Scaffold proteins derived from ly6 / uPAR proteins or / and clostridial neurotoxins and uses thereof
Patent Information
- Application Number
- CN202610710074.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-21
- Publication Date
- 2026-08-18
AI Technical Summary
但由于毒素仅与神经细胞膜上的特异受体结合,只能靶向神经细胞,无法实现各种细胞的靶向递送
本发明提供了衍生于Ly6/uPAR蛋白或/和梭菌神经毒素的支架蛋白及应用,通过重组的、非天然存在的支架蛋白,为工程化筛选与靶分子具有高亲和力、高特异性结合物提供工具,可对支架蛋白分子中的氨基酸进行随机化或定向性进化以生成结合多种靶标分子所需的多样性,可实现高效的多肽、蛋白质、核酸和/或其他需要输送的分子向细胞内靶向递送。
Smart Images

Figure CN122587046A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of protein engineering technology, and more particularly to scaffold proteins derived from Ly6 / uPAR protein and / or clostridium neurotoxin and their applications. Background Technology
[0002] Currently, many novel proteins with targeted binding properties and diverse functions have been developed based on scaffold proteins. These proteins can interact with targets such as cytokines, receptors, enzymes, hormones, growth factors, signal transduction proteins, regulatory proteins, and immunoglobulins, providing new strategies for solving problems in life sciences, environmental sciences, and medicine, and showing broad application prospects.
[0003] However, due to the cell membrane barrier, proteins obtained using scaffold proteins primarily act on cell surface targets and often cannot freely enter the cell. They require carriers such as cell-penetrating peptides, liposomes, polymers, and viruses to deliver the proteins into the cell to exert their effects. While each strategy has its advantages, insufficient target specificity, a lack of intrinsic mechanisms for cell recognition, and separation from the carrier within the cell reduce the efficiency of intracellular protein delivery and often lead to off-target effects and side effects, limiting the application of these methods in vivo. Therefore, developing novel proteins that can efficiently penetrate cell membranes and specifically act on intracellular targets is a major challenge in obtaining therapeutic drugs targeting intracellular targets.
[0004] Clostridium neurotoxins are a family of homologous proteins produced by anaerobic bacteria of the genus Clostridium. This family includes botulinum neurotoxins (BoNT) of types A, B, C, D, DC, E, F, G, and X, and tetanus neurotoxin (TeNT). These toxins consist of a double-stranded structure composed of an N-terminal light chain (L chain) and a C-terminal heavy chain (H chain). The L chain is a zinc-dependent protease with endopeptidase activity. The H chain is further divided into a translocation domain (H... N ) and receptor binding domain (H C H C The structural domain also includes H at the N end. CN Subdomains and C-terminal H CC Subdomain. In H CC The subdomain contains ganglioside and neuronal protein receptor binding regions, mediating the binding of the toxin to specific receptors (e.g., human Syt II or human Syt I) on the nerve cell membrane, allowing it to enter the nerve cell. Subsequently, the toxin's H... NThe structural domain forms a channel, transporting its L-chain into the cytoplasm to act as a protease. By utilizing the specific targeting ability of clostridium neurotoxin, highly efficient intracellular targeted delivery systems for peptides, proteins, nucleic acids, and other molecules can be developed. However, because the toxin binds only to specific receptors on nerve cell membranes, it can only target nerve cells and cannot achieve targeted delivery to various cell types.
