Tumor haptens and tumor holotoxins based on tyrosine-acetylgalactosamine and fluorinated derivatives thereof, methods of preparation and use

Abstract

The application belongs to the technical field of tumor immunity, and particularly relates to a kind of tumor hapten and tumor complete antigen based on tyrosine-acetyl galactosamine and fluorine derivative thereof, preparation method and application.The tumor hapten provided in the application has the structure shown in formula I.A specific substituent group is introduced on tyrosine-acetyl galactosamine in the application, which can reduce the recognition of glycoside hydrolase and improve the metabolic stability thereof.The tumor complete antigen obtained by coupling with carrier protein Qbeta can induce higher antibody titer in mice in vivo, and shows preference for IgG, and shows stronger T cell activation capacity;Meanwhile, the serum antibody generated by immunization has stronger recognition and killing of tumor cells;The serum of mice immunized by vaccine can better recognize and bind tumor cells CT26-KO;In addition, it shows significant CDC and ADCP effects, and shows potential killing of tumor cells.Formula I.

Description

Technical Field

[0001] This invention belongs to the field of tumor immunology technology, specifically relating to a class of tumor haptens and complete tumor antigens based on tyrosine-acetylgalactosamine and its fluorinated derivatives, their preparation methods, and applications. Background Technology

[0002] The glycosylation patterns exhibited by tumor cells, which differ from those of normal cells, make tumor-associated glycoantigens (TACAs) important targets for tumor immunotherapy. In recent years, various TACAs, such as Tn, sTn, and TF, have been discovered and used in tumor immunotherapy. However, due to their low immunogenicity, metabolic instability, and high immune tolerance, no tumor immunotherapy targeting TACAs has yet been approved by the FDA.

[0003] Recently, a new class of TACAs has been discovered, namely those linked to tyrosine residues. N -Acetylgalactosamine (Tyr-GalNAc). It was first discovered in amyloid β in Alzheimer's disease, and is known for its tyrosine-linked structure. O - Sugars enable them to bind normally to serine or threonine. O - Glycophase differentiation. Monoclonal antibodies can be generated by inducing the use of Tyr-GalNAc mimics. Researchers have found that this type of antigen is highly expressed in a variety of tumor cells and has the potential to become a new class of TACAs applicable to tumor immunotherapy and reducing off-target effects. Summary of the Invention

[0004] The purpose of this invention is to provide a class of tumor haptens and complete tumor antigens based on tyrosine-acetylgalactosamine and its fluorinated derivatives, their preparation methods, and applications. The tumor haptens and complete tumor antigens provided by this invention have strong metabolic stability and immunogenicity, exhibiting excellent T cell activation ability and significant tumor prevention effects.

[0005] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a class of tumor haptens based on tyrosine-acetylgalactosamine and its fluorinated derivatives, having the structure shown in Formula I: Formula I; R1 is selected from -OH or F, and R2 is selected from -CH3, -CH2F, -CHF2 or -CF3.

[0006] Preferably, when R1 is -OH, R2 is selected from -CH3, -CH2F, -CHF2 or -CF3; when R1 is F, R2 is selected from -CH3.

[0007] This invention provides a method for preparing tumor haptens based on tyrosine-acetylgalactosamine and its fluorinated derivatives, as described in the above technical solution, comprising the following steps: Compound 7, trifluoroacetic acid, and an organic solvent were mixed and reacted to obtain compound 8; Compound 8, HATU, DIEA, ethanolamine, and an organic solvent were mixed and reacted to obtain compound 9; Compound 9 was reacted with an ammonia-methanol solution in a protective gas atmosphere to obtain compound 10; Compound 10, adipic acid di( N The 1,2-hydroxysuccinimide ester (diNHS) and an organic solvent are mixed and reacted to obtain the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives; The chemical structures of compounds 7, 8, 9, and 10 are as follows: , , , .

[0008] Preferably, compound 7 is selected from compound 7a, compound 7b, compound 7c, compound 7d or compound 7e; The preparation method of compounds 7b, 7c, and 7d includes the following steps: mixing compound 6, zinc powder, and acetic acid to react and obtain an intermediate product; mixing the intermediate product and a fluorine-containing raw material in an organic solvent to react and obtain compounds 7b, 7c, and 7d. The fluorine-containing raw material used to prepare compounds 7b, 7c, and 7d is selected sequentially from fluoroacetic acid (CH2FCO2H), difluoroacetic acid (CHF2CO2H), and trifluoroacetic anhydride (TFAA). The preparation method of compound 7e includes the following steps: mixing compound 18, acetic anhydride-acetic acid organic solution and zinc powder and reacting them to obtain compound 7e; , , , , , , .

[0009] This invention provides a class of complete tumor antigens based on tyrosine-acetylgalactosamine and its fluorinated derivatives, which are obtained by conjugating the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives prepared by the above-described technical solution or the preparation method described above with virus-like particles.

[0010] Preferably, the virus-like particles are Qβ virus-like particles.

[0011] This invention provides a method for preparing complete tumor antigens based on tyrosine-acetylgalactosamine and its fluorinated derivatives as described in the above technical solution, comprising the following steps: A buffer solution of virus-like particles and a hapten solution are mixed and incubated to obtain a complete tumor antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives. The hapten solution includes the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives and an organic solvent.

[0012] The present invention provides the application of the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives, or the tumor complete antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives, as described in the above-mentioned technical solutions, in the preparation of tumor vaccines.

[0013] Preferably, the tumor vaccine includes a colon adenocarcinoma tumor vaccine, a melanoma tumor vaccine, or a breast cancer tumor vaccine.

[0014] This invention provides a tumor vaccine based on tyrosine-acetylgalactosamine and its fluorinated derivatives, comprising the complete tumor antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives as described in the above technical solution.

[0015] This invention provides a class of tumor haptens (Tyr-GalNAc haptens) based on tyrosine-acetylgalactosamine and its fluorinated derivatives, having the structure shown in Formula I. Wherein, R1 is selected from -OH or F, and R2 is selected from -CH3, -CH2F, CHF2, or CF3. This invention... N Introducing specific substituents (including fluorinated groups) at the C-2 and C-6 positions of acetylgalactosamine effectively improves the structural stability of the hapten and reduces its hydrolysis in vivo.

[0016] This invention provides a class of complete tumor antigens based on tyrosine-acetylgalactosamine and its fluorinated derivatives. These are obtained by conjugating the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives, prepared by the methods described above, with virus-like particles (VLPs). This invention links the Tyr-GalNAc hapten to virus-like particles via a flexible alkane chain, making it a complete antigen, thereby enhancing its immunogenicity. High immunogenicity allows for a higher proportion of T cell activation and a stronger immune response.

[0017] This invention provides a tumor vaccine based on tyrosine-acetylgalactosamine and its fluorinated derivatives, comprising the complete tumor antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives as described in the above-mentioned technical solution. The tumor vaccine provided by this invention can activate a strong immune response and has tumor preventive effects, providing new technical support for the development of Tyr-GalNAc-based immunotherapies.

[0018] In summary, compared with the prior art, the present invention has the following beneficial effects: The tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives provided by this invention introduces specific substituent groups (including fluorinated groups) on tyrosine-acetylgalactosamine, which can reduce the recognition of glycoside hydrolases and improve their metabolic stability, thereby exhibiting stronger metabolic stability.

[0019] The tumor complete antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives provided by this invention has stronger immunogenicity, can induce higher antibody titers in mice, and shows a preference for IgG, demonstrating its stronger T cell activation ability.

[0020] The serum antibodies generated by immunization with the tumor vaccine based on tyrosine-acetylgalactosamine and its fluorinated derivatives provided by this invention exhibit stronger recognition and killing effects on tumor cells. Results from the examples show that mouse serum immunized with the tumor vaccine provided by this invention can better recognize and bind to CT26-KO tumor cells; in addition, it exhibits significant CDC and ADCP effects, demonstrating potential tumor cell killing.

[0021] The tumor vaccine based on tyrosine-acetylgalactosamine and its fluorinated derivatives provided by this invention has significant tumor prevention effects. The results of the examples show that the tumor vaccine based on tyrosine-fluoroacetylgalactosamine provided by this invention significantly inhibits the increase of tumor volume in mice and improves mouse survival rate, demonstrating significant tumor prevention effects. Attached Figure Description

[0022] Figure 1 For compound 11a in heavy water 1 H NMR spectrum (600 MHz); Figure 2 For compound 11a in heavy water 13 C NMR spectrum (101 MHz); Figure 3 For compound 11b in heavy water 1 H NMR spectrum (400 MHz); Figure 4For compound 11b in heavy water 13 C NMR spectrum (101 MHz); Figure 5 For compound 11b in heavy water 19 F NMR spectrum (376 MHz); Figure 6 For compound 11c in heavy water 1 H NMR spectrum (400 MHz); Figure 7 For compound 11c in heavy water 13 C NMR spectrum (101 MHz); Figure 8 For compound 11c in heavy water 19 F NMR spectrum (376 MHz); Figure 9 For compound 11d in heavy water 1 H NMR spectrum (400 MHz); Figure 10 For compound 11d in heavy water 13 C NMR spectrum (101 MHz); Figure 11 For compound 11d in heavy water 19 F NMR spectrum (376 MHz); Figure 12 For compound 11e in heavy water 1 H NMR spectrum (400 MHz); Figure 13 For compound 11e in heavy water 13 C NMR spectrum (101 MHz); Figure 14 For compound 11e in heavy water 19 F NMR spectrum (376 MHz); Figure 15 ESI-TOF mass spectrometry characterization of Qβ particle monomers and Qβ-Tyr-GalNAc series conjugate monomers; Figure 16 DLS characterization data for Qβ particles and Qβ-Tyr-GalNAc series conjugates; Figure 17 TEM transmission electron microscopy images of Qβ particles and Qβ-Tyr-GalNAc series conjugates (scale bar: 50 nm). Figure 18 The figure shows the antibody titer test results after immunizing mice with the Qβ-Tyr-GalNAc series conjugates prepared in this invention; Figure 19 This is the result of flow cytometry analysis of the binding of post-immunization serum to the CT26-KO cell line expressing Tyr-GalNAc antigen, as described in this invention. Figure 20 In this invention, the mixed immunized serum showed CDC in CT26-KO, B16F10-KO and 4T1-KO cells, and ADCP in CT26-KO cells. Figure 21 The results of the tumor prevention efficacy test of the vaccine in this invention; Figure 22 This is a flowchart illustrating the overall chemical synthesis of tumor haptens based on tyrosine-acetylgalactosamine and its fluorinated derivatives in this invention. Figure 23 The flowchart shows the synthesis process of fluorine-free modified tyrosine acetaminogalactosamine in the examples. Figure 24 The flowchart shows the synthesis of 2-fluorine modified tyrosine acetaminogalactosamine in the examples. Figure 25 The flowchart shows the synthesis of tyrosine acetaminogalactosamine with monofluoride modification at the six-position in the examples. Figure 26 The flowchart shows the synthesis process of tumor haptens based on tyrosine-acetylgalactosamine and its fluorinated derivatives in the examples. Figure 27 The flowchart shown is a synthesis process of tumor complete antigens based on tyrosine-acetylgalactosamine and its fluorinated derivatives in the examples. Detailed Implementation

[0023] This invention provides a class of tumor haptens based on tyrosine-acetylgalactosamine and its fluorinated derivatives, having the structure shown in Formula I: ; R1 is selected from -OH or F, and R2 is selected from -CH3, -CH2F, -CHF2 or -CF3.

[0024] In this invention, when R1 is -OH, R2 is selected from -CH3, -CH2F, -CHF2, or -CF3. When R1 is F, R2 is selected from -CH3.

[0025] In this invention, R1 is -OH and R2 is -CH3, that is... N -( N -Hydroxysuccinyl adipic acid)- O -(2-Deoxy-2-acetamido- α -D-galactosyl)-L-tyrosine ethanolamide (NHS-Tyr-GalNAc), denoted as compound 11a.

[0026] In this invention, R1 is -OH and R2 is -CH2F, that is... N -( N -Hydroxysuccinyl adipic acid)- O -(2-Deoxy-2-fluoroacetamido- α -D-galactosyl)-L-tyrosine ethanolamide (NHS-Tyr-GalNFAc), denoted as compound 11b.

[0027] In this invention, R1 is -OH and R2 is -CHF2, that is... N -( N -Hydroxysuccinyl adipic acid)- O -(2-Deoxy-2-difluoroacetamido- α -D-galactosyl)-L-tyrosine ethanolamide (NHS-Tyr-GalNF2Ac), denoted as compound 11c.

[0028] In this invention, R1 is -OH and R2 is -CF3, that is... N -( N -Hydroxysuccinyl adipic acid)- O -(2-Deoxy-2-trifluoroacetamido- α -D-galactosyl)-L-tyrosine ethanolamide (NHS-Tyr-GalNF3Ac), denoted as compound 11d.

[0029] In this invention, R1 is F, and R2 is -CH3, that is... N -( N -Hydroxysuccinyl adipic acid)- O -(2-deoxy-2-acetamido-6-deoxy-6-fluoro- α -D-galactosyl)-L-tyrosine ethanolamide (NHS-Tyr-6F-GalNAc), denoted as compound 11e.

[0030] This invention provides a method for preparing tumor haptens based on tyrosine-acetylgalactosamine and its fluorinated derivatives, as described in the above technical solution, comprising the following steps: Compound 7, trifluoroacetic acid, and an organic solvent were mixed and reacted to obtain compound 8; Compound 8, HATU, DIEA, ethanolamine, and an organic solvent were mixed and reacted to obtain compound 9; Compound 9 was reacted with an ammonia-methanol solution in a protective gas atmosphere to obtain compound 10; Compound 10, adipic acid di( NThe 1,2-hydroxysuccinimide ester (diNHS) and an organic solvent are mixed and reacted to obtain the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives; The chemical structures of compounds 7, 8, 9, and 10 are as follows: , , , .

[0031] In this invention, unless otherwise specified, all raw materials / components are commercially available products well-known to those skilled in the art. Unless otherwise specified, solutions in this invention are aqueous solutions with water as the solvent; for example, hydrochloric acid solution is an aqueous solution of hydrochloric acid. Room temperature in this invention generally refers to a temperature between 15°C and 30°C, and is generally defined as 25°C. The overall chemical synthesis flow chart of the method for preparing tumor haptens based on tyrosine-acetylgalactosamine and its fluorinated derivatives provided by this invention is as follows: Figure 22 As shown. This invention starts with commercially available fully acetyl-protected D-galactose, which is divided into two groups for synthesis: one with fluorine modification at the two-position and the other with fluorine modification at the six-position. For the tumor hapten with monofluorine modification at the six-position, this invention adopts a strategy of "fluorination first, then glycosylation"; for the tumor hapten with fluorine modification at the two-position, this invention adopts a strategy of "glycosylation first, then fluorination", yielding tyrosine acetaminogalactosamines (7a~7e) containing five different fluorine modifications. Furthermore, aminoethanol is attached to the C-terminus of the tyrosine residue and an NHS linker for connection with Qβ is attached to the N-terminus, resulting in tumor haptens based on tyrosine-acetaminogalactosamine and its fluorinated derivatives (11a~11e).

