mg, 1.2 mmol) were added sequentially. The reaction mixture was stirred at room temperature for 4 hours, and the reaction was monitored by LC-MS after completion. Water (15 mL) was added to the reaction mixture, and the mixture was extracted with dichloromethane (2 × 30 mL). The combined organic phases were washed with saturated brine (4 × 40 mL). The resulting organic phase was dried over anhydrous Na₂SO₄ and filtered. The filtrate was concentrated under reduced pressure. The residue was purified by pre-prepared thin-layer chromatography (Prep-TLC) to give compound Linker 1 as a brown oil (266 mg, 65% yield). 1 H NMR (500 MHz, CDCl3) δ 8.48 (d, J =1.8 Hz, 1H), 8.20 (dd, J = 8.1, 1.8 Hz, 1H), 7.84 (d, J = 8.1 Hz, 1H), 7.47(s, 1H), 5.02 (s, 2H), 3.85 (t, J = 5.6 Hz, 2H), 3.70 – 3.68 (m, 4H), 2.90 –2.83 (m, 6H). 13 C NMR (126 MHz, CDCl3) δ 169.76, 167.34, 165.25, 147.16,139.90, 134.93, 133.58, 129.69, 123.59, 70.00, 65.90, 62.25, 40.17, 32.79,25.79.HRMS (ESI-Q-TOF): calcd for C 17 H 20 N3O9 [M + H] + 410.1194, found 410.1198.
[0150] Example 2: Synthesis of Linker 2 (L2) The synthetic route was the same as that for intermediate 1, yielding Linker 2 as a brown oily substance of 296 mg, with a yield of 59%. 1 H NMR (500MHz, DMSO) δ 8.99 (t, J= 5.3 Hz, 1H), 8.50 (d, J = 1.6 Hz, 1H), 8.21 (dd, J = 8.1, 1.6 Hz, 1H), 7.94 (d, J = 8.1 Hz, 1H), 5.66 (s, 1H), 4.88 (d, J = 5.5Hz, 2H), 3.60 (dd, J = 12.3, 6.6 Hz, 2H), 3.03 (t, J = 6.8 Hz (2H), 2.81 (s, 4H). 13 C NMR (126 MHz, DMSO) δ 170.14, 167.42, 164.34, 146.56, 141.51, 133.58,132.16, 128.50, 123.13, 59.91, 35.17, 30.27, 25.45. 13 C NMR (126 MHz, DMSO) δ170.13, 167.41, 164.33, 146.56, 141.50, 133.57, 132.16, 128.49, 123.11,59.90, 35.17, 30.27, 25.44. HRMS (ESI-Q-TOF): calcd for C 15 H 14 N3O8 [M - H] - 364.0786, found 364.0788.
[0151] Example 3: Synthesis of Linker 3 (L3) Compound 2 (1.04 g, 5.07 mmol) was dissolved in dry DMF (20 mL), and N-hydroxysuccinimide (0.76 g, 6.59 mmol) and EDCI (1.94 g, 10.14 mmol) were added. The reaction mixture was stirred overnight at room temperature. Water (30 mL) was then added, and the mixture was extracted with ethyl acetate (2 × 60 mL). The combined organic phases were washed successively with saturated brine (4 × 40 mL). The resulting organic phase was dried over anhydrous Na₂SO₄ and filtered. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give intermediate 4 as a yellow solid (1.22 g, 82% yield). 1H NMR (400 MHz, DMSO) δ 8.63 (d, J = 1.7 Hz, 1H), 8.46 (dd, J = 8.2, 1.8 Hz, 1H), 8.15 (d, J = 8.2 Hz, 1H), 4.96(s, 2H), 2.92 (s, 4H). 13 C NMR (101 MHz, DMSO) δ 170.10, 160.37, 146.88, 146.21, 134.42, 129.66, 125.75, 123.77, 60.02, 25.57.