[0005] Lymphocyte antigen-6 (Ly6) / urokinase-type plasminogen activator receptor (uPAR) protein superfamily members typically contain a LU domain with a "three-finger ring" β-sheet structure consisting of 80-100 amino acids. Within the Ly6 / uPAR protein family, secretory Ly6 / urokinase-type plasminogen activator receptor-associated protein 1 (SLURP1), secretory Ly6 / urokinase-type plasminogen activator receptor-associated protein 2 (SLURP2), prostate and testis expressed gene 1 (PATE1), and Ly6 family member G5B (LY6G5B) are secreted proteins. Ly6 / neurotoxin-1 (LYNX1), plasminogen activator-urokinase receptor (PLAUR), prostate stem cell antigen (PSCA), complement regulator CD59, GPI-anchored high-density lipoprotein-binding protein 1 (GPIHBP1), and glycosylphosphatidylinositol anchoring molecule (GML, LY6DL) are cell membrane GPI-anchored proteins. Based on their diverse expression patterns, Ly6 / uPAR proteins possess a wide range of functions, including cell proliferation, migration, cell-cell interactions, immune cell maturation, macrophage activation, and cytokine production. They typically exert their effects by targeting nicotinic acetylcholine receptors. While GPI-anchored proteins cannot directly participate in intracellular signal transduction, they can initiate signal transduction through interactions with other transmembrane proteins. The variable amino acid sequence and length within the "three-finger loop" of the Ly6 / uPAR protein's LU domain provide flexibility for intermolecular interactions, enabling functional diversification. Therefore, using the Ly6 / uPAR protein's LU domain as a scaffold protein, and introducing amino acid mutations, can be considered to prepare highly diverse libraries, thereby obtaining high-affinity ligands targeting ion channels, receptors, enzymes, and other molecules. Summary of the Invention
[0006] The purpose of this invention is to provide a scaffold protein derived from Ly6 / uPAR protein and / or clostridium neurotoxin and its applications. Through recombinant, non-naturally occurring scaffold proteins, a tool is provided for engineered screening of binding compounds with high affinity and high specificity to target molecules. The amino acids in the scaffold protein molecules can be randomized or directed to generate the diversity required to bind to multiple target molecules, enabling efficient targeted delivery of peptides, proteins, nucleic acids and / or other molecules into cells.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The present invention provides a scaffold protein derived from Ly6 / uPAR protein and / or clostridium neurotoxin, including at least one of Ly6 / uPAR protein variants and clostridium neurotoxin variants; The Ly6 / uPAR protein variants include variants in which two or more amino acid changes are made on any one or more rings of ring 1, ring 2 and ring 3 of the molecular structure of wild-type Ly6 / uPAR protein; The clostridium neurotoxin variants include H CC Subdomain variants; the H CC The subdomain is derived from the H chain receptor-binding domain of clostridium neurotoxin, wherein the H... CC Subdomain variants are found in the wild-type Clostridium neurotoxin H chain receptor binding domain H. C H CC Variants in which eight or more amino acids are changed in the subdomain.
[0008] In a specific embodiment, the scaffold protein further includes a heterologous peptide inserted into the Ly6 / uPAR protein variant or the clostridium neurotoxin variant; the heterologous peptide is derived from at least one of an EGF-like domain and a glycosyl recognition domain of a lectin.
[0009] Preferably, the heteropeptide sequence is inserted into the loop region of the scaffold protein. The loop region can be defined as a region that, under normal conditions, does not involve the ordered secondary or tertiary structure of the protein (i.e., the protein is correctly folded and not under denaturing conditions), but may contribute to the function and / or proper spatial organization of secondary structural elements within the protein. The location of the loop region in the scaffold protein varies among different protein variants.
[0010] In a specific implementation, the Ly6 / uPAR protein variant is an LU domain variant, which is a variant formed by replacing and / or recombining the amino acid sequences of loops 1, 2, and 3 of the three-finger loop of the LU domain of the wild-type Ly6 / uPAR protein with the amino acid sequences of the EGF-like domains A, B, and C of an epidermal growth factor (EGF) family member, or a protein having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or at least 95% amino acid sequence identity with the variant; the Ly6 / uPAR protein includes secretory Ly6 / urokinase plasminogen activator receptor-associated protein-1 (SLURP-1), secretory Ly6 / urokinase plasminogen activator receptor-associated protein-2 (SLURP-2), prostate and testis gene 1 encoded protein (PATE1), Ly6 family member G5B (LY6G5B), L The inclusion factor is at least one of y6 / neurotoxin-1 (LYNX1), urokinase-type plasminogen activator receptor (PLAUR), prostate stem cell antigen (PSCA), complement regulatory protein CD59, glycosylphosphatidylinositol-anchored high-density lipoprotein-binding protein 1 (GPIHBP1), and glycosylphosphatidylinositol-anchored molecule (LY6DL); the epidermal growth factor (EGF) family members include at least one of EGF, transforming growth factor α (TGFα), Epigen protein, neuroregulatory protein-1 (Neuregulin-1), heparin-bound epidermal growth factor (HB-EGF), amphiregulin, epiiregulin, β-cellular, neuroregulatory protein-2 (Neuregulin-2), and neuroregulatory protein-3 (Neuregulin-3).