[0032] In this invention, the fluorinated tyrosine acetaminogalactosamine is compound 7, and the five fluorinated tyrosine acetaminogalactosamines are compounds 7a, 7b, 7c, 7d, or 7e. Compound 7 is preferably selected from compounds 7a, 7b, 7c, 7d, or 7e. The chemical structures of compounds 7a, 7b, 7c, 7d, and 7e are as follows: , , , , .

[0033] In this invention, compound 7a can be prepared using methods well known to those skilled in the art. A flowchart of the preparation process of compound 7a in this embodiment is shown in Figure 23.

[0034] In this invention, the preparation method of compounds 7b, 7c, and 7d includes the following steps: mixing compound 6, zinc powder, and acetic acid to react and obtain an intermediate product. In this invention, compound 6 can be prepared using a method well-known to those skilled in the art. The preferred molar ratio of compound 6 to zinc powder is 0.53:5.33, 0.3:3.15, or 0.255:2.6. This invention does not have specific requirements for the amount of acetic acid used, as long as compound 6 is completely dissolved. The reaction is carried out under stirring at room temperature. The preferred reaction time is 1-1.5 hours. After the reaction, this invention preferably filters and concentrates the obtained mixed product sequentially to obtain an intermediate product. The concentration can be vacuum concentration. After obtaining the intermediate product, this invention reacts the intermediate product with a fluorinated raw material in an organic solvent to obtain compounds 7b, 7c, and 7d. The fluorinated raw material used to prepare compounds 7b, 7c, and 7d is selected sequentially from fluoroacetic acid (CH2FCO2H), difluoroacetic acid (CHF2CO2H), and trifluoroacetic anhydride (TFAA). In this invention, the organic solvent can be acetonitrile or dichloromethane, and in the examples, it can be anhydrous acetonitrile or anhydrous dichloromethane. The molar ratio of compound 6 to fluoroacetic acid is preferably 0.53:5.25. The molar ratio of compound 6 to difluoroacetic acid is preferably 0.3:3.26. The molar ratio of compound 6 to trifluoroacetic anhydride is preferably 0.255:0.765. When preparing compounds 7b and 7c, the reactants also include HATU and DIEA. The molar ratio of fluoroacetic acid, HATU, and DIEA is preferably 5.25:4.73:5.74. The molar ratio of difluoroacetic acid, HATU, and DIEA is preferably 3.26:2.93:3.59. When preparing compound 7d, the reactants also include triethylamine, which can be anhydrous triethylamine. The molar ratio of trifluoroacetic anhydride to triethylamine is preferably 0.765:0.765. The reaction is carried out at room temperature. For the preparation of compounds 7b and 7c, the reaction time is preferably 30-40 min. For the preparation of compound 7d, the reaction time is preferably 12-24 h. After the reaction is complete, the reaction mixture is preferably dissolved in ethyl acetate after removing the solvent, and then washed and dried sequentially to obtain the organic phase product. The organic phase product is then concentrated and purified by column chromatography to obtain compound 7b or compound 7c. The washing time is preferably saturated sodium bicarbonate aqueous solution followed by saturated brine. The eluent used for column chromatography purification is preferably n-hexane and ethyl acetate, with a volume ratio of n-hexane to ethyl acetate preferably of 1-2:1. The reaction for the preparation of compound 7d is carried out under a protective gas atmosphere, which can be argon.When preparing the compound for 7 days, after the reaction is complete, the reaction mixture is preferably diluted with dichloromethane, and then washed, dried, concentrated, and purified by column chromatography in sequence. The eluent used for column chromatography purification is preferably petroleum ether and ethyl acetate, with a preferred volume ratio of 5:1.

[0035] In this invention, the preparation method of compound 7e includes the following steps: mixing compound 18, acetic anhydride-acetic acid organic solution, and zinc powder to react and obtain compound 7e. In this invention, compound 18 is preferably prepared from compound 17. In this invention, the acetic anhydride-acetic acid organic solvent preferably includes acetic anhydride (Ac2O), acetic acid (AcOH), and tetrahydrofuran (THF), and the volume ratio of THF, Ac2O, and AcOH in the acetic anhydride-acetic acid organic solvent is preferably 3:2:1. The reaction is carried out at room temperature, and the reaction time is preferably 12-24 h. The reaction is detected by TLC in this invention. After the reaction is completed, the reaction mixture is preferably filtered to remove excess zinc powder, and the filtrate is diluted with dichloromethane, washed and dried sequentially, and finally concentrated and purified by column chromatography. The eluent used for column chromatography purification is preferably petroleum ether and ethyl acetate, and the volume ratio of petroleum ether to ethyl acetate is preferably 1:2.

[0036] In this invention, the chemical structures of compounds 6, 17, and 18 are as follows: , , .

[0037] This invention involves reacting compound 7, trifluoroacetic acid, and an organic solvent to obtain compound 8. In this invention, compound 7 includes compounds 7a, 7b, 7c, 7d, and 7e. Preferably, compound 7 is dissolved in a mixture of trifluoroacetic acid and anisole, and the reaction is carried out at room temperature. After the reaction, toluene is added for dilution, and the solvent is removed by co-evaporation with toluene. Subsequently, the mixture is purified by silica gel column chromatography to obtain compound 8. Compound 8 includes compounds 8a, 8b, 8c, 8d, and 8e. The preferred volume ratio of trifluoroacetic acid to anisole is 10:1. The reaction time can be 20-30 minutes. The reaction is carried out under stirring. The eluent used for silica gel column chromatography purification is preferably an acetic acid solution of dichloromethane and methanol. The acetic acid content in the methanol-acetic acid solution is 0.1% (v:v). The preferred volume ratio of the dichloromethane to methanol-acetic acid solution is 50:1.

[0038] After obtaining compound 8, the present invention reacts compound 8, HATU, DIEA, ethanolamine, and an organic solvent to obtain compound 9. In the present invention, the molar ratio of compound 8, HATU, and DIEA is preferably 1:1.1:2.2. The molar ratio of compound 8 and ethanolamine is preferably 1:1.1. The organic solvent can be... N , N -Dimethylformamide (DMF). The reaction is carried out under stirring at room temperature. The reaction time is preferably 1-1.5 h. After the reaction is completed, the resulting reaction solution is preferably diluted with dichloromethane, then washed and dried sequentially, and finally concentrated and purified by column chromatography to obtain compound 9. The eluent used for column chromatography purification is preferably dichloromethane and methanol, and the volume ratio of dichloromethane to methanol is preferably 30:1.

[0039] After obtaining compound 9, the present invention reacts compound 9 with an ammonia-methanol solution under a protective gas atmosphere to obtain compound 10. In the present invention, the protective gas is preferably argon. The molar concentration of the ammonia-methanol solution is preferably 7M. The ammonia-methanol solution is used in excess. The reaction is carried out at room temperature. The reaction time is preferably 4-12 hours. The reaction progress is monitored by TLC. After the reaction is completed, the reaction solution is purged with nitrogen, and the solvent is evaporated to obtain a crude product; the crude product is dissolved in ethyl acetate and then extracted with water to obtain an aqueous phase; the aqueous phase is freeze-dried to obtain compound 10.

[0040] After obtaining compound 10, the present invention combines compound 10 with di(adipic acid) N The 10-hydroxysuccinimide ester (diNHS) is reacted with an organic solvent to obtain the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives. In this invention, the molar ratio of compound 10 to diNHS is preferably 1:3. The organic solvent is preferably... N -Methylpyrrolidone (NMP). The reaction is carried out under stirring at room temperature, and the reaction time is preferably 1-2 hours. The progress of the reaction is preferably monitored by high-performance liquid chromatography. After the reaction is complete, the organic solvent is preferably removed by lyophilization to obtain a crude product; the crude product is precipitated with ethyl acetate, then washed with a mixed solution of methanol (MeOH) and ethyl acetate (EtOAc), and finally the precipitate is collected and lyophilized to obtain the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives. The volume content of MeOH in the mixed solution of MeOH and EtOAc is 10%.

[0041] This invention provides a class of complete tumor antigens based on tyrosine-acetylgalactosamine and its fluorinated derivatives, which are obtained by conjugating the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives prepared by the above-described technical solution or the preparation method described above with virus-like particles.

[0042] In this invention, the virus-like particles are preferably Qβ virus-like particles (abbreviated as Qβ particles). In this invention, Qβ represents Qβ virus-like particles (VLPs), which are VLPs derived from small RNA bacteriophages. Their capsids are formed by the self-assembly of 180 14.3 kDa capsid protein subunits, exhibiting an icosahedral structure with a diameter of approximately 29 nm.

[0043] The tumor complete antigen (Qβ-Fluorinated-GalNAc-) based on tyrosine-acetylgalactosamine and its fluorinated derivatives provided by this invention O The specific structure of the -Tyr, Qβ hapten conjugate is as follows: .

[0044] In this invention, n represents the number of haptens coupled to a virus-like particle (Qβ particle). In this invention, when the virus-like particle is a Qβ virus-like particle, the resulting tumor complete antigen structure based on tyrosine-acetylgalactosamine and its fluorinated derivatives has n = 300~700.

[0045] In this invention, R1 is -OH and R2 is -CH3, i.e., the polyvalent conjugate Qβ-[ N -(adiacyl)- O -(2-Deoxy-2-acetamido- α [-D-galactosyl)-L-tyrosine ethanolamide] (Qβ-Tyr-GalNAc), denoted as compound 12a.

[0046] In this invention, R1 is -OH and R2 is -CH2F, i.e., the polyvalent conjugate Qβ-[ N -(adiacyl)- O -(2-Deoxy-2-fluoroacetamido- α [-D-galactosyl)-L-tyrosine ethanolamide] (Qβ-Tyr-GalNFAc), denoted as compound 12b.

[0047] In this invention, R1 is -OH, R2 is -CHF2, i.e., the polyvalent conjugate Qβ-[ N -(adiacyl)- O -(2-Deoxy-2-difluoroacetamido- α[-D-galactosyl)-L-tyrosine ethanolamide] (Qβ-Tyr-GalNF2Ac), denoted as compound 12c.

[0048] In this invention, R1 is -OH, R2 is -CF3, i.e., the polyvalent conjugate Qβ-[ N -(adiacyl)- O -(2-Deoxy-2-trifluoroacetamido- α [-D-galactosyl)-L-tyrosine ethanolamide], where R1 is a hydroxyl group and R2 is a trifluoromethyl group (Qβ-Tyr-GalNF3Ac), denoted as compound 12d.

[0049] In this invention, R1 is F, and R2 is -CH3, i.e., the polyvalent conjugate Qβ-[ N -(adiacyl)- O -(2-deoxy-2-acetamido-6-deoxy-6-fluoro- α [-D-galactosyl)-L-tyrosine ethanolamide] (Qβ-Tyr-6F-GalNAc), denoted as compound 12e.

[0050] This invention provides a method for preparing complete tumor antigens based on tyrosine-acetylgalactosamine and its fluorinated derivatives as described in the above technical solution, comprising the following steps: A buffer solution of virus-like particles and a hapten solution are mixed and incubated to obtain a complete tumor antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives. The hapten solution includes the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives and an organic solvent.

[0051] In this invention, the buffer solution for the virus-like particles is preferably a potassium phosphate buffer for virus-like particles. The molar concentration of the potassium phosphate buffer is preferably 0.1 M, and the pH value is 7.2. In this invention, the virus-like particles are Qβ virus-like particles. The preparation method of the Qβ virus-like particles preferably includes: inoculating the transformed strain into 1 L of LB medium containing ampicillin for protein expression, collecting the supernatant; mixing the supernatant with PEG 8000 for precipitation, resuspending the precipitate in PBS solution to obtain a protein solution; mixing the protein solution with an organic solvent to form a colloid; separating the phase of the colloid by centrifugation, collecting the aqueous phase; purifying the aqueous phase to obtain Qβ virus-like particles. The organic solvent is preferably chloroform and n-butanol, and the volume ratio of chloroform to n-butanol is preferably 1:1. The purification preferably includes, in sequence: ultrafiltration membrane concentration, sucrose density gradient centrifugation, and further purification using Sepharose CL-4B cross-linked agarose gel. During further purification using the Sepharose CL-4B cross-linked agarose gel, a Millipore 100kMWCO ultrafiltration membrane is preferably used to remove residual sucrose. Each Qβ virus-like particle consists of 180 subunits, each containing 4 reactive amino groups. The molar ratio of the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives to the reactive amino groups in the Qβ virus-like particles is 18.9:1.

[0052] In this invention, the organic solvent in the hapten solution can be dimethyl sulfoxide (DMSO). The incubation is carried out at room temperature, and the incubation time is preferably 12-24 hours. After the incubation, the resulting incubation solution is preferably diluted with phosphate buffer and then purified. The purification is performed multiple times, with each purification cycle involving washing with phosphate buffer.

[0053] The present invention provides the application of the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives, or the tumor complete antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives, as described in the above-mentioned technical solutions, in the preparation of tumor vaccines.

[0054] In this invention, the tumor vaccine may be a colon adenocarcinoma tumor vaccine, a melanoma tumor vaccine, or a breast cancer tumor vaccine.

[0055] This invention provides a tumor vaccine based on tyrosine-acetylgalactosamine and its fluorinated derivatives, comprising the complete tumor antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives as described in the above technical solution.

[0056] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0057] The reagents and consumables used in the following examples are sourced and described as follows: Chemical reagents were purchased from Sigma Aldrich, TCI, Acros, Adamas, CS Bio, J&K, Jier Biochemical, Annegi, Innovent, McLean, etc., and used directly; solvents were purchased from Tongguang Company (GR grade) or Fisher, Sigma, Acros, Oceanpak (HPLC grade); anhydrous solvents included diethyl ether, tetrahydrofuran, toluene, dichloromethane, and... N , N Dimethylformamide, etc., were purified and dried using the PURE SOLV® (Innovative Technology, Inc.) system after purchase; thin-layer chromatography analysis was performed using the HSGF254 high-performance thin-layer chromatography silica gel pre-plate from Yinlong Company; and rapid column chromatography was performed using 200-300 mesh silica gel from Qingdao Ocean Chemical Company.

[0058] The instruments used in the following examples include: nuclear magnetic resonance spectroscopy data were acquired at room temperature using a Bruker Avance III nuclear magnetic resonance spectrometer. 1 The H NMR detection frequency is 400 MHz or 600 MHz. 13 The C NMR detection frequency is 101 MHz. 19 The F NMR detection frequency was 376 MHz. The chemical shift (δ) was calibrated with reference to the standard peak shift of the residual solvent in tetramethylsilane (TMS) or deuterated reagents. Commonly used solvents are CDCl3 and D2O, with the reference chemical shift for the residual hydrogen signal in CDCl3 being δ 7.26 (…). 1 H) and δ 77.0 ( 13 C), the reference chemical shift of the residual water peak (HDO) in D2O is δ 4.79 ( 1H). Reporting formats for NMR data include chemical shift (δ), integral, multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet), and coupling constant (J). Analytical high-performance liquid chromatography (HPLC) chromatograms were acquired using a Waters Alliance e2695 system equipped with a Waters 2489 UV / Vis detector. A Welch C18 column (5.0 μm, 4.6 × 250 mm) was used at a flow rate of 1.0 mL / min, with detection wavelengths of 210 nm and 280 nm. Transmission electron microscopy (TEM) images were obtained using a JEM-1400PLUS TEM for particle morphology analysis. Particle size distribution (DLS) data were measured using a Malvern Zetasizer Nano ZSP dynamic light scattering spectrometer. High-resolution electrospray ionization time-of-flight (ESI-TOF) mass spectrometry data were obtained using a Waters SYNAPT G2-Si high-resolution ion mobility mass spectrometer.