[0152] Example 4: Synthesis of Linker 4 (L4) Compounds 1-2 (400 mg, 2.0 mmol), methyl 4-piperidincarnate (299 mg, 2.0 mmol), and HATU (837 mg, 2.2 mmol) were dissolved in dry DMF (10 mL), and then DIPEA (0.7 mL, 4 mmol) was added. The reaction mixture was stirred at room temperature for 2 hours. Water (30 mL) was then added and the mixture was extracted with ethyl acetate (2 × 30 mL). The combined organic phases were washed sequentially with saturated brine (4 × 30 mL). The resulting organic phases were dried over anhydrous Na₂SO₄ and filtered. The filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (eluent: dichloromethane / methanol) to give a yellow oily intermediate (529 mg, 82% yield).
[0153] The intermediate (529 mg) was dissolved in tetrahydrofuran (8 mL), and an aqueous solution of lithium hydroxide (207 mg, 4.92 mmol) (8 mL) was added. The mixture was reacted at room temperature for 3 hours. The pH was then adjusted to approximately 3 with 1 N hydrochloric acid, and the mixture was extracted with ethyl acetate. The organic layers were combined, and the resulting organic phase was dried over anhydrous Na₂SO₄ and filtered. The filtrate was concentrated under reduced pressure to give a yellow solid (506 mg, 92% yield) of 1-(4-(hydroxymethyl)-3-nitrobenzoyl)piperidine-4-carboxylic acid, which was used directly for the next reaction without further purification.
[0154] 1-(4-(hydroxymethyl)-3-nitrobenzoyl)piperidine-4-carboxylic acid (200 mg, 0.7 mmol) was dissolved in dry DMF (10 mL), and N-hydroxysuccinimide (90 mg, 0.8 mmol) and EDCI (149 mg, 0.8 mmol) were added. The reaction mixture was stirred at room temperature for 4 hours. After the reaction was complete, water (30 mL) was added and the mixture was extracted with ethyl acetate (60 mL). The organic layers were combined, and the resulting organic phase was washed with saturated brine (4 × 30 mL). The resulting organic phase was dried over anhydrous Na₂SO₄ and filtered. The filtrate was concentrated under reduced pressure to give Linker 4 as a yellow solid (188 mg, 71% yield), which was used directly for the next reaction without further purification.
[0155] Example 5: Synthesis of Linker 5 (L5) The synthetic route was the same as that for intermediate 1, yielding intermediate 3 as 115 mg of a brown oily substance, with a yield of 32%. 1 H NMR (500MHz, CDCl3) δ 8.59 – 8.50 (m, 1H), 8.18 – 8.11 (m, 1H), 7.88 (dd, J = 16.1,8.0 Hz, 1H), 5.04 (d, J = 7.3 Hz, 2H), 3.85 (t, J = 5.9 Hz, 1H), 3.78 (dd, J= 10.6, 4.5 Hz, 1H), 3.62-3.72 (m, 11H), 2.85 (t, J = 6.0 Hz, 1H), 2.68 (dd,J = 12.6, 6.5 Hz, 1H), 2.62 – 2.55 (m, 1H).
[0156] Preparation of oligonucleotide-ligand conjugates Example 6: ssDNA-L1-G Add 32 μL of reaction buffer (25 mM PBS buffer) / DMSO = 1:1, pH=10) to a 2 mL centrifuge tube, followed by 4 μL of 1 mmol ssDNA (in 25 mM PBS buffer, pH=8.5) and 4 μL of 50 mM (50 equiv) linker1 in DMSO solution. The reaction mixture was incubated at room temperature with shaking for 1 hour to obtain ssDNA-linker1. The reaction was monitored by LC-Mass, and the reaction was complete with a conversion rate greater than 95%. The reaction mixture was then diluted with ultrapure water to reduce the DMSO concentration to <5%, and ultrafiltered using an Amicon Ultra-0.5 mL centrifuge filter (3k-cutoff, Millipore, model #UFC5003BK) at 13000 ×g to remove small molecules and perform buffer exchange, transferring to photoclick reaction buffer (25 mM PBS buffer, pH 8.5). The mixture was then transferred to a 96-well plate, and 50 mM tGalNAc-1 (50 equiv) was added. The 96-well plate (without the cap) was placed on ice and irradiated with 365 nm light at a distance of 10 mm for 15 minutes. Samples were collected and incubated at 25°C for 1 hour. The reaction was monitored using LC-Mass, and the reaction was complete, yielding ssDNA-L1-G with a conversion rate greater than 95%. ssDNA-L1-G [M] calcd: 8970.6, found: 8969.0.