[0011] Preferably, the Ly6 / uPAR protein variant is a variant formed by replacing and / or recombinating two or more amino acids from each of the loops 1, 2, and 3 of the three-finger loop of the wild-type Ly6 / uPAR protein with two or more amino acids from the loops A, B, and C of the EGF-like domain, based on the LU domain of the wild-type Ly6 / uPAR protein. By replacing part or all of the amino acid sequences in the three-finger loop of the LU domain of the Ly6 / uPAR protein with the loop region sequences of the EGF-like domain, the framework stability and diversity of the scaffold protein are further improved, thereby providing a richer, more diverse, and higher-quality protein library.
[0012] Furthermore, the amino acid sequence of the Ly6 / uPAR protein variant is shown in any one of SEQ ID NO: 1-10.
[0013] In a specific implementation scheme, in order to enable clostridium neurotoxin to achieve highly efficient targeted delivery of various intracellular proteins, the H... CC Subdomain variants are those that bind the H chain receptor domain of wild-type clostridium neurotoxin. CC The variant is a protein having a partial amino acid sequence of the subdomain replaced and / or recombined with an amino acid sequence of the glycosyl recognition domain of the lectin that binds to the glycostructure, or having at least 50%, 60%, 70%, 75%, 80%, 90%, or 95% amino acid sequence identity with the variant; the clostridium neurotoxin includes wild-type clostridium neurotoxins such as botulinum toxin type A (BoNT / A), botulinum toxin type B (BoNT / B), botulinum toxin type C (BoNT / C), botulinum toxin type D (BoNT / D), botulinum toxin type DC (BoNT / DC), and botulinum toxin type E (BoNT / E). The lectin comprises at least one of the following: botulinum toxin type F (BoNT / F), botulinum toxin type G (BoNT / G), botulinum toxin type X (BoNT / X), and tetanus neurotoxin (TeNT); the lectin comprises at least one of the following: mannose-binding lectin (MBL), E-selectin, sialic acid-binding immunoglobulin-like lectin (Siglec)-3, Siglec-5, dendritic cell-specific ICAM-3 capture non-integrin (DC-SIGN), Siglec-7, Siglec-9, ficolin-3, ficolin-1, and ficolin-2.
[0014] Preferably, the H CC Subdomain variant is wild-type Clostridium neurotoxin H chain receptor binding domain H C H CC A variant in which a portion of the amino acid sequence of the subdomain is replaced by an amino acid sequence that binds to the sugar structure in the lectin glycosyl recognition domain, wherein the H CC The partial amino acid sequence of the subdomain includes H CC The variant contains partial or complete amino acid sequences of the ganglioside receptor-binding region and the neuronal protein receptor-binding region of the subdomain. This variant can significantly broaden the target range, expanding the target range from targeting neurons to targeting all cell types, thereby increasing the target range of the scaffold protein.
[0015] Furthermore, the H CC The amino acid sequences of the subdomain variants are shown in any one of SEQ ID NO: 11-20.
[0016] In a specific implementation, the scaffold protein is a recombinant protein of the Ly6 / uPAR protein variant and the clostridium neurotoxin variant; the recombinant protein comprises, from the N-terminus to the C-terminus, the Ly6 / uPAR protein variant, the clostridium neurotoxin L-chain variant, and the clostridium neurotoxin H-chain translocation domain H. N The recombinant protein of a Clostridium neurotoxin H-chain receptor-binding domain variant or a protein having at least 50%, 60%, 70%, 75%, 80%, 90%, or 95% amino acid sequence identity with the recombinant protein; the Clostridium neurotoxin H-chain receptor-binding domain variant includes H... CN Sub-domains and the H CC Subdomain variants; the L chain is a light chain at the N-terminus of clostridium neurotoxin, and the L chain variants are variants in which at least 3, 5, 8, 10, or 15 amino acids are changed on the L chain of wild-type clostridium neurotoxin.
[0017] Preferably, the clostridial neurotoxin L-chain variant comprises an amino acid sequence obtained by mutating the HEXXH motif at the active site of the wild-type clostridial neurotoxin L-chain enzyme to AQXXA, where X represents any amino acid. Mutating the HEXXH motif eliminates the neurotoxicity of the clostridial neurotoxin and avoids the toxicity of the scaffold protein.