[0059] Example 1 (1) Synthesis of fluorine-free modified tyrosine acetaminogalactosamine according to Figure 23 The preparation process described above involves using commercially available 1,2,3,4,6-pentaacetyl- α / β-D-galactopyranoside 1 (5.00 g, 12.8 mmol) was dissolved in 40 mL of anhydrous dichloromethane, and hydrogen bromide solution (18.0 mL, 64.0 mmol, 33% acetic acid solution) was added at 0 °C under argon protection. After reacting in an ice-water bath for 2 hours, thin-layer chromatography (TLC) showed that the starting material had been completely consumed. Subsequently, the reaction was terminated with an equal volume of ice water, extracted with two volumes of ethyl acetate, and washed successively with ice water (2 × 100 mL), saturated sodium bicarbonate solution (3 × 100 mL), and saturated brine (1 × 50 mL), and then dried over anhydrous sodium sulfate. The organic phase was filtered and concentrated under reduced pressure to give a white foamy compound 2. Subsequently, compound 2 was dissolved in a mixture of 20 mL of 60% aqueous acetic acid and 20 mL of ethyl acetate, and sodium acetate (4.85 g, 59.1 mmol), copper sulfate pentahydrate (0.2620 g, 1.05 mmol), and zinc powder (5.00 g, 76.9 mmol) were added sequentially. The mixture was reacted at room temperature under argon protection for 5 hours. The system was then diluted with ethyl acetate and washed sequentially with saturated sodium bicarbonate solution (3 × 50 mL) and saturated brine (1 × 50 mL). After drying with anhydrous sodium sulfate, the mixture was filtered, concentrated under reduced pressure, and then purified by silica gel column chromatography (petroleum ether / ethyl acetate, 6:1) to give compound 3 (1.7661 g, 6.49 mmol, overall yield of 51%). Compound 3 is 3,4,6-tri- O -Acetyl-D-galactosene, NMR spectrum consistent with previously reported data.

[0060] Under argon protection, compound 3 (0.6890 g, 2.53 mmol) and 1.0270 g of 4Å molecular sieve were added to 6.89 mL of anhydrous acetonitrile. After cooling to -15 °C, potassium azide (0.0811 g, 5.06 mmol) and cerium ammonium nitrate (3.4600 g, 5.06 mmol) were added sequentially to the solution. After reacting at -15 °C for 8 hours, the solution was diluted with ethyl acetate, washed with water (3 × 50 mL), and dried over anhydrous Na₂SO₄. The organic phase was filtered and concentrated under reduced pressure to obtain a yellow oily substance, which was compound 4. Subsequently, compound 4 was dissolved in 19 mL of anhydrous acetonitrile at 0 °C. Anhydrous lithium bromide (1.5370 g, 18.11 mmol) was added to the phase solution under argon protection, and the reaction was carried out overnight at room temperature. After the reaction was complete, the reaction mixture was diluted with ethyl acetate and washed with water (3 × 100 mL) and saturated brine (1 × 100 mL). After drying with anhydrous Na₂SO₄, the mixture was filtered, concentrated under reduced pressure, and purified by silica gel column chromatography (petroleum ether / ethyl acetate, 6:1) to give compound 5 (0.5154 g, 1.31 mmol, overall yield of 52%). Compound 5 is a bromo-3,4,6-tri- O -acetyl-2-deoxy-2-azide- α -D-galactose, the NMR spectrum is consistent with the data reported in the literature.

[0061] Under inert argon gas protection and light-protected conditions, N -(9-fluorenylmethoxycarbonyl)-L-tyrosine tert-butyl ester (0.6249 g, 1.36 mmol) and 1.718 g of 4Å molecular sieve were added to a DCM / toluene (6.4 mL / 6.4 mL) mixed solvent. After cooling the system to 0 °C, Ag₂CO₃ (0.4073 g, 1.48 mmol) and AgClO₄ (0.0623 g, 0.30 mmol) were added, and stirring was continued for 30 minutes. Subsequently, compound 5 (0.5154 g, 1.31 mmol) was dissolved in DCM / toluene (1.8 mL / 1.8 mL) and slowly added dropwise to the above reaction system, and the reaction was stirred overnight at room temperature. After the reaction was complete, DCM was added for dilution, followed by filtration. The filtrate was washed successively with saturated sodium bicarbonate solution (3 × 50 mL) and saturated brine (1 × 50 mL), dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and then purified by silica gel column chromatography (petroleum ether / ethyl acetate, 4:1 to 3:1) to give the target product compound 6 (0.4445 g, 0.58 mmol, yield 44%). Compound 6 is... N -(9-fluorenemethyloxycarbonyl)- O -(3,4,6-Three-) O-acetyl-2-deoxy-2-azide- α -D-galactosyl)-L-tyrosine tert-butyl ester, NMR spectrum consistent with previously reported data.

[0062] Compound 6 (0.4074 g, 0.53 mmol) was dissolved in a THF:Ac₂O:AcOH (3:2:1, 20 mL) mixture, and zinc powder (pre-stirred in 1 M hydrochloric acid for 10 minutes, filtered, and dried; 0.2938 g, 4.52 mmol) was added. The reaction was stirred overnight at room temperature. After the reaction was completed by TLC monitoring, the zinc powder was removed by filtration. The filtrate was diluted with dichloromethane, washed successively with sodium bicarbonate solution (3 × 50 mL) and saturated brine (1 × 50 mL), dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and then purified by silica gel column chromatography (petroleum ether / ethyl acetate, 1:2) to give compound 7a (0.2696 g, 0.34 mmol, yield 65%). Compound 7a is... N -(9-fluorenemethyloxycarbonyl)- O -(3,4,6-Three-) O -Acetyl-2-deoxy-2-acetamido- α -D-galactosyl)-L-tyrosine tert-butyl ester, NMR spectrum consistent with previously reported data.

[0063] (2) Synthesis of 2-fluorine modified tyrosine acetaminogalactosamine according to Figure 24 The preparation process is as follows: Compound 6 (0.4060 g, 0.53 mmol) was dissolved in 4.4 mL of acetic acid, and activated zinc powder (pre-stirred in 1 M hydrochloric acid for 10 minutes, filtered, and dried; 0.3469 g, 5.33 mmol) was added. The mixture was stirred at room temperature for 1.5 h. After the reaction was complete, the mixture was filtered and concentrated under reduced pressure. The obtained compound was dissolved in 35.8 mL of anhydrous acetonitrile. Simultaneously, fluoroacetic acid (0.41 g, 5.25 mmol) was dissolved in 35.8 mL of anhydrous acetonitrile, and HBTU (1.7936 g, 4.73 mmol) and DIEA (1 mL, 5.74 mmol) were added sequentially. After mixing and stirring thoroughly, the mixture was reacted at room temperature for 30 minutes. After the reaction was complete, the solvent was removed by concentration under reduced pressure, and the compound was dissolved in ethyl acetate. The solution was washed sequentially with saturated NaHCO3 aqueous solution (3 × 50 mL) and saturated brine (1 × 50 mL), and then dried with anhydrous Na2SO4. The resulting organic phase was concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography (n-hexane / ethyl acetate, 1:1) to give compound 7b (0.3738 g, 0.46 mmol, 88% yield in two steps). Compound 7b is... N -(9-fluorenemethyloxycarbonyl)-O -(3,4,6-Three-) O -Acetyl-2-deoxy-2-fluoroacetamido- α -D-galactosyl)-L-tyrosine tert-butyl ester. 1 H NMR (400 MHz, CDCl3) δ 7.75 (d, J = 7.6 Hz,2H), 7.53 (t, J = 8.6 Hz, 2H), 7.38 (t, J = 7.5 Hz, 2H), 7.29 (t, J = 7.5 Hz,2H), 7.04 (d, J = 8.3 Hz, 2H), 6.95 (d, J = 8.3 Hz, 2H), 6.53 (dd, J = 9.8,3.1 Hz, 1H), 5.51 (d, J = 3.6 Hz, 1H), 5.44 (d, J = 3.2 Hz, 1H), 5.38 (dd, J= 11.3, 3.3 Hz, 1H), 5.23 (d, J = 8.1 Hz, 1H), 4.77 (td, J = 10.7, 4.2 Hz,1H), 4.75 (d, J = 47.3 Hz, 2H), 4.49 (d, J = 7.6 Hz, 1H), 4.44 (dd, J = 10.6,6.9 Hz, 1H), 4.30 (dd, J = 10.7, 6.9 Hz, 1H), 4.23 (t, J = 6.7 Hz, 1H), 4.17(t, J = 6.9 Hz, 1H), 4.04 (qd, J = 11.2, 6.6 Hz, 2H), 3.13–2.96 (m, 2H), 2.16(s, 3H), 2.01 (s, 3H), 1.91 (s, 3H), 1.41 (s, 9H); 13C NMR (101 MHz, CDCl3) δ170.85, 170.57, 170.38, 170.33, 167.98 (d, J = 17.6 Hz), 155.63, 155.25,143.94, 143.90, 141.45, 131.11, 130.98, 127.88, 127.17, 125.23, 125.11,120.15, 120.12, 116.71, 96.65, 82.67, 80.12 (d, J = 186.6 Hz), 68.26, 67.68,67.14, 66.94, 61.61, 55.20, 47.38, 47.31, 38.74, 37.57, 28.14, 20.84, 20.67; 19 F NMR (376 MHz, CDCl3) δ -225.13. Compound 6 (0.2312 g, 0.30 mmol) was dissolved in 3.1 mL of acetic acid, and activated zinc powder (pre-stirred in 1M hydrochloric acid for 10 minutes, filtered, and dried; 0.2050 g, 3.15 mmol) was added. The mixture was stirred at room temperature for 1.5 h. After the reaction was complete, the mixture was filtered and concentrated under reduced pressure. The resulting compound was dissolved in 20.4 mL of anhydrous acetonitrile. Simultaneously, difluoroacetic acid (0.2045 mL, 3.26 mmol) was dissolved in 20.4 mL of anhydrous acetonitrile, and HBTU (1.1127 g, 2.93 mmol) and DIEA (0.6 mL, 3.59 mmol) were added sequentially. The mixture was stirred thoroughly and reacted at room temperature for 30 minutes. After the reaction was complete, the solvent was removed by concentration under reduced pressure, and the compound was dissolved in ethyl acetate. The solution was washed sequentially with saturated NaHCO3 aqueous solution (3 × 50 mL) and saturated brine (1 × 50 mL), and then dried over anhydrous Na2SO4. The resulting organic phase was concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography (n-hexane / ethyl acetate, 2:1) to give compound 7c (0.1871 g, 0.23 mmol, two-step yield 76%). Compound 7c is... N -(9-fluorenemethyloxycarbonyl)- O -(3,4,6-Three-) O -Acetyl-2-deoxy-2-difluoroacetamido- α -D-galactosyl)-L-tyrosine tert-butyl ester. 1H NMR (400 MHz, CDCl3) δ 7.78 (d, J = 7.6 Hz, 2H), 7.56(dd, J = 11.1, 7.4 Hz, 2H), 7.41 (t, J = 7.5 Hz, 2H), 7.31 (t, J = 7.3, 2H),7.08 (d, J = 8.2 Hz, 2H), 6.97 (d, J = 8.6 Hz, 2H), 6.54 (d, J = 9.6 Hz, 1H),5.87 (t, J = 54.1 Hz, 1H), 5.53 (d, J = 3.6 Hz, 1H), 5.46 (dd, J = 3.3, 1.2Hz, 1H), 5.45 – 5.40 (m, 1H), 5.25 (d, J = 8.1 Hz, 1H), 4.74 (td, J = 11.0,3.6 Hz, 1H), 4.52 (d, J = 7.4 Hz, 1H), 4.47 (dd, J = 10.7, 6.9 Hz, 1H), 4.33(dd, J = 10.6, 7.0 Hz, 1H), 4.25 (t, J = 6.6 Hz, 1H), 4.21 (t, J = 6.9 Hz,1H), 4.06 (qd, J = 11.3, 6.6 Hz, 2H), 3.12–2.98 (m, 2H), 2.20 (s, 3H), 2.04(s, 3H), 1.94 (s, 3H), 1.43 (s, 9H); 13 C NMR (101 MHz, CDCl3) δ 170.95, 170.57,170.38, 170.26, 162.93 (t, J = 25.4 Hz), 155.62, 155.09, 143.95, 143.91,141.46, 141.44, 131.38, 131.04, 127.89, 127.18, 125.24, 125.12, 120.16,120.13, 116.81, 108.28 (t, J = 252.9 Hz), 96.43, 82.69, 68.13, 67.79, 67.06,66.95, 61.56, 55.21, 48.05, 47.32, 37.64, 28.14, 20.82, 20.73, 20.68; 19F NMR (376 MHz, CDCl3) δ -126.25 (dd, J = 302.7, 65.3 Hz). Compound 6 (0.1974 g, 0.255 mmol) was dissolved in 2.16 mL of acetic acid, and activated zinc powder (pre-stirred in 1 M hydrochloric acid for 10 minutes, filtered, and dried; 0.1690 g, 2.60 mmol) was added. The mixture was stirred at room temperature for 1.5 h. After the reaction was complete, the mixture was filtered and concentrated under reduced pressure. The resulting compound did not require further purification and could be used directly in the next reaction. Next, under argon protection, the resulting compound was dissolved in anhydrous dichloromethane (1.27 mL), and trifluoroacetic anhydride (TFAA, 0.14 mL, 0.765 mmol) and anhydrous triethylamine (TEA, 0.1 mL, 0.765 mmol) were added sequentially. After stirring, the mixture was reacted overnight at room temperature. After the reaction was complete, the reaction system was diluted with CH2Cl2 and washed sequentially with saturated NaHCO3 aqueous solution (3 × 20 mL) and saturated NaCl (3 × 20 mL), and then dried with anhydrous Na2SO4. The resulting organic phase was concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography (petroleum ether / ethyl acetate, 5:1) to give compound 7d (0.0691 g, 0.083 mmol, two-step yield 32%). Compound 7d is... N -(9-fluorenemethyloxycarbonyl)- O -(3,4,6-Three-) O -Acetyl-2-deoxy-2-trifluoroacetamido- α -D-galactosyl)-L-tyrosine tert-butyl ester. 1H NMR (400 MHz, CDCl3) δ 7.77 (d, J = 7.5 Hz, 2H), 7.56 (t, J = 9.8, 2H), 7.41 (t, J = 7.5 Hz, 2H), 7.31 (t, J = 7.4, 2H), 7.08 (d, J = 8.2 Hz, 2H), 6.96 (d, J = 8.4 Hz, 2H), 6.63 (d, J = 9.4 Hz, 1H), 5.57 (d, J = 3.6 Hz, 1H), 5.49 – 5.39 (m, 2H), 5.27 (d, J = 8.0 Hz, 1H), 4.72(td, J = 10.6, 3.6Hz, 1H), 4.52 (d, J = 9.6, 1H), 4.46 (dd, J = 10.7, 7.0 Hz, 1H), 4.34 (dd, J = 10.7, 6.9 Hz, 1H), 4.24 (t, J = 6.5 Hz, 1H), 4.20 (t, J =6.9 Hz, 1H), 4.13 – 3.99 (m, 2H), 3.12–2.99 (m, 2H), 2.20 (s, 3H), 2.04 (s,3H), 1.94 (s, 3H), 1.43 (s, 9H); 13 C NMR (101 MHz, CDCl3) δ 170.92, 170.44,170.25, 170.10, 157.39 (q, J = 37.8 Hz), 155.52, 154.84, 143.82, 143.79,141.35, 141.33, 131.48, 130.97, 127.77, 127.06, 125.12, 125.00, 120.05,120.01, 116.75, 115.54 (q, J = 287.7 Hz), 96.11, 82.57, 67.95, 67.72, 66.87, 66.84, 61.41, 55.10, 48.70, 47.20, 37.54, 28.01, 20.68, 20.54; 19 F NMR (376MHz, CDCl3) δ -75.91. (3) Synthesis of tyrosine acetylgalactosamine modified at the six-position monofluoride according to Figure 25The preparation process is as follows: Under argon protection, commercially available D-galactose compound 13 (3.5 g, 19.4 mmol) and anhydrous zinc chloride (3.6 g, 26.2 mmol) were dissolved in 75 mL of acetone, and 0.42 mL of concentrated sulfuric acid was slowly added dropwise. The reaction was carried out overnight at room temperature until the starting material was completely eliminated. After the reaction was complete, the solution was neutralized with saturated sodium carbonate solution and filtered to remove the solid. The filtrate was concentrated under reduced pressure, dissolved in dichloromethane, washed with saturated brine (1 × 100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain a pale yellow viscous oily product 1,2:3,4-di- O -Isopropylidene- α -D-galactose can be used directly in the next reaction. (The remaining text appears to be a mix of unrelated characters and symbols, possibly due to OCR errors.) O -Isopropylidene- α D-galactose (1.0 g, 3.8 mmol) was dissolved in 7.5 mL of anhydrous dichloromethane, and 2,4,6-trimethylpyridine (1.2 mL, 9.2 mmol) was added. N , N -Diethylaminosulfur trifluoride (DAST) (0.7 g, 4.6 mmol). The reaction mixture was heated at 80 °C for 2 hours, and the reaction was terminated by adding 0.5 mL of methanol. After concentration under reduced pressure, the mixture was dissolved in dichloromethane and washed successively with saturated sodium bicarbonate solution (3 × 50 mL) and saturated brine (1 × 50 mL). After drying with anhydrous sodium sulfate, the mixture was filtered, concentrated under reduced pressure, and then purified by silica gel column chromatography (petroleum ether: ethyl acetate, 20:1) to give compound 14 (0.8191 g, 3.13 mmol, 81% yield in two steps). Compound 14 is 1,2:3,4-di- O -Isopropylidene-6-deoxy-6-fluoro- α -D-galactose. The NMR spectrum is consistent with previously reported data.