[0157] Example 7: ssDNA-L2-G The synthetic route and steps were the same as ssDNA-L1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain ssDNA-L2 and ssDNA-L2-G with a conversion rate greater than 95%. ssDNA-L2-G [M] calcd: 8926.6, found: 8925.0.
[0158] Example 8: ssDNA-L3-G The synthetic route and steps were the same as for ssDNA-L1-G. The reaction was monitored using LC-Mass, and the reaction was completed to obtain ssDNA-L3-G with a conversion rate greater than 95%. ssDNA-L3-G [M] calcd: 8855.6, found: 8854.0.
[0159] Example 9: ssDNA-L4-G The synthetic route and steps were the same as for ssDNA-L1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain ssDNA-L4 and ssDNA-L4-G with a conversion rate greater than 95%. ssDNA-L4-G [M] calcd: 8965.7, found: 8965.5.
[0160] Example 10: G-L3-ssDNA Add 76 μL of reaction buffer (25 mM PBS buffer / DMSO = 1:1, pH=10) to a 2 mL centrifuge tube, followed by 2 μL of 1 mmol 200 mM tGalNAc-1 DMSO solution and 2 μL of 200 mM linker3 DMSO solution. Shake the reaction mixture at room temperature for 1 hour to obtain G-L3. The reaction was monitored by LC-Mass, and the reaction was complete with a conversion rate greater than 95%. Mix 8 μL of G-L3, 2 μL of ssDNA, and 8 μL of 25 mM PBS buffer (pH=8.5) and transfer to a 96-well plate. Place the 96-well plate on ice and irradiate with 365 nm light at a distance of 10 mm for 15 minutes. Collect the sample and incubate at 25°C for 1 hour. The reaction was monitored by LC-Mass, and the reaction was complete to obtain ssDNA-L3-G with a conversion rate greater than 95%. G-L3-ssDNA [M] calcd: 8854.7.7, found: 8854.0.
[0161] Example 11: ssDNA-L1-LA The synthetic route and steps are the same as ssDNA-L1-G. The reaction was monitored using LC-Mass, and the reaction was completed to obtain ssDNA-L1-LA. ssDNA-L1-LA [M] calcd: 7948.7, found: 7949.0.
[0162] Example 12: ssDNA-L1-FA The synthetic route and steps were the same as ssDNA-L1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain ssDNA-L1-FA with a conversion rate of 97%. ssDNA-L1-LA [M] calcd: 8011.7, found: 8012.4.
[0163] Example 13: ssDNA-L1-CHOL The synthetic route and steps are the same as ssDNA-L1-G. The reaction was monitored using LC-Mass, and the reaction was completed to obtain ssDNA-L1-CHOL. ssDNA-L1-CHOL [M] calcd: 8002.8, found: 8002.5.
[0164] Example 14: ssDNA-L1-CRGDfK The synthetic route and steps were the same as ssDNA-L1-G. The reaction was monitored using LC-Mass, and the reaction was completed to obtain ssDNA-L1-CRGDfK with a conversion rate greater than 95%. ssDNA-L1-CHOL [M] calcd: 8044.7, found: 8044.0.
[0165] Example 15: ssDNA-L1-NGR The synthetic route and steps were the same as ssDNA-L1-G. The reaction was monitored using LC-Mass, and the reaction was completed to obtain ssDNA-L1-NGR with a conversion rate greater than 95%. ssDNA-L1-NGR [M] calcd: 7932.6, found: 7932.2.
[0166] Example 16: ssDNA-L1-Anti-MUC1 The synthetic route and steps were the same as ssDNA-L1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain ssDNA-L1-Anti-MUC1 with a conversion rate of 96%. ssDNA-L1-Anti-MUC1 [M] calcd: 15355.4, found: 15355.6.