[0018] Furthermore, in the recombinant protein of the Ly6 / uPAR protein variant and the clostridium neurotoxin variant, the clostridium neurotoxin L-chain variant also includes a phorylase cleavage site located at its C-terminus, the sequence of which is GNRVRRSV. The addition of the phorylase cleavage site effectively prevents structural rearrangement within the recombinant protein, enabling effective activation of the protein within the cell.
[0019] Preferably, the amino acid sequences of the recombinant proteins of the Ly6 / uPAR protein variant and the Clostridium neurotoxin variant are shown in any one of SEQ ID NO: 21-30.
[0020] The scaffold protein of the present invention is a recombinant, non-naturally occurring scaffold protein, comprising a recombinant protein having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, or at least 95% amino acid sequence identity with the Ly6 / uPAR protein variant or the clostridium neurotoxin variant or the Ly6 / uPAR protein variant or the clostridium neurotoxin variant, and wherein at least one loop region is a non-naturally occurring variant of the homologous loop region of SEQ ID NO: 1 to SEQ ID NO: 30.
[0021] The scaffold proteins of the present invention are particularly used as scaffold proteins for confining and displaying peptide and / or protein sequences.
[0022] This invention also provides a display library, which is generated by directed and / or random mutations of 5 to 60 amino acid residues of any of the aforementioned scaffold proteins. The library of this invention can be used to capture and identify targets.
[0023] In a specific implementation, the library is a DNA library containing DNA molecules encoding multiple scaffold protein variants generated by directed and / or random mutations of 5 to 60 amino acid residues of any of the aforementioned scaffold proteins.
[0024] The present invention also provides a nucleic acid molecule encoding the aforementioned scaffold protein. Specifically, the nucleic acid molecule encodes a scaffold protein with an amino acid sequence as shown in any one of SEQ ID NO: 1-30. The nucleotide sequence of the nucleic acid molecule is shown in any one of SEQ ID NO: 30-60.
[0025] The present invention also provides a recombinant vector comprising the above-mentioned nucleic acid molecules, which are suitable for expression in host cells.
[0026] The present invention also provides the application of the above-mentioned scaffold protein or display library in screening affinity-binding proteins for targets; the affinity-binding proteins include at least one of protein-targeted drugs and detection reagents for targets.
[0027] In specific implementations, the present invention also provides methods for preparing, using, screening, optimizing, and engineering the above-mentioned scaffold proteins and display libraries.
[0028] In a specific implementation, the present invention also provides a method for screening protein-targeted drugs using the aforementioned scaffold protein or display library.
[0029] Preferably, the method for screening the affinity-binding protein includes the following steps: obtaining a display library by mutating the amino acid sequence of the Ly6 / uPAR protein variant or clostridium neurotoxin variant by mutating 5-60 amino acid residues; the display library includes the expression gene obtained after mutating the Ly6 / uPAR protein variant or clostridium neurotoxin variant by 5-60 amino acid residues; screening DNA expressing the affinity-binding protein targeting the target within the display library using in vitro display technology; and expressing and purifying the DNA to obtain the affinity-binding protein. Alternatively, the screening method for the affinity-binding protein includes the following steps: obtaining two display libraries by randomly mutagenesis of 5-30 amino acid residues each in the N-terminal and C-terminal amino acid sequences of the recombinant protein of the Ly6 / uPAR protein variant and the clostridium neurotoxin variant; each display library includes an expression gene obtained after random mutation of 5-30 amino acid residues at the N-terminus and C-terminus; screening DNA expressing the affinity-binding protein targeting the target in the display libraries generated at the N-terminus and C-terminus using in vitro display technology; and using the DNA of the two selected affinity-binding proteins as the N-terminal and C-terminal domains of the recombinant protein of the Ly6 / uPAR protein variant and the clostridium neurotoxin variant, respectively, for the clostridium neurotoxin L-chain variant and the clostridium neurotoxin H-chain translocation domain. N Clostridium neurotoxin H chain receptor binding domain H CN The DNA encoding the subdomain is ligated and a recombinant vector is constructed. The ligated DNA is then expressed and purified to obtain the affinity-binding protein. The recombinant protein has an N-terminus of a Ly6 / uPAR protein variant and a C-terminus of H... CC Subdomain variants. This method can screen for proteins targeting different targets, obtaining recombinant affinity-binding proteins that act on different targets simultaneously, thereby increasing their mode of action or effect.