[0064] Compound 14 (0.8191 g, 3.13 mmol) was dissolved in 80% acetic acid (40 mL) and reacted overnight under reflux. After the reaction was complete, the system was co-distilled under reduced pressure with toluene (3 × 30 mL) and dichloromethane (3 × 30 mL), and the crude product was dried under vacuum for 2 hours. Then, the dried crude product was dissolved in a mixed solvent of pyridine and acetic anhydride (40 mL, 2:1), stirred at room temperature for 24 hours, and then co-distilled again with toluene (3 × 30 mL) and dichloromethane (3 × 30 mL). Purification was performed by silica gel column chromatography (dichloromethane: ethyl acetate, 20:1) to give 1,2,3,4-tetra- O -acetyl-6-deoxy-6-fluoro- α / βA mixture of D-galactose isomers (1.1767 g, 3.36 mmol, 99% two-step yield) was dissolved in 10 mL of anhydrous dichloromethane and added dropwise with 7.4 mL of 33% hydrogen bromide / glacial acetic acid solution at 0 °C. After reacting for 2 hours at 0 °C, the reaction was stopped by adding ice water and neutralized with solid NaHCO3 at 0 °C. The aqueous phase was extracted with dichloromethane (4 × 50 mL), and the combined organic phases were washed with saturated NaHCO3 solution (2 × 50 mL) and saturated brine (2 × 50 mL), dried over anhydrous MgSO4, and concentrated under reduced pressure. Purification by silica gel column chromatography (petroleum ether: ethyl acetate, 5:1) gave compound 15 (0.7854 g, 2.12 mmol, 63% two-step yield). Compound 15 is a bromo-2,3,4-tri- O -acetyl-6-deoxy-6-fluoro- α -D-galactose. The NMR spectrum is consistent with data reported in the literature.

[0065] Compound 16 (0.3134 g, 1.35 mmol, 64% yield) was synthesized from compound 15 (0.7854 g, 2.12 mmol) via the synthetic route of compound 3. Compound 16 is 3,4-di- O -Acetyl-6-deoxy-6-fluoro-galactosene. The NMR spectrum is consistent with previously reported data.

[0066] Following the synthetic route for the preparation of compound 5 from compound 3, compound 17 (0.4159 g, 1.17 mmol, two-step yield 87%) was synthesized from compound 16 (0.3134 g, 1.34 mmol). Compound 17 is a bromo-3,4-di- O -Acetyl-2-deoxy-2-azido-6-deoxy-6-fluoro- α -D-galactose. The NMR spectrum is consistent with previously reported data.

[0067] Compound 18 (1.1034 g, 1.51 mmol, 50% yield) was synthesized from compound 17 (1.0673 g, 3.01 mmol) using the synthetic pathway of compound 6. Compound 18 is... N -(9-fluorenemethyloxycarbonyl)- O -(2-deoxy-2-azido-3,4-di- O -acetyl-6-deoxy-6-fluoro- α -D-galactosyl)-L-tyrosine tert-butyl ester. 1 H NMR (400 MHz, CDCl3) δ7.77 (d, J = 7.6 Hz, 2H), 7.56 (dd,J = 15.5, 7.5 Hz, 2H), 7.41 (t, J = 7.5 Hz, 2H), 7.31 (t, J = 7.4 Hz, 2H), 7.09 (d, J = 8.3 Hz, 2H), 7.02 (d, J = 8.4 Hz, 2H), 5.60 (d, J = 3.4 Hz, 1H), 5.56 (dd, J = 3.8, 2.7 Hz, 1H), 5.26 (d, J = 8.1 Hz, 1H),4.56 – 4.49 (m, 1H), 4.49 – 4.44 (m, 1H), 4.44 – 4.38 (m, 1H), 4.33 – 4.28(m, 2H), 4.20 (t, J = 7.0 Hz, 1H), 3.79 (dd, J = 10.8, 3.5 Hz, 1H), 3.04 (t, J =7.1 Hz, 2H), 2.18 (s, 3H), 2.11 (s, 3H), 1.43 (s, 9H); 13 C NMR (101 MHz, CDCl3)δ 170.58, 169.96, 169.84, 155.56, 155.35, 143.92, 143.88, 141.37, 141.35,131.10, 130.95, 127.77, 127.11, 125.22, 125.11, 120.05, 120.02, 116.80,97.36, 82.50, 81.00 (d, J = 172.9 Hz), 68.05, 68.01 (d, J = 23.2 Hz), 67.55(d, J = 5.6 Hz), 66.87, 57.35, 55.14, 47.23, 37.59, 28.04, 20.72, 20.63; 19 FNMR (376 MHz, CDCl3) δ -232.02. Compound 7e (0.4016 g, 0.54 mmol, 97% yield) was synthesized from compound 18 (0.4072 g, 0.56 mmol) via the synthetic route of compound 7a. Compound 7e is... N-(9-fluorenemethyloxycarbonyl)- O -(3,4-two-) O -Acetyl-2-deoxy-2-acetamido-6-deoxy-6-fluoro- α -D-galactosyl)-L-tyrosine tert-butyl ester. 1 H NMR (400 MHz, CDCl3) δ 7.77 (d, J = 7.6 Hz, 2H), 7.56 (dd, J = 11.5, 7.4 Hz, 2H), 7.41 (t,J = 7.5 Hz, 2H), 7.31 (t, J = 6.2 Hz, 2H), 7.08 (d, J = 8.2 Hz, 2H), 6.97 (d,J = 8.4 Hz, 2H), 5.78 (d, J = 9.5 Hz, 1H), 5.56 (d, J = 3.6 Hz, 1H), 5.47 (d,J = 3.4 Hz, 1H), 5.40 (dd, J = 11.4, 3.3 Hz, 1H), 5.30 (d, J = 8.1 Hz, 1H),4.77 (td, J = 11.4, 3.5 Hz, 1H), 4.56 – 4.48 (m, 1H), 4.48 – 4.43 (m, 1H), 4.45 – 4.34 (m, 1H), 4.38 – 4.24 (m, 1H), 4.21 (q, J = 6.8 Hz, 1H), 3.04 (t,J = 6.5 Hz, 2H), 2.18 (s, 3H), 2.05 (s, 3H), 1.97 (s, 3H), 1.43 (s, 9H); 13 CNMR (101 MHz, CDCl3) δ 171.17, 170.61, 170.35, 170.27, 155.61, 155.21,143.98, 143.87, 141.42, 131.02, 131.01, 127.84, 127.15, 125.24, 125.16,120.12, 120.10, 116.52, 96.63, 82.63, 81.07 (d, J = 172.0 Hz), 68.26 (d, J =24.1 Hz), 67.28 (d, J = 5.6 Hz), 66.93, 55.21, 47.95, 47.27, 37.65, 28.10, 23.43, 20.91, 20.82; 19F NMR (376 MHz, CDCl3) δ -231.86. (4) Synthesis of tumor haptens based on tyrosine-acetylgalactosamine and its fluorinated derivatives according to Figure 26 The preparation process is as follows: General Step I: Compound series 7 (compounds 7a, 7b, 7c, 7d, 7e) are dissolved in a mixture of trifluoroacetic acid and anisole (10:1, v / v) and stirred at room temperature for 30 minutes. After the reaction is complete, toluene is added for dilution, and the solvent is removed by co-evaporation with toluene. Subsequently, the mixture is purified by silica gel column chromatography (dichloromethane:methanol (0.1% acetic acid), 50:1) to obtain pure compound series 8 (compounds 8a, 8b, 8c, 8d, 8e). General Step II: Compound series 8 (1.0 equivalent), HATU (1.1 equivalent), and DIEA (2.2 equivalent) are dissolved in... N , N -Dimethylformamide ( N , N Dimethylformamide (DMF) was added. Then, ethanolamine (1.1 equivalents) was added, and the reaction was stirred at room temperature for 1 hour. After the reaction was complete, the mixture was diluted with dichloromethane and washed with saturated NaCl (3 × 20 mL), then dried over anhydrous Na₂SO₄. The resulting organic phase was concentrated under reduced pressure, and the crude product was purified by silica gel column chromatography (dichloromethane:methanol, 30:1) to give compound series 9 (compounds 9a, 9b, 9c, 9d, 9e). General Step III: Compound series 9 was added to a large excess of 7M ammonia-methanol solution under argon protection and at 0 °C. The reaction system was slowly heated to room temperature and stirred for 4 hours or overnight, and the reaction was monitored by TLC. After the reaction was complete, the solvent was evaporated by purging with nitrogen. The crude product was dissolved in ethyl acetate, then extracted with water, and the aqueous phase was collected and lyophilized to give compound series 10 (compounds 10a, 10b, 10c, 10d, 10e). General Step IV: Compound series 10 (1.0 equivalents) and di(dimethylformamide) were added to di(dimethylformamide)... N 3-hydroxysuccinimide ester (diNHS) (3.0 equivalents) dissolved in N -Methylpyrrolidone ( NThe reaction mixture was stirred at room temperature for 2 h and the reaction was detected by high performance liquid chromatography (HPLC). After the reaction was complete, NMP was removed by lyophilization. The crude product was precipitated twice in ethyl acetate and washed 3–5 times with 10% MeOH / EtOAc to remove excess diNHS linkers. The water-soluble fraction of the precipitate was finally collected and lyophilized to give compound series 11 (compounds 11a, 11b, 11c, 11d, 11e).

[0068] Compound 8a is N -(9-fluorenemethyloxycarbonyl)- O -(3,4,6-Three-) O -Acetyl-2-deoxy-2-acetamido- α -D-galactosyl)-L-tyrosine. Compound 8a (0.1397 g, 0.19 mmol, 85% yield) was synthesized from compound 7a (0.2037 g, 0.26 mmol) according to general procedure I. NMR spectra were consistent with previously reported data.