[0167] Example 17: siTtr1-Linker1-G A solution of 2 mmol siTtr1 (in 25 mM PBS buffer, pH 8.5) and 10 mM linker1 (5 equiv) in DMSO were added to a reaction buffer (25 mM PBS buffer / DMSO = 1:1, pH 10). The reaction mixture was then shaken at room temperature for 1 hour to obtain siTtr1-linker1. The reaction was monitored by LC-Mass, and the reaction was complete with a conversion greater than 95%. The reaction mixture was then diluted with ultrapure water to reduce the DMSO concentration to <5%, and ultrafiltered using an Amicon Ultra-0.5 mL centrifuge filter (3k-cutoff, Millipore, model #UFC5003BK) at 13000 ×g to remove small molecules and perform buffer exchange, transferring to photoclick reaction buffer (25 mM PBS buffer, pH 8.5). The mixture was then transferred to a 96-well plate, and 20 mM tGalNAc-1 (20 equiv) was added. The 96-well plate (without the cap) was placed on ice and irradiated with 365 nm light at a distance of 10 mm for 15 minutes. Samples were collected and incubated at 25 °C for 1 hour. The reaction was monitored by LC-Mass, and the reaction was complete with a conversion of 95%. siTtr1-Linker1-G [M+Na+4K-5H] calcd: 17278.5, found: 17279.2.
[0168] Example 18: siTtr1-Linker3-G The synthetic route and steps were the same as for siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siTtr1-Linker3-G with a conversion rate of 95%. siTtr1-Linker3-G [M+Na+4K-5H]: calcd: 17163.3 found: 17163.8.
[0169] Example 19: siTtr2-Linker1-G The synthetic route and steps were the same as for siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siTtr2-Linker1-G with a conversion rate of 93%. siTtr2-Linker1-G [M+Na+4K-5H] calcd: 17253.5, found: 17253.7.
[0170] Example 20: siTtr2-Linker2-G The synthetic route and steps were the same as siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siTtr2-Linker2-G with a conversion rate of 90%. siTtr2-Linker2-G [M+Na+4K-5H] calcd: 17209.5, found: 17209.8.
[0171] Example 21: siTtr2-Linker3-G The synthetic route and steps were the same as siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siTtr2-Linker3-G with a conversion rate of 91%. siTtr2-Linker3-G [M+Na+4K-5H] calcd: 17138.4, found: 17138.6.
[0172] Example 22: siTtr3-Linker1-G The synthetic route and steps were the same as for siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siTtr3-Linker1-G with a conversion rate of 92%. siTtr3-Linker1-G [M+Na+4K-5H] calcd: 17253.5, found: 17253.7.
[0173] Example 23: siTtr3-Linker3-G The synthetic route and steps were the same as siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siTtr3-Linker3-G with a conversion rate of 90%. siTtr3-Linker3-G [M+Na+4K-5H] calcd: 17138.4, found: 17138.6.
[0174] Example 24: siSmpd3-1-Linker3-G The synthetic route and steps were the same as siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siSmpd3-1-Linker3-G with a conversion rate of 90%. siSmpd3-1-Linker3-G [M] calcd: 15637.2, found:15637.9.
[0175] Example 25: siSmpd3-1-Linker1-G The synthetic route and steps were the same as for siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siSmpd3-1-Linker1-G with a conversion rate of 92%. siSmpd3-1-Linker1-G [M] calcd: 15752.3, found:15753.2.
[0176] Example 26: siSmpd3-2-Linker3-G The synthetic route and steps were the same as for siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siSmpd3-2-Linker3-G with a conversion rate of 97%. siSmpd3-2-Linker3-G [M] calcd: 15637.2, found:15637.9.
[0177] Example 27: siSmpd3-2-Linker1-G The synthetic route and steps were the same as for siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siSmpd3-2-Linker1-G with a conversion rate of 93%. siSmpd3-2-Linker1-G [M] calcd: 15752.3, found:15753.2.
[0178] Example 28: siSmpd3-3-Linker3-G The synthetic route and steps were the same as siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siSmpd3-3-Linker3-G with a conversion rate of 91%. siSmpd3-3-Linker3-G [M] calcd: 15732.4, found:15733.0.
[0179] Example 29: siSmpd3-13-Linker3-G The synthetic route and steps were the same as for siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siSmpd3-13-Linker3-G with a conversion rate of 98%. siSmpd3-13-Linker3-G [M] calcd: 15692.4, found: 15692.9.
[0180] Example 30: siSmpd3-13-Linker1-G The synthetic route and steps were the same as for siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siSmpd3-13-Linker1-G with a conversion rate of 92%. siSmpd3-13-Linker1-G [M] calcd: 15807.5, found: 15808.2.