[0030] Furthermore, the affinity-binding protein targets a receptor located within the cell nucleus. During the construction of the recombinant vector prior to expression, a nuclear localization signal sequence is inserted at the N-terminus or C-terminus of the affinity-binding protein to guide it into the cell nucleus and target the receptor therein, further expanding the target range of the scaffold protein. The nuclear localization signal sequence is PAKRARRGYK.
[0031] The present invention also provides a protein-targeted drug, which is obtained by screening for a target based on the scaffold protein or display library using display technology.
[0032] Preferably, the display technology is in vitro CIS display (cis-active display).
[0033] In a specific embodiment, the present invention also provides a pharmaceutical composition comprising the above-mentioned protein-targeting drug.
[0034] In a specific embodiment, the present invention also provides a method for treating, preventing, improving, detecting, diagnosing, or monitoring a disease or its symptoms in a patient by administering a therapeutically effective amount of the above-mentioned protein-targeting drug or a pharmaceutical composition containing the above-mentioned protein-targeting drug.
[0035] In specific embodiments, the pharmaceutical preparations of the present invention are preferably in the form of infusion, tablets, powders, granules, suppositories, injections, syrups, inhalation, and intranasal delivery systems.
[0036] The present invention also provides an affinity-binding protein AP-121 that targets the SARS-CoV-2 S protein, the amino acid sequence of which is shown in SEQ ID NO: 61.
[0037] The present invention also provides an affinity-binding protein AP-1312 targeting CD36, the amino acid sequence of which is shown in SEQ ID NO: 62.
[0038] The present invention also provides an affinity-binding protein AP-2105 targeting ASGPR and ALKBH5, the amino acid sequence of which is shown in SEQ ID NO: 63.
[0039] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides scaffold proteins derived from Ly6 / uPAR protein and / or clostridium neurotoxin and their applications. Through recombinant, non-naturally occurring scaffold proteins, tools are provided for engineered screening of binding compounds with high affinity and high specificity to target molecules. The amino acids in the scaffold protein molecules can be randomized or directionally evolved to generate the diversity required to bind multiple target molecules, enabling efficient targeted delivery of peptides, proteins, nucleic acids and / or other molecules into cells.
[0040] The recombinant protein of this invention possesses both a Ly6 / uPAR protein variant and a clostridium neurotoxin variant, exhibiting good framework stability. It can construct high-quality and highly complex libraries, improve target binding affinity, and efficiently penetrate cell membranes and nuclei, providing efficient targeted delivery of peptides, proteins, nucleic acids, and / or other molecules into the cell. Attached Figure Description
[0041] Figure 1 This is an amino acid sequence alignment diagram of the Ly6 / uPAR protein and the EGF-like domain recombinant variant; the underlined portion represents the part of the Ly6 / uPAR protein that has been replaced by the EGF-like domain. Figure 2 Clostridium neurotoxin receptor binding domain H CC Amino acid sequence alignment of the subdomain with the lectin glycosyl recognition domain recombinant variant; the underlined portion represents H. CC The portion of the subdomain replaced by the amino acid sequence that binds to the sugar structure in the lectin glycosyl recognition domain; Figure 3 This is composed of Ly6 / uPAR protein variants, Clostridium neurotoxin L-chain variants, and Clostridium neurotoxin H-chain translocation domain H. N Clostridium neurotoxin H chain receptor binding domain H CN Sub-domains, and H CC Structural diagram of a recombinant protein composed of variants of subdomains; Figure 4 The graph shows the SDS-PAGE results of the affinity-binding protein purified in Example 3 of this invention. Lanes are labeled at the top of the graph: Lane M: Protein standard (Bio-Rad); Lane 1: AP-121; Lane 2: AP-215; Lane 3: AP-302; Lane 4: AP-417; Lane 5: AP-536; Lane 6: AP-658; Lane 7: AP-716; Lane 8: AP-824; Lane 9: AP-972; and Lane 10: AP-1022. Figure 5 This is a diagram showing the interaction results between the affinity-binding protein and the target protein in Example 4; Figure 6 This is a graph showing the results of the neutralizing activity test of AP-121 against SARS-CoV-2 pseudovirus in