[0069] Compound 9a is N -(9-fluorenemethyloxycarbonyl)- O -(3,4,6-Three-) O -Acetyl-2-deoxy-2-acetamido- α -D-galactosyl)-L-tyrosine ethanolamide. Compound 9a (0.1347 g, 0.17 mmol, 91% yield) was synthesized from compound 8a (0.1397 g, 0.19 mmol) according to general procedure II. 1H NMR (400 MHz, CDCl3) δ 7.77 (d, J =7.5 Hz, 2H), 7.54 (t, J = 8.4 Hz, 2H), 7.41 (t, J = 7.4 Hz, 2H), 7.31 (t, J =7.5 Hz, 2H), 7.13 (d, J = 8.1 Hz, 2H), 6.97 (d, J = 8.1 Hz, 2H), 6.11 (s,1H), 5.80 (d, J = 9.3 Hz, 1H), 5.56 (d, J = 3.6 Hz, 1H), 5.44 – 5.40 (m, 1H),5.37 (dd, J = 11.3, 3.3 Hz, 1H), 4.71 (td, J = 10.8, 3.5 Hz, 1H), 4.43 (m,1H), 4.37 – 4.31 (m, 2H), 4.18 (m, 2H), 4.04 (d, J = 6.4 Hz, 2H), 3.54 (d, J= 16.4 Hz, 2H), 3.31 (s, 2H), 3.02 (m, 2H), 2.18 (s, 3H), 2.05 (s, 3H), 1.96 (s, 3H), 1.94 (s, 3H); 13 C NMR (101 MHz, CDCl3) δ 171.50, 171.24, 170.58,170.51, 170.40, 156.11, 155.36, 143.80, 143.76, 141.42, 131.30, 130.69,127.94, 127.22, 125.13, 125.06, 120.18, 120.17, 117.01, 96.68, 68.21, 67.48,67.17, 67.15, 61.64, 61.56, 56.59, 48.16, 47.23, 42.22, 38.13, 23.35, 20.92, 20.84, 20.71. Compound 10a is O -(2-Deoxy-2-acetamido- α -D-galactosyl)-L-tyrosine ethanolamide. Compound 10a (0.0664 g, 0.15 mmol, 90% yield) was synthesized from compound 9a (0.1347 g, 0.17 mmol) according to general procedure III. 1H NMR (400 MHz, D2O) δ 7.17 (d, J = 8.0 Hz, 2H), 7.07 (d, J = 7.5 Hz, 2H), 5.56 (d, J = 3.7 Hz, 1H), 4.31 (dd, J = 11.0, 3.7 Hz, 1H), 4.19 – 3.99(m, 3H), 3.71 (d, J = 6.0 Hz, 2H), 3.59 (t, J = 7.7 Hz, 1H), 3.54 – 3.40 (m,2H), 3.20 (t, J = 5.7 Hz, 2H), 2.94–2.80 (m, 2H), 2.02 (s, 3H); 13 C NMR (101MHz, D2O) δ 176.41, 174.70, 155.20, 131.46, 130.53, 117.23, 96.39, 71.73,68.39, 67.60, 61.04, 59.75, 56.34, 49.76, 41.08, 39.65, 21.87. Compound 11a is N -( N -Hydroxysuccinyl adipic acid)- O -(2-Deoxy-2-acetamido- α -D-galactosyl)-L-tyrosine ethanolamide: ; Compound 11a (0.0848 g, 0.13 mmol, 84% yield) was synthesized from compound 10a (0.0664 g, 0.15 mmol) according to general procedure IV. 1 H NMR (600 MHz, D2O) δ 7.25 (d, J = 8.7 Hz, 2H), 7.10 (d, J =8.5 Hz, 2H), 5.60 (d, J = 3.8 Hz, 1H), 4.60 (dd, J = 9.6, 6.0 Hz, 1H), 4.35 (dd, J = 11.1, 3.7 Hz, 1H), 4.15 (dd, J = 11.0, 3.3 Hz, 1H), 4.09 – 4.05 (m, 2H), 3.73(d, J= 6.1 Hz, 2H), 3.64 – 3.53 (m, 2H), 3.31 (td, J = 5.5, 2.5 Hz, 2H), 3.16(dd, J = 14.0, 6.2 Hz, 1H), 2.97 (s, 4H), 2.91 (dd, J = 14.0, 9.7 Hz, 1H), 2.69 –2.57 (m, 2H), 2.28 – 2.21 (m, 2H), 2.04 (s, 3H), 1.57 – 1.43 (m, 4H); 13 C NMR(101 MHz, D2O) δ 176.22, 174.57, 173.40, 173.34, 170.36, 155.15, 131.02,130.34, 117.04, 96.10, 71.68, 68.35, 67.63, 60.96, 59.77, 54.99, 49.68,41.34, 36.43, 34.84, 29.87, 25.49, 24.23, 22.80, 21.86. Compound 8b is N -(9-fluorenemethyloxycarbonyl)- O -(3,4,6-Three-) O -Acetyl-2-deoxy-2-fluoroacetamido- α -D-galactosyl)-L-tyrosine. 1H NMR (400 MHz, CDCl3) δ 7.77 (d, J = 7.7 Hz, 2H),7.55 (t, J = 7.5 Hz, 2H), 7.40 (t, J = 7.5 Hz, 2H), 7.30 (t, J = 7.5 Hz, 2H),7.06 (d, J = 8.2 Hz, 2H), 6.96 (d, J = 8.2 Hz, 2H), 6.65 (dd, J = 9.8, 1H), 5.54 (d, J = 3.6 Hz, 1H), 5.46 (d, J = 3.3 Hz, 1H), 5.41 (dd, J = 11.3, 3.2Hz, 1H), 5.30 (d, J = 8.1 Hz, 1H), 4.78 (td, J = 12.3, 3.5 Hz, 1H), 4.78 (d,J = 47.2 Hz, 2H), 4.66 (q, J = 6.0 Hz, 1H), 4.49 (dd, J = 10.5, 7.0 Hz, 1H), 4.35 (dd, J = 10.8, 6.8 Hz, 1H), 4.21 (m, 2H), 4.06 (m, 2H), 3.21–3.03 (m,2H), 2.19 (s, 3H), 2.04 (s, 3H), 1.91 (s, 3H); 13 C NMR (101 MHz, CDCl3) δ174.20, 170.83, 170.46, 170.31, 168.28 (d, J = 17.5 Hz), 155.69, 155.15,143.75, 143.67, 141.36, 141.33, 130.79, 130.59, 127.81, 127.08, 125.08,124.97, 120.07, 120.06, 116.65, 96.27, 79.98 (d, J = 186.7 Hz), 68.11, 67.56,67.03, 66.91, 61.53, 54.55, 47.38, 47.17, 38.71, 36.96, 20.74, 20.72, 20.56; 19 F NMR (376 MHz, CDCl3) δ -225.14. Compound 9b is N -(9-fluorenemethyloxycarbonyl)- O -(3,4,6-Three-)O -Acetyl-2-deoxy-2-fluoroacetamido- α -D-galactosyl)-L-tyrosine ethanolamide. 1 H NMR (400 MHz, CDCl3) δ 7.75 (d, J = 7.6 Hz, 2H), 7.50 (dd, J = 14.9, 7.4 Hz, 2H), 7.39 (t, J = 7.5 Hz, 2H), 7.29 (d, J =8.2 Hz, 2H), 7.12 (d, J = 8.1 Hz, 2H), 6.96 (d, J = 8.0 Hz, 2H), 6.65 (dd, J= 9.5, 2.9 Hz, 1H), 6.55 (s, 1H), 5.73 (d, J = 8.2 Hz, 1H), 5.52 (d, J = 3.6Hz, 1H), 5.45 (d, J = 3.2 Hz, 1H), 4.31 – 4.25 (m, 1H), 4.19 (t, J = 6.5 Hz, 1H), 4.13 (t, J = 6.8Hz, 1H), 4.08 – 3.98 (m, 2H), 3.62 – 3.46 (m, 2H), 3.30 (d, J = 5.8 Hz, 2H),3.04 – 2.98 (m, 2H), 2.18 (s, 3H), 2.04 (s, 3H), 1.92 (s, 3H); 13C NMR (101MHz, CDCl3) δ 171.64, 170.84, 170.48, 170.31, 168.04 (d, J = 17.7 Hz), 156.18, 155.26, 143.74, 143.70, 141.35, 131.43, 130.68, 127.89, 127.16,125.09, 125.00, 120.12, 120.11, 116.99, 96.65, 80.08 (d, J = 186.3 Hz),68.15, 67.50, 67.09, 67.04, 61.52, 56.41, 47.42, 47.14, 42.19, 38.01, 20.80, 20.76, 20.63; 19 F NMR (376 MHz, CDCl3) δ -225.06. Compound 10b is O -(2-Deoxy-2-fluoroacetamido- α -D-galactosyl)-L-tyrosine ethanolamide. Compound 10b (0.1546 g, 0.35 mmol, three-step yield 59%) was synthesized from compound 7b (0.4739 g, 0.59 mmol) according to general steps I, II and III. 1 H NMR (400 MHz, D2O) δ 7.18 (d, J = 8.2 Hz, 2H), 7.09 (d, J= 8.3 Hz, 2H), 5.62 (d, J = 3.7 Hz, 1H), 4.93 (dd, J = 46.3, 2.2 Hz, 2H), 4.44 (dd, , 3.56 –3.39 (m, 2H), 3.21 (t, J = 5.8 Hz, 2H), 2.98–2.83 (m, 2H); 13C NMR (101 MHz,D2O) δ 175.25, 171.23 (d, J = 18.4 Hz), 155.21, 131.00, 130.56, 117.25,96.19, 79.72 (d, J = 180.4 Hz), 71.79, 68.38, 67.37, 61.03, 59.72, 56.05,49.47, 41.13, 39.10; 19 F NMR (376 MHz, D2O) δ -227.53. Compound 11b is N -( N -Hydroxysuccinyl adipic acid)- O -(2-Deoxy-2-fluoroacetamido- α -D-galactosyl)-L-tyrosine ethanolamide: Compound 11b (0.1705 g, 0.25 mmol, 73% yield) was synthesized from compound 10b (0.1546 g, 0.35 mmol) according to general procedure IV. 1 H NMR (400 MHz, D2O) δ 7.22 (d, J = 8.9 Hz, 2H), 7.07 (d, J =7.7 Hz, 2H), 5.61 (d, J = 3.7 Hz, 1H), 4.90 (dd, J = 46.4, 6.1 Hz, 2H), 4.58 (m,1H), 4.43 (dd, J = 11.0, 3.7 Hz, 1H), 4.21 (dd, J = 11.0, 3.2 Hz, 1H), 4.09 –4.04 (m, 2H), 3.71 (d, J = 6.2 Hz, 2H), 3.55 (m, 2H), 3.28 (dd, J = 8.0, 3.4 Hz, 2H), 3.13 (dd, J = 14.0, 5.9 Hz, 1H), 2.94 (s, 4H), 2.87 (dd, J = 14.0, 9.8 Hz,1H), 2.62 – 2.53 (m, 2H), 2.22 (t, J= 7.0 Hz, 2H), 1.56 – 1.35 (m, 4H); 13 C NMR (101 MHz, D2O) δ 176.21, 173.42, 173.35, 171.13 (d, J = 18.8 Hz), 170.38,155.07, 131.13, 130.36, 117.09, 95.99, 79.74 (d, J = 180.7 Hz), 71.76, 68.36,67.44, 60.96, 59.80, 54.97, 49.39, 41.37, 36.45, 34.86, 29.89, 25.51, 24.26,22.81; 19 F NMR (376 MHz, D2O) δ -227.41. Compound 8c is N -(9-fluorenemethyloxycarbonyl)- O -(3,4,6-Three-) O -Acetyl-2-deoxy-2-difluoroacetamido- α -D-galactosyl)-L-tyrosine. Compound 8c (0.0651 g, 0.09 mmol, 81% yield) was synthesized from compound 7c (0.0871 g, 0.12 mmol) according to general procedure I. 1H NMR (400 MHz, CDCl3) δ 7.78 (d, J = 7.6Hz, 2H), 7.55 (t, J = 8.3 Hz, 2H), 7.41 (t, J = 7.5 Hz, 2H), 7.31 (t, J =7.5, 2H), 7.05 (d, J = 8.2 Hz, 2H), 6.96 (d, J = 8.4 Hz, 2H), 6.69 (d, J =9.5 Hz, 1H), 5.86 (t, J = 54.1 Hz, 1H), 5.56 (d, J = 3.6 Hz, 1H), 5.47 – 5.39(m, 2H), 5.24 (d, J = 8.1 Hz, 1H), 4.74 (td, J = 10.1, 3.5 Hz, 1H), 4.66 (q,J = 6.8 Hz, 1H), 4.50 (dd, J = 10.7, 6.7 Hz, 1H), 4.38 (dd, J = 10.8, 6.7 Hz,1H), 4.21 (m, 2H), 4.06 (d, J = 6.5 Hz, 2H), 3.20 – 3.02 (m, 2H), 2.20 (s, 3H), 2.04 (s, 3H), 1.92 (s, 3H); 13 C NMR (101 MHz, CDCl3) δ 175.10, 171.05,170.65, 170.41, 163.19 (t, J = 25.4 Hz), 155.86, 155.13, 143.77, 143.71,141.43, 141.40, 130.86, 130.80, 127.91, 127.17, 125.14, 125.03, 120.16,120.12, 116.95, 108.23 (t, J = 252.5 Hz), 96.22, 68.07, 67.71, 67.07, 61.66, 54.66, 48.03, 47.21, 37.06, 29.78, 20.76, 20.67, 20.61; 19 F NMR (376 MHz, CDCl3) δ -126.26 (dd, J = 304.4, 38.1 Hz). Compound 9c is N-(9-fluorenylmethoxycarbonyl)-O-(3,4,6-tri-O-acetyl-2-deoxy-2-difluoroacetamido- α-D-galactosyl)-L-tyrosine ethanolamide. Compound 9c (0.0655 g, 0.08 mmol, 95% yield) was synthesized from compound 8c (0.0651 g, 0.09 mmol) according to general procedure II. 1 H NMR (400 MHz, CDCl3) δ 7.75(d, J = 7.6 Hz, 2H), 7.50 (dd, J = 13.8, 7.4 Hz, 2H), 7.39 (t, J = 7.5 Hz,2H), 7.29 (d, 2H), 7.11 (d, J = 8.0 Hz, 2H), 6.94 (d, J = 7.9 Hz, 2H), 6.79 (s, 1H), 6.43 (s, 1H), 5.85 (t, J = 54.0 Hz, 1H), 5.51 (d, J = 3.6 Hz, 1H), 5.47 – 5.36 (m, 2H), 4.70 (td, J = 10.1, 3.6 Hz, 1H), 4.46 – 4.25 (m, 2H), 4.20 (d, J = 6.4 Hz, 1H), 4.14 (d, J = 6.9 Hz, 1H), 4.09 – 3.97 (m, 2H), 3.59– 3.45 (m, 2H), 3.31 – 3.25 (m, 2H), 3.00 (d, J = 7.1 Hz, 2H), 2.18 (s, 3H), 2.03 (s, 3H), 1.92 (d, J = 2.0 Hz, 3H); 13 C NMR (101 MHz, CDCl3) δ 171.59,171.00, 170.54, 170.28, 163.06 (t, J = 25.1 Hz), 156.17, 155.19, 143.77,143.72, 141.39, 131.67, 130.77, 127.93, 127.21, 125.12, 125.04, 120.16,117.18, 108.28 (t, J = 252.1 Hz), 96.50, 68.02, 67.63, 67.13, 66.99, 61.61,61.51, 56.49, 48.11, 47.18, 42.22, 38.09, 29.79, 20.78, 20.71, 20.68; 19F NMR (376 MHz, CDCl3) δ -126.19 (dd, J = 310.2, 35.7 Hz). Compound 10c is O -(2-Deoxy-2-difluoroacetamido- α -D-galactosyl)-L-tyrosine ethanolamide. Compound 10c (0.0526 g, 0.11 mmol, 66% yield) was synthesized from compound 9c (0.1392 g, 0.17 mmol) according to general procedure III. 1 H NMR (400 MHz, D2O) δ 7.16 (d, J = 8.6 Hz, 2H), 7.06 (d, J = 8.5Hz, 2H), 6.15 (t, J = 53.5 Hz, 1H), 5.61 (d, J = 3.7 Hz, 1H), 4.30 (ddd, J =70.9, 11.0, 3.4 Hz, 2H), 4.12 – 4.03 (m, 2H), 3.73 – 3.69 (m, 2H), 3.59 (t, J= 7.0 Hz, 1H), 3.55 – 3.40 (m, 2H), 3.26 – 3.18 (m, 2H), 2.95 – 2.75 (m, 2H); 13 C NMR (101 MHz, D2O) δ 175.91, 165.46 (t, J = 25.9 Hz), 155.17, 131.39,130.57, 