[0181] Example 31: siSmpd3-14-Linker3-G The synthetic route and steps were the same as for siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siSmpd3-14-Linker3-G with a conversion rate of 95%. siSmpd3-14-Linker3-G [M] calcd: 151480.0, found: 15148.5.
[0182] Example 32: siSmpd3-19-Linker3-G The synthetic route and steps were the same as siTtr1-Linker1-G. The reaction was monitored by LC-Mass, and the reaction was completed to obtain siSmpd3-19-Linker3-G with a conversion rate of 95%. siSmpd3-19-Linker3-G [M] calcd: 15652.3, found: 15652.8.
[0183] Example 33: Conversion rate of siTtr molecules after being linked with coupling molecules Example 34: Conversion rate of photoclick chemical cyclization reaction of siTtr-Linkers with ligand tGalNAc-1 Example 35: Conversion rate of siSmpd3 molecules after being linked with coupling molecules Example 36: Conversion rate of photoclick chemical cyclization reaction of siSmpd3-Linkers with ligand tGalNAc-1 Biological testing experiments Example 37 In vivo gene silencing experiment Experimental Methods: Male C57BL / 6 mice (6-7 weeks old, n=4 per group) were administered the drug subcutaneously at a volume of 0.1 mL / 10 g body weight. All siRNA compounds were administered at three doses: 0.5, 1.5, and 5 mg / kg. Control mice (n=4) were injected with PBS. Liver tissue was collected 120 hours after administration and frozen at -80°C. 20 mg of frozen mouse liver tissue was ground and resuspended in 1 mL Trizol (Takara Bio, Japan). 100 mL of chloroform was added to each sample, mixed, and allowed to stand at room temperature for 5 minutes. The sample was centrifuged at 12,000 g for 15 minutes at 4°C, and the supernatant was transferred to a new tube. 1.5 volumes of 100% isopropanol were added. RNA was purified using an EZ-10 centrifuge column (Shanghai Sangon Biotech, China), and RNA concentration and purity were determined using NanoDrop (ThermoFisher Scientific, USA). cDNA was synthesized using the Hifair Advance Fast First-Strand cDNA Synthesis Kit (Yisheng Biotechnology, China) with 500 ng of total RNA as a template. Detection was performed using the Hieff qPCR SYBR MasterMix (Yisheng Biotechnology, China) on an ABI 7500 Fast real-time quantitative PCR system. The reaction program was: 95℃ pre-denaturation for 5 minutes, followed by 40 cycles (95℃ for 10 seconds, 60℃ for 30 seconds). The relative expression level of transthyretin (Ttr) mRNA was calculated using the ddCt method with glyceraldehyde-3-phosphate dehydrogenase (Gapdh) as an internal reference gene.
[0184] The primer sequences are as follows: mTtr (Forward primer: 5'-TTGCCTCGCTGGACTGGTA-3' (SEQ ID No: 6); Reverse primer: 5'-TTACAGCCACGTCTACAGCAG-3' (SEQ ID No: 7)); mGapdh (Forwardprimer:: 5'-TGACCTCAACTACATGGTCTACA-3' (SEQ ID No: 8); Reverse Primer: 5'-CTTCCCATTCTCGGCCTTG-3' (SEQ ID No: 9)) Results: The in vivo pharmacological properties of the prepared siRNA-tGalNAc conjugate (Table 1) in a mouse model were evaluated and compared with those of the parent conjugate siTtr-P, which served as a positive control. Five days after subcutaneous injection of three doses (0.5, 1.5, and 5 mg / kg) of the conjugate, Ttr mRNA levels were analyzed. Compared with phosphate-buffered saline (PBS) treatment (negative control), the positive control siTtr-P showed a dose-dependent effect, inhibiting Ttr levels by 10.0% at a dose of 5 mg / kg.
[0185] At doses of 0.5 and 1.5 mg / kg, siTr1-Linker3-G exhibited higher inhibitory activity against Ttr than siTtr-P (Ttr level, 41.8% vs 52.5%; 29.2% vs 35.7%), indicating higher delivery efficiency for ASGPR. Furthermore, siTtr1-linker1-G, siTtr2-linker1-G, siTtr2-linker2-G, and siTtr2-linker3-G also showed significant inhibitory activity; at high doses (5 mg / kg), all three conjugates (siTr1-Linker3-G, siTtr2-linker1-G, and siTtr2-linker2-G) showed significant inhibitory activity, with siTtr2-Linker1-G exhibiting the best activity (Ttr level, 7.8% vs 10.0%).