Example 5; Figure 7 The graph shows the SDS-PAGE results of the affinity-binding protein purified in Example 8 of this invention. Lanes are labeled at the top of the graph: Lane M: Protein standard (Bio-Rad); Lane 1: AP-1106; Lane 2: AP-1225; Lane 3: AP-1312; Lane 4: AP-1407; Lane 5: AP-1512; Lane 6: AP-1619; Lane 7: AP-1723; Lane 8: AP-1855; Lane 9: AP-1926; and Lane 10: AP-2011. Figure 8 This is a graph showing the results of AP-1312 inhibiting lipid uptake in human cancer cells MCF-7, as observed by fluorescence microscopy in Example 10. Figure 9 This is a graph showing the results of AP-1312 inhibiting lipid uptake in human cancer cells MDA-MB-468 as observed by fluorescence microscopy in Example 10; Figure 10 This is a full-field cell analyzer detection result of AP-1312 inhibiting lipid absorption in human cancer cells MCF-7 and MDA-MB-468 in Example 10; Figure 11 This is a graph showing the detection results of AP-1312-induced tumor cell apoptosis in Example 11; Figure 12 This is a graph showing the detection results of AP-1312 inhibiting tumor cell proliferation in Example 11; Figure 13The figure shows the SDS-PAGE results of the affinity-binding protein purified in Example 14 of this invention. Lanes are labeled at the top of the figure: Lane M: Protein standard (Bio-Rad); Lane 1: AP-2105; Lane 2: AP-2211; Lane 3: AP-2308; Lane 4: AP-2436; Lane 5: AP-2517; Lane 6: AP-2612; Lane 7: AP-2721; Lane 8: AP-2814; Lane 9: AP-2965; and Lane 10: AP-3033. Figure 14 The image shows the detection results of AP-2105 inhibiting the synthesis of triglycerides and cholesterol in hepatocytes in Example 16. Detailed Implementation
[0042] The scaffold protein of this invention is a variant formed by recombination of the Ly6 / uPAR protein with the EGF-like domain of an EGF family member, such as... Figure 1 As shown, the scaffold protein of the present invention is thermally stable, soluble, and easy to produce, and these properties facilitate the generation of different sets of variants of the scaffold protein of the present invention capable of binding to specific targets.
[0043] In another scaffold protein of the present invention, the H protein is derived from the clostridium neurotoxin receptor binding domain. CC The structure of the recombinant variants of the subdomain and the lectin glycosyl recognition domain, such as Figure 2 As shown, a highly randomized library can be effectively used to engineer the scaffold of the present invention for the isolation of affinity-binding proteins. The randomization design and random screening methods employed in the present invention provide a simple and efficient means of obtaining specific binders for targets of interest. Therefore, the scaffold of the present invention is expected to be particularly useful for the development of various therapeutic agents, diagnostic agents, and detection agents, for example, but not limited to, targeting a variety of targets.
[0044] Another scaffold protein in this invention is a recombinant protein derived from Ly6 / uPAR protein and clostridium neurotoxin, such as... Figure 3 As shown, it includes the Ly6 / uPAR protein variant, the Clostridium neurotoxin L-chain variant, and the Clostridium neurotoxin H-chain translocation domain H. N Clostridium neurotoxin H chain receptor binding domain H CN Sub-domain, H CC Recombinant proteins with variants of subdomains.
[0045] Unless otherwise specified in the embodiments of this invention, all reagents and consumables used are commercially available products.
[0046] It will be apparent to those skilled in the art that the scaffold protein of the present invention is composed of amino acid residues, and that variants of the scaffold protein of the present invention can be readily generated by inserting, substituting, or deleting them using conventional experiments. Those skilled in the art can obtain variants of the scaffold protein of the present invention lacking one or more individual secondary structural elements with minimal effort and reasonable expectation of success.
[0047] The present invention also relates to nucleic acids of single and collective library members encoding randomized variants of the scaffold protein of the present invention. Various methods exist for introducing variations into nucleic acids encoding polypeptide sequences, including but not limited to incorporating DNA fragments containing a mixture of degenerate codons or coupled trinucleotides, employing error-prone PCR, DNA fragment shuffling, and various other methods and combinations thereof, and these methods are well known and readily used by those skilled in the art.