117.31, 108.17 (t, J = 247.7 Hz), 96.06, 71.82, 68.37, 67.21, 61.04,59.75, 56.22, 50.04, 41.11, 39.42; 19 F NMR (376 MHz, D2O) δ -127.18. Compound 11c is N -( N -Hydroxysuccinyl adipic acid)- O -(2-Deoxy-2-difluoroacetamido- α -D-galactosyl)-L-tyrosine ethanolamide: Compound 11c (0.0833 g, 0.12 mmol, 62% yield) was synthesized from compound 10c (0.0899 g, 0.19 mmol) according to general procedure IV. 1H NMR (400 MHz, D2O) δ 7.23 (d, J = 8.6 Hz, 2H), 7.08 (d, J =8.6 Hz, 2H), 6.16 (t, J = 53.5 Hz, 1H), 5.63 (d, J = 3.7 Hz, 1H), 4.59 (dd, J =9.7, 5.9 Hz, 1H), 4.41 (dd, J = 11.0, 3.7 Hz, 1H), 4.23 (dd, J = 11.1, 3.2 Hz,1H), 4.08 – 4.05 (m, 2H), 3.72 (d, J = 6.1 Hz, 2H), 3.61 – 3.51 (m, 2H), 3.29(t, J = 5.7 Hz, 2H), 3.15 (dd, J = 14.0, 5.9 Hz, 1H), 2.95 (s, 4H), 2.88 (dd, J =14.0, 9.8 Hz, 1H), 2.59 (q, J = 6.7 Hz, 2H), 2.23 (t, J = 6.8 Hz, 2H), 1.55 –1.38 (m, 4H); 13 C NMR (101 MHz, D2O) δ 178.78, 175.97, 175.92, 172.93, 167.90(t, J = 26.2 Hz), 157.61, 133.74, 132.90, 119.67, 110.70 (t, J = 247.4 Hz),98.34, 74.31, 70.87, 69.78, 63.49, 62.33, 57.50, 52.49, 43.91, 38.98, 37.38,32.43, 28.04, 26.78, 25.32; 19 F NMR (376 MHz, D2O) δ -124.67. Compound 8d is N -(9-fluorenemethyloxycarbonyl)- O -(3,4,6-Three-) O-Acetyl-2-deoxy-2-trifluoroacetamido- α -D-galactosyl)-L-tyrosine. Compound 8d (0.2642 g, 0.34 mmol, 85% yield) was synthesized from compound 7d (0.3342 g, 0.40 mmol) according to general procedure I. 1 H NMR (400 MHz, CDCl3) δ 7.78 (d, J = 7.6Hz, 2H), 7.55 (t, J = 7.2 Hz, 2H), 7.41 (t, J = 7.5 Hz, 2H), 7.31 (t, J = 7.4Hz, 2H), 7.07 (d, J = 8.2 Hz, 2H), 6.96 (d, J = 8.3 Hz, 2H), 6.72 (d, J = 9.4Hz, 1H), 5.60 (s, 1H), 5.44 (d, J = 10.2 Hz, 2H), 5.20 (d, J = 8.2 Hz, 1H), 4.77 – 4.63 (m, 2H), 4.55 – 4.47 (m, 1H), 4.40 (t, J = 8.8 Hz, 1H), 4.22 (q,J = 6.5 Hz, 2H), 4.06 (d, J = 6.5 Hz, 2H), 3.12 (dd, J = 15.5, 5.4 Hz, 1H), 2.20 (s, 3H), 2.04 (s, 3H), 1.92 (s, 3H); 13 C NMR (101 MHz, CDCl3) δ 175.30,171.01, 170.57, 170.25, 157.55 (q, J = 37.3 Hz), 155.77, 154.90, 143.69,143.63, 141.36, 141.33, 130.90, 130.81, 127.83, 127.08, 125.04, 124.93,120.08, 120.04, 116.92, 115.58 (d, J = 286.1 Hz), 95.94, 67.91, 67.63, 66.95,66.91, 61.56, 54.66, 48.63, 47.14, 36.96, 20.65, 20.52; 19 F NMR (376 MHz, CDCl3) δ -75.81. Compound 9d is N -(9-fluorenemethyloxycarbonyl)-O -(3,4,6-Three-) O -Acetyl-2-deoxy-2-trifluoroacetamido- α -D-galactosyl)-L-tyrosine ethanolamide. Compound 9d (0.2581 g, 0.31 mmol, 93% yield) was synthesized from compound 8d (0.2642 g, 0.34 mmol) according to general procedure II. 1 H NMR (400 MHz, CDCl3) δ 7.77(d, J = 7.6 Hz, 2H), 7.54 (dd, J = 10.5, 7.4 Hz, 2H), 7.41 (t, J = 7.5 Hz,2H), 7.31 (t, J = 7.4 Hz, 2H), 7.19 – 7.10 (m, 2H), 6.98 (d, J = 8.1 Hz, 2H), 6.65 (d, J = 9.2 Hz, 1H), 6.10 (s, 1H), 5.58 (d, J = 3.5 Hz, 1H), 5.48 –5.36 (m, 2H), 4.77 – 4.63 (m, 1H), 4.44 (d, J = 8.2 Hz, 1H), 4.35 (s, 2H), 4.22 (d, J = 6.6 Hz, 1H), 4.18 (t, J = 6.6 Hz, 1H), 4.06 (t, J = 6.2 Hz, 2H), 3.56 (d, J = 16.7 Hz, 2H), 3.32 (s, 2H), 3.03 (d, J = 27.5 Hz, 2H), 2.20 (s,3H), 2.05 (s, 3H), 1.96 (s, 3H); 13C NMR (101 MHz, CDCl3) δ 171.47, 170.98,170.46, 170.14, 157.52 (q, J = 37.8 Hz), 156.06, 154.97, 143.67, 143.61,141.30, 131.75, 130.71, 127.83, 127.10, 125.00, 124.92, 120.06, 117.17,115.57 (q, J = 287.8 Hz), 96.23, 67.85, 67.56, 67.04, 66.81, 61.52, 61.38,56.40, 48.74, 47.10, 42.13, 37.95, 20.66, 20.56, 20.54; 19 F NMR (376 MHz, CDCl3) δ -75.88. Compound 10d is O -(2-Deoxy-2-trifluoroacetamido- α -D-galactosyl)-L-tyrosine ethanolamide. Compound 10d (0.0976 g, 0.20 mmol, 65% yield) was synthesized from compound 9d (0.2481 g, 0.30 mmol) according to general procedure III. 1 H NMR (400 MHz, D2O) δ 7.21 (t, J = 8.3 Hz, 2H), 7.13 (dd, J = 17.7,8.3 Hz, 2H), 5.66 (d, J = 3.7 Hz, 1H), 4.42 (dd, J = 11.1, 3.7 Hz, 1H), 4.26(dd, J = 11.1, 3.3 Hz, 1H), 4.15 – 4.04 (m, 2H), 3.72 (dt, J = 10.0, 4.8 Hz, 3H), 3.57 – 3.38 (m, 2H), 3.26 – 3.15 (m, 2H), 3.02 – 2.85 (m, 2H); 13C NMR(101 MHz, D2O) δ 181.45, 159.44 (q, J = 37.8 Hz), 155.22, 131.04, 130.58,117.45, 117.31, 117.18 (q, J = 285.4 Hz), 95.85, 71.95, 71.82, 68.35, 66.95,61.05, 61.02, 59.71, 55.99, 50.62, 41.15, 39.03; 19 F NMR (376 MHz, D2O) δ -75.35. Compound 11d is N -( N -Hydroxysuccinyl adipic acid)- O -(2-Deoxy-2-trifluoroacetamido- α -D-galactosyl)-L-tyrosine ethanolamide: Compound 11d (0.1107 g, 0.16 mmol, 79% yield) was synthesized from compound 10d (0.0976 g, 0.20 mmol) according to general procedure IV. 1 H NMR (400 MHz, D2O) δ 7.22 (d, J = 8.5 Hz, 2H), 7.07 (d,J = 8.5 Hz, 2H), 5.64 (d, J = 3.7 Hz, 1H), 4.59 (dd, J = 9.7, 5.9 Hz, 1H), 4.42 (dd, J = 11.1, 3.7 Hz, 1H), 4.25 (dd, J = 11.0, 3.2 Hz, 1H), 4.11 – 4.03(m, 2H), 3.78 – 3.69 (d, J = 6.5 Hz, 2H), 3.61 – 3.48 (m, 2H), 3.29 (t, J =5.5 Hz, 2H), 3.14 (dd, J = 14.0, 6.0 Hz, 1H), 2.95 (s, 4H), 2.91 – 2.83 (m,1H), 2.63 – 2.51 (m, 2H), 2.23 (t, J = 6.9 Hz, 2H), 1.55 – 1.38 (m, 4H); 13CNMR (101 MHz, D2O) δ 176.25, 173.44, 173.40, 170.36, 155.06, 131.22, 130.35,117.18, 117.09, 95.61, 71.78, 68.32, 66.99, 60.95, 59.79, 54.95, 50.56,41.37, 36.43, 34.82, 29.85, 25.51, 25.14, 24.23, 22.75; 19 F NMR (376 MHz, D2O)δ -75.35. Compound 8e is N -(9-fluorenemethyloxycarbonyl)- O -(3,4-two-) O -Acetyl-2-deoxy-2-acetamido-6-deoxy-6-fluoro- α -D-galactosyl)-L-tyrosine. Compound 8e (0.3315 g, 0.48 mmol, 89% yield) was synthesized from compound 7e (0.4016 g, 0.54 mmol) according to general procedure I. 1 H NMR (400 MHz, CDCl3) δ 7.78 (d, J =7.6 Hz, 2H), 7.56 (t, J = 8.4 Hz, 2H), 7.41 (t, J = 7.4 Hz, 2H), 7.32 (t, J =7.5, 2H), 7.06 (d, J = 8.1 Hz, 2H), 6.96 (d, J = 8.2 Hz, 2H), 5.82 (d, J =9.5 Hz, 1H), 5.59 (d, J = 4.4 Hz, 1H), 5.48 (d, J = 3.8 Hz, 1H), 5.42 (dd, J= 10.8, 2.6 Hz, 1H), 5.23 (d, J = 8.0 Hz, 1H), 4.76 (td, J = 9.6, 3.5 Hz,1H), 4.70 – 4.62 (m, 1H), 4.53 – 4.46 (m, 1H), 4.45 – 4.38 (m, 1H), 4.35 –4.17 (m, 2H), 3.12 (d, J = 6.6 Hz, 2H), 2.20 (s, 3H), 2.06 (s, 3H), 1.98 (s, 3H); 13C NMR (101 MHz, CDCl3) δ 171.53, 171.29, 170.46, 155.85, 155.28, 143.90,143.74, 141.42, 130.96, 127.87, 127.16, 125.20, 125.14, 120.14, 116.74,96.50, 81.11 (d, J = 172.2 Hz), 68.23 (d, J = 22.6 Hz), 68.05, 67.25 (d, J =5.2 Hz), 67.04, 54.70, 48.17, 47.22, 37.13, 23.15, 20.90, 20.80; 19 F NMR (376MHz, CDCl3) δ -231.88. Compound 9e is N -(9-fluorenemethyloxycarbonyl)- O -(3,4-two-) O -Acetyl-2-deoxy-2-acetamido-6-deoxy-6-fluoro- α -D-galactosyl)-L-tyrosine ethanolamide. 1 H NMR (400 MHz, CDCl3) δ 7.76 (d, J =7.6 Hz, 2H), 7.52 (dd, J = 13.0, 7.5 Hz, 2H), 7.40 (t, J = 7.5 Hz, 2H), 7.29(t, J = 7.7 Hz, 2H), 7.11 (d, 5.38 (dd, J = 11.4, 3.3 Hz, 1H), 4.72 (td, J = 12.3, 3.5 Hz, 1H), 4.49 – 4.06 (m, 4H), 3.52 (d, J = 21.8 Hz, 2H), 3.28 (s, 2H), 3.10 – 2.91 (m, 2H), 2.17 (s, 3H), 2.05 (s, 3H), 1.95 (s, 3H); 13C NMR (101 MHz, CDCl3) δ171.55, 171.23, 170.49, 170.37, 156.12, 155.39, 143.81, 141.44, 131.37,130.78, 130.66, 127.93, 127.22, 125.12, 120.17, 117.02, 96.77, 82.20, 80.50,68.55, 68.32, 68.11, 67.33, 67.27, 67.16, 61.70, 56.61, 48.16, 47.23, 42.24,38.20, 23.37, 20.92, 20.81; 19 F NMR (376 MHz, CDCl3) δ -231.39. Compound 10e is O -(2-deoxy-2-acetamido-6-deoxy-6-fluoro- α -D-galactosyl)-L-tyrosine ethanolamide. Compound 10e (0.2053 g, 0.48 mmol, 99% yield in two steps) was synthesized from compound 8e (0.3315 g, 0.48 mmol) according to general steps II and III. 1 H NMR (400 MHz, D2O) δ 7.18 (d, J = 8.6 Hz, 2H), 7.06 (d, J = 8.6 Hz, 2H), 5.59 (d, J = 3.7 Hz, 1H), 4.74 – 4.48 (m, 2H), 4.34(dq, J = 11.4, 4.5 Hz, 2H), 4.19 – 4.08 (m, 2H), 3.66 (t, J = 7.0 Hz, 1H), 3.46 (dq, J = 24.9, 5.7 Hz, 2H), 3.20 (t, J = 5.7 Hz, 2H), 2.98–2.84 (m, 2H),2.03 (s, 3H); 13 C NMR (101 MHz, D2O) δ 175.37, 174.70, 155.12, 131.26, 130.63,117.39, 96.43, 83.28 (d, J = 165.6 Hz), 70.20 (d, J = 19.9 Hz), 68.06 (d, J =7.4 Hz), 67.27, 59.72, 56.09, 49.58, 41.11, 39.17, 21.87. Compound 11e is N -( N -Hydroxysuccinyl adipic acid)- O -(2-deoxy-2-acetamido-6-deoxy-6-fluoro- α -D-galactosyl)-L-tyrosine ethanolamide: Compound 11e (0.2173 g, 0.33 mmol, 69% yield) was synthesized from compound 10e (0.2053 g, 0.48 mmol) according to general procedure IV. 1 H NMR (400 MHz, D2O) δ 7.22 (d, J = 8.2 Hz, 2H), 7.06 (d,J = 8.2 Hz, 2H), 5.60 (d, J = 3.6 Hz, 1H), 4.73 – 4.47 (m, 3H), 4.38 – 4.27(m, 2H), 4.14 (dd, J = 10.9, 3.3 Hz, 1H), 4.10 (d, J = 3.3 Hz, 1H), 3.62 –3.50 (m, 2H), 3.29 (t, J = 5.6 Hz, 2H), 3.14 (dd, J = 14.0, 5.8 Hz, 1H), 2.94(s, 4H), 2.87 (dd, J = 14.0, 9.8 Hz, 1H), 2.63 – 2.55 (m, 2H), 2.22 (t, J =7.0 Hz, 2H), 2.02 (s, 3H), 1.53 – 1.37 (m, 4H); 13 C NMR (101 MHz, D2O) δ176.23, 174.61, 173.42, 173.35, 170.39, 155.00, 131.32, 130.43, 117.19,96.19, 83.24 (d, J = 165.2 Hz), 70.17 (d, J = 20.4 Hz), 68.05 (d, J = 7.4Hz), 67.33, 59.79, 54.96, 49.53, 41.37, 36.43, 34.87, 29.87, 25.50, 24.25,22.80, 21.87; 19 F NMR (376 MHz, D2O) δ -230.12. Example 2 (1) Expression of Qβ: The Qβ plasmid was heat-shocked at 42 °C into competent Escherichia coli BL21 cells, and then inoculated into 10 mL of LB medium containing ampicillin and cultured overnight at 37 °C. Subsequently, the amplified bacterial culture was transferred to 1 L of LB medium and cultured at 37 °C for 4 h. When the OD600 reached 0.6, the culture temperature was lowered to 20 °C to induce protein expression. After 48 h, the bacterial cells were collected by centrifugation, resuspended in 1×PBS (pH 7.0), and then sonicated to lyse. The supernatant was then collected by centrifugation at 14,000 rpm for 20 min at 4 °C.