[0186] Table 1. Evaluation of the activity of the prepared siTtr-tGalNAc in inhibiting Ttr mRNA expression in a mouse model. The structure of siTtrP is as follows: Its sequence is: Chain of Justice: mA*mA*mCAfGmUfGfUfUmCmUmUmGmCmUmCmUmAmUmAmAdTdT antisense chain: mU*fU*mAmUmAfGmAfGfCmAmAmGmAfAmCfAmCmUmGmUmU*mU*mU These results collectively demonstrate that the siRNA-tGalNAc conjugates described in this invention can effectively deliver siRNA drugs to the liver and convert them into significant Ttr knockdown, thus highlighting that the oligonucleotide-ligand conjugation method described in this invention can not only prepare siRNA-tGalNAc conjugates with strong in vivo pharmacological potency, but also verify the effectiveness of the conjugation technology platform involved.
[0187] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.
Claims
1. An oligonucleotide-ligand conjugate of Formula I or Formula II, or a pharmaceutically acceptable salt thereof, or a stereoisomer thereof, or a racemic mixture thereof, Formula I; Formula II; in, (or ONM) indicates an oligonucleotide moiety; (or TLM) indicates the target ligand portion; L is either absent or L is a linking group; R1 represents 0-3 substituents, each independently selected from the group consisting of: D, halogen, -NO2, -CN, -OH, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C2-C6 alkoxy, substituted or unsubstituted C1-C6 cycloalkyl, substituted or unsubstituted C3-C8 heterocycloalkyl, substituted or unsubstituted C3-C8 heterocycloalkyl containing 1-3 heteroatoms selected from N, O, or S, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 5-7 heteroaryl containing 1-3 heteroatoms selected from N, O, or S, -C(O)R6; the substitution refers to substitution by one or more substituents selected from the group consisting of: halogen, -CN, -NO2, C1-C6 alkyl, C1-C6 haloalkyl, -OH, C1-C6 alkoxy, oxo (=O); R6 is selected from the following group: H, -OH, -NH2, C1-C6 alkyl, C1-C6 alkoxy; This indicates the location of the connections between the various parts of the structure.
2. The oligonucleotide-ligand conjugate as described in claim 1, characterized in that, In this context, L represents either the absence of a component or a divalent linker selected from the following groups: 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 、 ; n1, n3, n4, n6, n7, n8, n9, n 10 n 12 n 13 n 14 n 15 n 16 n 18 n 19 n 20 n 23 n 25 n 31 n 32 n 33 and n 41 Each is an independent integer from 0 to 10; n2, n5, n 11 n 17 n 21 n 22 n 24 n 26 n 27 n 28 n 29 n 30 n 34 n 35 n 36 n 37 n 38 n 39 n 40 and n 42 Each is an independent integer from 1 to 10; X1 and X2 are each independently selected from the following groups: -CH-, -N-; X3 is selected from the following group: -O-, -S-; X4 is selected from the following groups: -O-, -NH-; Y is selected from the following groups: -CH-, -N-; Z is selected from the following group: not present, -CH2-; m1, m2, and m3 are each independently selected from the following groups: 0, 1, and 2.
3. The oligonucleotide-ligand conjugate as described in claim 1, characterized in that, The oligonucleotide-ligand conjugates were prepared by (a) an amide formation reaction and (b) a photoclick chemical cyclization reaction; and / or The oligonucleotides are selected from the group consisting of: antisense oligonucleotides (ASO), small interfering RNA (siRNA), aptamers, microRNAs (miRNA), small activating RNAs (saRNA), CpG oligonucleotides, DNA oligonucleotides, peptide nucleic acids (PNA), or combinations thereof; and / or The targeting ligand is selected from the group consisting of liposomes, carbohydrates, peptides, folic acid, aptamers, antibodies, or combinations thereof.