[0070] To precipitate Qβ particles, PEG 8000 to a final concentration of 10% (w / v) was added to the supernatant and mixed overnight at 4 °C. The precipitate was recovered by centrifugation at 14,000 rpm for 20 min and resuspended in 1× PBS (pH 7.0). The resulting protein solution was mixed with chloroform / n-butanol (1:1, v / v) at a ratio of 1:1 and stirred to form a homogeneous colloid. Subsequently, phase separation was performed by centrifugation at 7000 rpm for 1 h, and the aqueous phase (supernatant) was collected.

[0071] The samples were concentrated using a Millipore 100k MWCO ultrafiltration membrane and further purified by centrifugation using a 10–40% (w / v) sucrose density gradient (SW32 oscillating rotor, 28,000 rpm, 5 h). During purification, protein bands were visually observed under LED illumination, and 1 mL of the bright blue band was collected as the purified product.

[0072] Qβ particles were subjected to ultrafiltration using a Millipore 100k MWCO membrane to remove residual sucrose, and then further purified using a Sepharose CL-4B cross-linked agarose gel, followed by thorough washing with 10× PBS. Finally, protein concentration was determined using the BCA protein assay.

[0073] The purified Qβ particles were characterized by ESI-TOF mass spectrometry, DLS, and TEM (e.g., Figures 15-17 As shown in the figure, its particle size, uniformity, morphology and purity were analyzed.

[0074] (2) Preparation of Qβ-Tyr-GalNAc conjugate according to Figure 27The synthetic flow chart shown illustrates the process for preparing the Qβ-Tyr-GalNAc conjugate. First, Qβ particles (53.9 mg, 20.5 nmol particles, 3.7 μmol subunits, 14.7 μmol reactive amino groups) were dissolved in 22.3 mL of potassium phosphate buffer (0.1 M, pH 7.2) and transferred to a 50 mL centrifuge tube. Subsequently, 0.278 mmol of NHS-Tyr-GalNAc series compound 11 was dissolved in 1.42 mL of DMSO (18.9 molar equivalents per reactive amino group) and added to the reaction tube. After mixing, the reaction mixture was incubated overnight at room temperature by rotation. After the reaction was complete, the reaction mixture was diluted with 50 mL of 1× PBS (pH 7.4) and purified using a Millipore 100k MWCO centrifuge filter, with repeated washing to remove unconjugated Tyr-GalNAc antigen. After each buffer change, the absorbance of the effluent at 210 nm, 260 nm, and 280 nm was measured using a Nano DROP instrument to monitor the washing process. SDS-PAGE electrophoresis was used to further confirm the washing effect and the final protein purity. Finally, the conjugated Qβ-Tyr-GalNAcr particles were collected in 1× PBS (pH 7.4) to obtain Qβ-Tyr-GalNAc conjugate series 12 (compounds 12a~12e), which are complete tumor antigens based on tyrosine-acetylgalactosamine and its fluorinated derivatives.

[0075] Test Example 1 (1) Structural identification data Nuclear magnetic resonance analysis: All nuclear magnetic resonance spectral data were acquired at room temperature using a Bruker Avance III nuclear magnetic resonance spectrometer. 1 The H NMR detection frequency is 400 MHz or 600 MHz. 13 The C NMR detection frequency is 101 MHz. 19 The F NMR detection frequency was 376 MHz. The chemical shift (δ) was calibrated with reference to the standard peak shift of the residual solvent in tetramethylsilane (TMS) or deuterated reagents. Commonly used solvents are CDCl3 and D2O, with the reference chemical shift for the residual hydrogen signal in CDCl3 being δ 7.26 (…). 1 H) and δ 77.0 ( 13 C), the reference chemical shift of the residual water peak (HDO) in D2O is δ 4.79 ( 1 H). The reporting format of NMR data includes chemical shift (δ), integral, multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, m = multiply), and coupling constant (J).

[0076] Mass spectrometry analysis: High-resolution mass spectrometry data were acquired using a Waters Q-TOF mass spectrometer (Xevo G2 Q-TQF) at the Chemical Instrumentation Center of Peking University School of Medicine. High-resolution electrospray ionization time-of-flight mass spectrometry data were acquired using a Waters SYNAPT G2-Si high-resolution ion mobility mass spectrometer. Matrix-assisted laser desorption / ionization time-of-flight mass spectrometry data were recorded using a Bruker ultrafleXtreme MALDI-TOF / TOF mass spectrometer.

[0077] The detection results of target compounds 11a, 11b, 11c, 11d, and 11e prepared in Example 1 are as follows: Figures 1-14 As shown. The ESI-TOF mass spectrometry characterization results of the Qβ particle monomer and the Qβ-Tyr-GalNAc series conjugate monomers in Example 2 are as follows. Figure 15 As shown, Figure 15 a) in the text represents the Qβ monomer. Figure 15 b) in the text refers to the Qβ-Tyr-GalNAc monomer. Figure 15 c) in the text represents the Qβ-Tyr-GalNFAc monomer. Figure 15 d) in the figure represents the Qβ-Tyr-GalNF2Ac monomer. Figure 15 e) in the figure represents the Qβ-Tyr-GalNF3Ac monomer. Figure 15 f) in the figure is the Qβ-Tyr-6F-GalNAc monomer.

[0078] (2) DLS dynamic light scattering particle size determination The particle size of Qβ particles and Qβ-Tyr-GalNAc conjugates was determined using DLS at a solution concentration of 1 mg / mL. Three replicate experiments were set up, and the PdI (Polydispersity Index) was controlled to be less than 0.2 to ensure the uniformity of particle size distribution and the accuracy of data. Figure 16 DLS characterization data for Qβ particles and Qβ-Tyr-GalNAc series conjugates. Figure 16 The results showed that the PdI of all particles was less than 0.2, and the average particle size distribution was about 30 nm, indicating that the particle size distribution was uniform.

[0079] (3) Transmission electron microscope For transmission electron microscopy (TEM) analysis, 10 μL of Qβ-Tyr-GalNAc conjugate solution (0.5 μg / μL, dissolved in 1×PBS buffer) was added dropwise onto a 200-mesh carbon-coated copper grid and allowed to stand at room temperature for 1 min for adsorption. After blotting off excess liquid with filter paper, the grid was negatively stained with 10 μL of 2% (w / v) phosphotungstic acid solution for 1 min. After removing excess stain, the copper grid was allowed to air dry at room temperature. The morphology of the Qβ-Tyr-GalNAc conjugate was observed using a JEM-1400PLUS TEM. Figure 17 TEM transmission electron microscopy images of Qβ particles and Qβ-Tyr-GalNAc series conjugates (scale bar: 50 nm).

[0080] Test Example 2 The reagents used in this test case included: chemical reagents purchased from Sigma-Aldrich, TCI, Acros, Adamas, CS Bio, J&K, Gir Biochemical, Energie, Innovent, and McLean, and used directly; Freund's adjuvant purchased from Sigma-Aldrich BS; all antibodies purchased from Biolegend or Proteintech; cell culture consumables purchased from Thermo or Corning; CCK-8 kit purchased from Yeasen; and live / dead cell identification dye purchased from Thermo.

[0081] The instruments used in this test case included: absorbance data for enzyme-linked immunosorbent assay (ELISA) recorded by a Thermo Scientific Multiskan GO microplate reader; and flow cytometry data acquired by a Beckman Coulter CytoFLEX dual-laser flow cytometer.

[0082] The experimental method for this test case is as follows: (1) Mouse immunization Female BALB / c mice (8 weeks old) were purchased from the Department of Laboratory Animal Science, Peking University School of Medicine, and housed in a specific pathogen-free environment. All procedures were performed in accordance with the "Guidelines for the Care and Use of Laboratory Animals" and approved by the Professional Committee on Laboratory Animal Welfare and Ethics of Peking University (Approval No.: LA2022225). Mice were randomly divided into six groups (n=5 per group) and immunized with either Qβ particles emulsified with Freund's adjuvant (CFA or IFA, 1:1, v / v) or Qβ-Tyr-GalNAc conjugate. The hapten dose per mouse was 10 nmol, with the total protein content of the Qβ particle group kept constant. The antigen was diluted with physiological saline and emulsified with CFA or IFA using a homogenizer or vortex mixer. 0.1 mL of the emulsion was injected subcutaneously into the nape of the neck of each mouse. Primary immunization: CFA on day 0; booster immunizations: IFA on days 14 and 28. Serum samples were collected on days 7, 21, 35, and 45. Antibody titer was determined by ELISA.

[0083] (2) ELISA to determine antibody titer Antibody titers were determined using enzyme-linked immunosorbent assay (ELISA). The simplified procedure is as follows: BSA-Tyr-GalNAc, BSA-Thr-GalNAc, or BSA-Ser-GalNAc conjugates (10 µg / mL, 100 µL per well) were diluted with 1× PBS (pH 7.4) and coated onto Nunc 96-well microplates, incubated overnight at 4 °C. Subsequently, the plates were washed three times with PBST (300 µL per well) and blocked for 2 hours at room temperature with PBST solution containing 5% BSA (200 µL per well). After blocking, the plates were washed three more times with PBST.

[0084] Mouse antiserum diluted serially with 1% BSA / PBST (100 µL per well, triple replicate) was added to the wells of the plate and incubated at room temperature for 2 hours, followed by washing three times with PBST. Then, horseradish peroxidase-conjugated goat anti-mouse IgG (H+L), IgM, IgG1, IgG2a, IgG2b, or IgG3 secondary antibodies diluted 1:6000 with 1% BSA / PBST (100 µL per well) were added to detect total IgG and each IgG subclass. After incubation at room temperature for 2 hours, the plate was washed five times with PBST.

[0085] The colorimetric reaction was initiated by incubation of 100 µL of TMB substrate solution per well for 3 minutes, followed by termination with 50 µL of 2 M H₂SO₄ per well. Absorbance was measured at 450 nm using a microplate reader. Antibody titer was calculated using four-parameter logistic regression analysis with GraphPadPrism software, defined as the highest serum dilution producing an OD₄₅₀ value of 0.15.

[0086] (3) Knockout of COSMC gene in CT26, B16F10 and 4T1 cell lines The CT26, B16F10, and 4T1 cell lines used in this invention were obtained from the National Cell Line Resource Infrastructure (China). The gDNA sequence GCGGTCTGCCTGAAATACGC (SEQ ID NO.1) was cloned into the BbsI restriction site of the px458 plasmid to construct the COSMC-KO plasmid. Cells were transfected according to the Lipo2000 manufacturer's instructions, and 96 GFP-positive single cells were obtained by flow cytometry sorting after 48 hours. The COSMC gene knockout single clones were verified by genome sequencing.

[0087] (4) Tumor cell culture CT26-KO, B16F10-KO, and 4T1-KO cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. All cells were cultured in a humidified incubator at 37°C and 5% CO2. When cell confluence reached approximately 80-90%, the medium was aspirated, and the cells were gently washed once with DPBS (pH 7.4). Then, an appropriate amount of 0.25% trypsin-EDTA solution was added, and the cells were incubated for 1-2 minutes until they became rounded and detached from the culture dish. Fresh medium was immediately added to stop the digestion. The cells were resuspended by gentle pipetting and centrifuged at 1000 rpm for 3 minutes to collect the cells. The supernatant was discarded, and the cell pellet was resuspended in fresh medium and passaged at an appropriate ratio for subsequent culture or experiments.

[0088] (5) Flow cytometry detection of serum antibodies binding to tumor cells CT26-KO cells were collected, washed with DPBS, and resuspended to a concentration of 5 × 10⁻⁶. 5 cells mL -1 Take a sample containing 5 × 10 5 Cell suspensions were aliquoted into 1.5 mL microcentrifuge tubes. A viability-fixing dye (1 µL per sample) was added, and the tubes were incubated on ice in the dark for 30 minutes to distinguish live from dead cells. After centrifugation (600 × g, 3 min, 4 °C), the cells were resuspended in 100 µL of flow cytometry buffer (DPBS containing 5% FBS) and divided into two equal aliquots (2.5 × 10⁶ cells per aliquot). 5Cells were incubated on ice for 30 minutes with pre-immunization or post-immunization serum (25 µL diluted 1:20 with 0.5% BSA-DPBS). After washing twice with flow cytometry buffer, FITC-labeled anti-mouse IgG secondary antibody (50 µL diluted 1:1000 with 0.5% BSA-DPBS) was added, and the cells were incubated on ice for another 30 minutes. Cells were washed twice more with flow cytometry buffer, and finally resuspended in 200 µL of flow cytometry buffer for analysis using a dual-laser flow cytometer. Data were processed using FlowJo software.

[0089] (6) Complement-dependent cytotoxicity (CDC) detection The CCK-8 assay was used to evaluate the complement-dependent cytotoxicity of mouse antiserum against CT26-KO, B16F10-KO, and 4T1-KO cells. Cells were seeded at a density of 5,000 cells per well in 96-well plates and cultured in RPMI-1640 medium containing 10% heat-inactivated FBS (treated at 56°C) and 1% penicillin-streptomycin at 37°C and 5% CO2 for 48 hours until cell confluence reached approximately 60%. After incubation, the medium was removed, and 50 μL of mouse antiserum diluted 1:50 with the medium was added to each well. The plates were then incubated at 37°C and 5% CO2 for 30 minutes. Subsequently, 50 μL of rabbit complement serum diluted 1:40–1:20 was added to each well, and the plates were incubated for another 1–2 hours under the same conditions.

[0090] After incubation, remove the supernatant and add 100 μL of CCK-8 working solution (10%, v / v) to each well. Incubate the plate at 37 ℃ for another hour, and measure the absorbance at 450 nm using a microplate reader. Wells containing only cultured cells without antibody treatment serve as positive controls (maximum OD450 value), while wells containing only culture medium serve as negative controls (minimum OD450 value). All experiments were performed in triplicate.

[0091] Cell viability is calculated using the following formula: ; (7) Antibody-dependent phagocytosis (ADCP) assay CFSE-labeled CT26-KO cells were used at a density of 5 × 10⁶ cells per well. 4 Cells were seeded at a density of 1.6 × 10⁶ cells / well in 24-well plates. 100 µL of antiserum diluted 1:50 was added, and the plates were incubated at 37 °C for 1 hour, with pre-immunization mouse serum used as a negative control. After incubation, cells were washed with PBS to remove unbound antibodies. Bone marrow-derived macrophages (BMDMs) were isolated from mice and seeded at 1.6 × 10⁶ cells / well. 5The cells were added to the well at a density of 1,000 cells and co-cultured with the target cells at 37 °C for 4 hours.