4. The oligonucleotide-ligand conjugate as described in claim 1, characterized in that, The structure of the targeting ligand is selected from the following group: 、 、 、 、 、 、 、 、 、 、 、 、 、 ; Among them, p1, p2, p3, p4, p5, p6, p7, p8, p9, p 10 Each is an independent integer from 0 to 7; Wavy lines ( () refers to the position where the target ligand is connected to the rest of the oligonucleotide-ligand conjugate; Indicates antibody.
5. The oligonucleotide-ligand conjugate as described in claim 1, characterized in that, Its structure is selected from the following group: in, This indicates a single-stranded oligonucleotide modified with a primary amine. This indicates a primary amine-modified double-stranded oligonucleotide.
6. A method for preparing an oligonucleotide-ligand conjugate, characterized in that, Includes the following steps: (a) Providing a primary amine-modified oligonucleotide ON and a primary amine-modified targeting ligand TL, wherein the primary amine-modified oligonucleotide ON has a first coupling reactive group -NH2, and the primary amine-modified targeting ligand TL has a second coupling reactive group -NH2. (b) The primary amine-modified oligonucleotide ON and the primary amine-modified targeting ligand TL are reacted with the coupling molecule to form an oligonucleotide-ligand conjugate. The coupling molecule has a third coupling reactive group. , and the fourth coupling reactive group .
7. The method as described in claim 6, characterized in that, Step (b) includes the following steps: (b1) A primary amine-modified oligonucleotide ON is coupled with a compound of formula I-a1 or I-a2 to prepare a compound of formula Ib; and (b2) Compound Ib is prepared by photoclick chemical cyclization reaction with a primary amine-modified targeting ligand TL; or (b1) The primary amine-modified targeting ligand TL is coupled with a compound of formula I-a1 or I-a2 to prepare a compound of formula II-b; and (b2) Compound II-b was prepared by photoclick chemical cyclization reaction with primary amine-modified oligonucleotide ON; In each formula, R1, L, ONM and TLM are defined as described above.
8. The method as described in claim 6, characterized in that, The method is synthesis method one, two, three, or four: The synthesis method one includes the following steps: (M1a) The primary amine-modified oligonucleotide ON is coupled with a compound of formula I-a1 or I-a2 in a buffer system via an amide condensation reaction to form a compound of formula Ib. (M1b) The compound of formula Ib and the buffer of the primary amine-modified targeting ligand TL were placed under ultraviolet light to undergo a photoclick chemical cyclization reaction to form the oligonucleotide-ligand conjugate shown in formula I. Synthesis method two includes the following steps: (M2a) The primary amine-modified targeting ligand TL is coupled with a compound of formula I-a1 or I-a2 in a buffer system via an amide condensation reaction to form an o-nitrobenzyl alcohol-modified oligonucleotide intermediate of formula II-b. (M2b) The intermediate compound of formula II-b and the oligonucleotide ON containing primary amine modification are placed under ultraviolet light to undergo a photoclick chemical cyclization reaction to form the oligonucleotide-ligand conjugate shown in formula II; Synthesis method three includes the following steps: (M3a) The primary amine-modified targeting ligand TL reacts with compound of formula I-a2 to form compound of formula III-b, under the same reaction conditions as step (M1b) of the synthetic method. (M3b) Compound I is formed by reacting the III-b compound with a primary amine-modified oligonucleotide ON, under the same reaction conditions as step (M1a) of the synthetic method. Synthesis Method Four: (M4a) The oligonucleotide ON modified with a primary amine reacts with compound I-a2 to form compound IV-b, under the same reaction conditions as step (M1b) of the synthetic method. (M4b) Compound of formula IV-b is reacted with a primary amine-modified targeting ligand TL to form compound of formula II, under the same reaction conditions as step (M1a) of the synthetic method. In each formula, R1, L, ONM and TLM are defined as described above.
9. A pharmaceutical composition, characterized in that, Include: (i) The oligonucleotide-ligand conjugate as described in any one of claims 1-5, or a pharmaceutically acceptable salt thereof, or a stereoisomer thereof, or a racemic mixture thereof; as well as (ii) Pharmaceutically acceptable carriers.
10. Use of the oligonucleotide-ligand conjugate according to claim 1, characterized in that, Used in the preparation of a drug; preferably, the drug is used for the prevention and / or treatment of gene-mediated diseases or conditions.