[0092] After co-culture, all cells were collected, and BMDMs within them were labeled with CD11b, which is phycoerythrin-labeled. Samples were then used for flow cytometry analysis.

[0093] Antibody-dependent phagocytosis is calculated using the following formula: ; Q2 and Q3 represent the corresponding gated cell populations determined by flow cytometry.

[0094] (8) Mouse in vivo tumor prevention experiment Eight-week-old female Balb / c mice were purchased from the Animal Breeding Laboratory of Peking University School of Medicine and housed in the Experimental Animal Department of Peking University. The experiment was conducted according to the guidelines of the relevant institutions and was approved by the Animal Ethics and Use Committee. Mice were randomly divided into 7 groups of 8 mice each, and were immunized with either Freund's adjuvant (CFA or IFA, 1:1, v / v) emulsion, or aluminum adjuvant (1:1, v / v) mixed Qβ particles, or Qβ-Tyr-GalNAc conjugate. The hapten dose per mouse was 10 nmol, with the total protein content in the Qβ particle group kept constant. The antigen was diluted with physiological saline. Each mouse received a subcutaneous injection of 0.1 mL of the emulsion via the nape of the neck. In the Freund's adjuvant group: CFA was administered on day 0; IFA was administered on days 14 and 28. On day 35, CT26-KO cells were subcutaneously inoculated, 1 million cells per mouse, and resuspended in 100 μL DPBS. The size, weight, and survival status of subcutaneous tumors in mice were continuously recorded.

[0095] Experimental results: Results of antibody titer assay after immunization of mice with Qβ-Tyr-GalNAc series conjugates Figure 18 This is a graph of the ELISA results. Figure 18 a) in the figure is a schematic diagram of the immunization procedure and blood collection time points, with 5 mice in each group. Figure 18 b) in the figure represents the analysis of the total anti-Tyr-GalNAc IgG titer in serum over time using an ELISA method with BSA-Tyr-GalNAc as the coating antigen. Figure 18 c) in the figure represents the total anti-Tyr-GalNAc IgG titer in the serum on day 45, with each dot representing one mouse. Figure 18 In the figures d) and e), the immune response to Qβ-Tyr-GalNFAc (e.g., on day 45) was observed. Figure 18 (d) shown in the figure) and immune Qβ-Tyr-GalNF2Ac (as shown in the figure) Figure 18The levels of anti-Tyr-GalNAc IgG subclasses and IgM in mouse serum (e) are shown in Figure 1. Each dot represents a mouse. Figure 18 f) represents serum-specific analysis. Serum was diluted 1:1000 on day 45 and its binding affinity to BSA conjugates of Tyr-GalNAc, Thr-GalNAc, or Ser-GalNAc was assessed by ELISA. Each dot represents one mouse. Results are expressed as mean ± standard error. One-way ANOVA was performed using GraphPad Prism to determine statistical significance. p<0.05; p < 0.0001; ns, no significant difference).

[0096] Figure 18 ELISA results showed that the unfluorinated Qβ-Tyr-GalNAc itself elicited a strong immune response. Furthermore, the vaccines Qβ-Tyr-GalNFAc and Qβ-Tyr-GalNF2Ac, with monofluorinated and difluorinated groups introduced at the two positions of galactosamine, further enhanced this immune response. The other two fluorinated modifications were comparable in potency to the unfluorinated vaccine.

[0097] Among them, Qβ-Tyr-GalNF2Ac exhibited the strongest immunogenicity. Antibody subtype analysis revealed that it induced a much larger amount of IgG than IgM, indicating that it can more effectively trigger Th cell activation and T cell-dependent B cell immune responses. In addition, Qβ-Tyr-GalNFAc and Qβ-Tyr-GalNF2Ac were found to induce the production of multiple IgG subtypes, such as IgG1, IgG2a, and IgG2b, indicating humoral homeostasis in the immune process. The large-scale production of IgG1 mediating ADCC suggests its potential anti-tumor activity.

[0098] The synthesis of BSA-Thr-GalNAc and BSA-Ser-GalNAc was used to examine antibody specificity. The results showed that serum antibodies bound to BSA-Tyr-GalNAc much more strongly than to BSA-Thr-GalNAc and BSA-Ser-GalNAc, indicating higher specificity. Binding assay of serum and tumor cells to CT26-KO after immunization: The binding of post-immunization serum to the CT26-KO cell line expressing Tyr-GalNAc antigen was detected by flow cytometry. The experimental method was as described above, and the test results are as follows.

[0099] Figure 19The serum can bind to the surface of CT26-KO cells after immunization. Figure 19 In Figure a), a representative flow cytometry atlas shows the binding of mixed serum from immunized mice on day 45 to CT26-KO cells. The Vehicle group served as a control group without serum, and the Pre-immune group served as a serum control group on day 0. Mouse serum was stained with FITC-labeled anti-mouse IgG. Figure 19 b in the text is a pair Figure 19 Statistical analysis of flow cytometry results in section a). Results were standardized using the Vehicle group as a baseline and are expressed as mean ± standard deviation (n = 3 replicates). One-way ANOVA was performed using GraphPad Prism to determine statistical significance. p<0.05; p<0.001; p<0.0001). Figure 19 c) shows the immunofluorescence staining of CT26-KO cell surface with serum after mixed immunization on day 45. Mouse serum was stained with anti-mouse IgG labeled with CoraLite 647 (red), and cell nuclei were stained with Hoechst 33342 (blue). Scale bar: 50 μm.

[0100] Flow cytometry results showed that, compared with pre-immunization serum, mouse serum immunized with Qβ-Tyr-GalNAc exhibited binding to CT26-KO, while serum immunized with Qβ-Tyr-GalNFAc and Qβ-Tyr-GalNF2Ac enhanced this binding. This indicates that Qβ-Tyr-GalNFAc and Qβ-Tyr-GalNF2Ac can induce the production of antibodies that recognize Tyr-GalNAc on the surface of tumor cells.

[0101] Antibody-mediated phagocytosis and complement-dependent cytotoxic effects in serum after immunization: The CDC effect on CT26-KO, B16F10-KO and 4T1-KO and the ADCP effect on CT26-KO were tested using post-immunization serum. The experimental method was as described above, and the results are as follows.

[0102] Figure 20 The study aimed to determine the CDC effect of the mixed immunized serum on CT26-KO, B16F10-KO and 4T1-KO, and the ADCP effect on CT26-KO. Figure 20In this figure, A represents the complement-dependent cytotoxicity of serum on CT26-KO cells after co-immunization on day 45, as determined by the CCK-8 assay. The co-immunized serum dilution ratio was 1 / 50; the complement dilution ratio was 1 / 40. Cell viability was standardized against the Vehicle group, and results are expressed as mean ± standard deviation (n = 3 replicates). One-way ANOVA was performed using GraphPad Prism to determine statistical significance. P<0.01; P<0.001; P<0.0001). Figure 20 B, C, and D in the table represent complement-dependent cytotoxicity of serum following co-immunization on day 45 to CT26 and CT26-KO cells, B16F10 and B16F10-KO cells, and 4T1 and 4T1-KO cells, as determined by the CCK-8 assay. Co-immunized serum dilution ratio: 1 / 50; complement dilution ratio: 1 / 20. Cell viability was standardized against the pre-immunization serum group, and results are expressed as mean ± standard deviation (n = 3 replicates). A t-test was performed using GraphPad Prism to determine statistical significance. P<0.01; p < 0.0001; ns, not significant). Figure 20 E in the figure represents the representative flow cytometry result of ADCP effect. Figure 20 F in the table represents the statistical analysis results of ADCP effect, used to assess the role of serum after mixed immunization on day 45. CT26-KO cells were labeled with CFSE, and BMDM cells were stained with PE-CD11b. PE in the Q2 gate... + CFSE + The cells were defined as phagocytosed CT26-KO cells, PE cells in the Q3 phylum. - CFSE + Cells were defined as unphagocytosed CT26-KO cells. Target cell phagocytosis rate was defined as Q2 / (Q2+Q3). ​​Data are presented as mean ± standard deviation (n = 3 replicates). One-way ANOVA was performed using GraphPad Prism to determine statistical significance. P<0.0001).

[0103] The CDC assay aimed to evaluate the ability of serum antibodies generated after immunization to activate the complement system and kill target cells. In the experiment, CT26-KO cells were co-incubated with diluted serum and rabbit complement was added. Cell death was then detected using a CCK-8 assay kit. The results showed that serum antibodies generated after Qβ-Tyr-GalNF2Ac immunization exhibited the strongest CDC effect, achieving a cell-killing rate of 71%. Similarly, serum antibodies generated after Qβ-Tyr-GalNF2Ac immunization produced a CDC effect against B16F10-KO and 4T1-KO cells, but did not kill wild-type CT26, B16F10, and 4T1 cells.

[0104] ADCP was designed to measure antibody-mediated phagocytosis. The results showed that, similarly, serum antibodies produced after immunization with Qβ-Tyr-GalNF2Ac exhibited the strongest phagocytic activation activity and tumor cell killing ability. Antibodies produced after immunization with other modified vaccines also showed significantly stronger ADCP effects than the background.

[0105] Cancer prevention efficacy of vaccines: Based on the preliminary experiments described above, vaccine formulations based on Qβ-Tyr-GalNFAc and Qβ-Tyr-GalNF2Ac have potential for tumor prevention and treatment. Therefore, they were mixed with Freund's adjuvant and clinically commonly used aluminum adjuvant, respectively, and used to formulate vaccines. Vaccines were administered on days 0, 14, and 28, and CT26-KO tumor cells were injected on day 35. Tumor growth and weight changes were continuously monitored, and the results are as follows: Figure 21 As shown.

[0106] Figure 21 Vaccination with Qβ-Tyr-GalNFAc and Qβ-Tyr-GalNF2Ac can protect mice from CT26-KO tumor progression. Figure 21 Figure a) shows the timeline for immunization, blood collection, and CT26-KO cell inoculation. Eight mice were used in each group for immunization, using either Freund's adjuvant or aluminum adjuvant. Figure 21 b) in the figure represents the CT26-KO tumor volume in immunized mice. Tumor volume is expressed as (length × width) 2 ) / 2. Data are expressed as mean ± standard error (n = 8 mice). One-way ANOVA was performed using GraphPad Prism to compare tumor volume at day 53 between the Qβ-Tyr-GalNFAc or Qβ-Tyr-GalNF2Ac groups with the same adjuvant and the Qβ-immunized group. P<0.05; P < 0.001; ns, no significant difference). Figure 21 c) represents the survival time of immunized mice. A Log-Rank test was performed using GraphPad Prism to compare the significant differences in survival time between the Qβ-Tyr-GalNFAc or Qβ-Tyr-GalNF2Ac groups and the Qβ-immunized group using the same adjuvant. P<0.05; P<0.01; P < 0.001; ns, no significant difference).

[0107] The results showed that the vaccine formulations based on Qβ-Tyr-GalNFAc and Qβ-Tyr-GalNF2Ac exhibited significant tumor prevention efficacy. Mice vaccinated with the fluorinated vaccine showed smaller tumor volume and higher survival rate, suggesting that such vaccines may be a promising component of combination cancer therapy.

[0108] As demonstrated by the above embodiments, the fluorination modification of tyrosine acetylgalactosamine in this invention reduces the recognition of glycoside hydrolases and improves its metabolic stability. The complete antigen provided by this invention can induce higher antibody titers in mice and exhibits a preference for IgG, demonstrating its stronger T-cell activation ability. The serum of mice immunized with the vaccine provided by this invention can better recognize and bind to CT26-KO tumor cells; in addition, it exhibits significant CDC and ADCP effects, showing potential selective killing of tumor cells highly expressing Tyr-GalNAc. The tumor vaccine based on tyrosine-fluorinated acetylgalactosamine provided by this invention significantly slows tumor growth and improves mouse survival, demonstrating significant tumor prevention effects.

[0109] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. Other embodiments can be obtained based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A class of tumor haptens based on tyrosine-acetylgalactosamine and its fluorinated derivatives, characterized in that, It has the structure shown in Equation I: Equation I; R1 is selected from -OH or F, and R2 is selected from -CH3, -CH2F, -CHF2 or -CF3.

2. The tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives according to claim 1, characterized in that, When R1 is -OH, R2 is selected from -CH3, -CH2F, -CHF2 or -CF3; when R1 is F, R2 is selected from -CH3.

3. A method for preparing a type of tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives as described in claim 1 or 2, characterized in that, Includes the following steps: Compound 7, trifluoroacetic acid, and an organic solvent were mixed and reacted to obtain compound 8; Compound 8, HATU, DIEA, ethanolamine, and an organic solvent were mixed and reacted to obtain compound 9; Compound 9 was reacted with an ammonia-methanol solution in a protective gas atmosphere to obtain compound 10; Compound 10, adipic acid di( N The ester of tyrosine-acetylgalactosamine and its fluorinated derivatives are reacted to obtain the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives. The chemical structures of compounds 7, 8, 9, and 10 are as follows: 、 、 、 。 4. The preparation method according to claim 3, characterized in that, Compound 7 is selected from compound 7a, compound 7b, compound 7c, compound 7d, or compound 7e; The preparation method of compounds 7b, 7c, and 7d includes the following steps: mixing compound 6, zinc powder, and acetic acid to react and obtain an intermediate product; mixing the intermediate product and a fluorine-containing raw material in an organic solvent to react and obtain compounds 7b, 7c, and 7d. The fluorine-containing raw material used to prepare compounds 7b, 7c, and 7d is selected sequentially from fluoroacetic acid, difluoroacetic acid, and trifluoroacetic anhydride. The preparation method of compound 7e includes the following steps: mixing compound 18, acetic anhydride-acetic acid organic solution and zinc powder and reacting them to obtain compound 7e; 、 、 、 、 、 、 。 5. A class of complete tumor antigens based on tyrosine-acetylgalactosamine and its fluorinated derivatives, characterized in that, The tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives as described in claim 1 or 2, or the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives prepared by the preparation method described in claim 3 or 4, is conjugated with virus-like particles.

6. The tumor complete antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives according to claim 5, characterized in that, The virus-like particles are Qβ virus-like particles.

7. The method for preparing the complete tumor antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives as described in claim 5 or 6, characterized in that, Includes the following steps: A buffer solution of virus-like particles and a hapten solution are mixed and incubated to obtain a complete tumor antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives. The hapten solution includes the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives and an organic solvent.

8. The use of the tumor hapten based on tyrosine-acetylgalactosamine and its fluorinated derivatives as described in claim 1 or 2, or the tumor complete antigen based on tyrosine-acetylgalactosamine and its fluorinated derivatives as described in claim 5 or 6, in the preparation of tumor vaccines.

9. The application according to claim 8, characterized in that, The tumor vaccines include colorectal adenocarcinoma vaccines, melanoma vaccines, or breast cancer vaccines.

10. A tumor vaccine based on tyrosine-acetylgalactosamine and its fluorinated derivatives, characterized in that, A complete tumor antigen comprising the tyrosine-acetylgalactosamine and its fluorinated derivatives as described in claim 5 or 6.

Images