[0048] In another specific embodiment, the oligonucleotide encoding the variant loop region polypeptide can be randomized using various degenerate codons, such as, but not limited to, NNK, NNS, NHK, VNK, NNN, or combinations thereof. In other embodiments, the oligonucleotide encoding the variant loop region polypeptide can be randomized by: error-prone polymerases such as in error-prone PCR, by mutagenic strains of cultured cells or microorganisms, or by various other random or targeted mutagenesis methods known to those skilled in the art.
[0049] In some embodiments, the scaffold protein of the present invention can bind to a target by transplanting loop regions obtained from other binding molecules, such as, but not limited to, EGF-like domains and / or lectin glycosyl recognition domains, or loop regions obtained from other peptides with known binding activity. In other embodiments, peptides with known activity, such as nuclear localization signals, antimicrobial peptides, cell membrane penetration peptides, platelet aggregation inhibitory peptides, transfer inhibitory peptides, immunomodulatory peptides, and other peptides with known activity, can be transplanted into the scaffold protein of the present invention.
[0050] Further embodiments of the present invention relate to a method for obtaining the randomized library of the present invention for specific binding to target molecules.
[0051] One embodiment of the present invention includes a method for obtaining a protein-based targeted drug that binds to a target, the method comprising: (a) contacting a target ligand with a display library under conditions that allow for the formation of a scaffold-target ligand complex; and (b) obtaining the protein-based targeted drug that binds to the target ligand from the complex.
[0052] The fundamental principle of all selection techniques is the physical association between phenotype (i.e., the displayed protein) and genotype (i.e., the nucleic acid encoding the displayed protein). Different selection techniques use different strategies to achieve this association, and this is well known to those skilled in the art. Therefore, in some implementations, examples of such techniques include, but are not limited to, phage display, virus display, bacterial display, yeast display, mammalian cell display, mRNA display, ribosome display, cDNA display, or CIS display.
[0053] In a specific embodiment of the present invention, in vitro CIS display is selected as the selected technology.
[0054] Embodiments of the present invention relate to nucleic acid molecules encoding the scaffold protein or protein-targeting drug of the present invention, or nucleic acid molecules within a display library, a vector containing said nucleic acid molecule, and a host cell containing said nucleic acid molecule and / or said vector. The nucleic acid molecule may be DNA, RNA, or any other similar substance thereof. Many vectors and host cells known to those skilled in the art are available for various purposes. Such purposes may include, but are not limited to, protein production, gene therapy, or the production of viral particles displaying or encoding proteins of interest. Those skilled in the art will be able to select from many well-known options of nucleic acid molecules, vectors, and host cells and confirm their suitability using conventional methods.
[0055] In another embodiment of the invention, a nucleic acid molecule containing the coding region of the scaffold protein of the invention can be used to produce the protein in vivo by administration of the nucleic acid molecule for purposes such as treating a disease. In one embodiment, the nucleoside-modified RNA encoding the protein can be administered intravenously in a polymer-based or lipid-based formulation to enable the translation of the nucleic acid and the production of the protein in a patient's body.
[0056] In other embodiments, the present invention relates to the expression and purification of the encoded protein of the scaffold protein and the display library of the present invention, and protein-targeted drugs.
[0057] In one implementation, this includes: (a) isolating a nucleic acid molecule encoding a scaffold protein that binds to a target ligand, (b) operatively linking the nucleic acid molecule to an expression vector, and (c) expressing the nucleic acid molecule operatively linked to the expression vector in a cell.
[0058] In another embodiment, the obtained scaffold protein of the present invention can be used in an unmodified state, or further modified by constructing various fusion proteins such as bispecific or multispecific binding molecules, or by fusing with various other components. The fusions and those described in the following embodiments can be formed by, for example, but not limited to, dimerizing domains, covalent isopeptide bonds, chemical crosslinks, disulfide bonds, amino acid linkers, or other means well known to those skilled in the art. In one specific embodiment, the amino acid linker comprises a soluble and flexible polypeptide linker containing small and / or hydrophilic amino acid residues such as glycine, serine, alanine, and threonine, although those skilled in the art can use many other amino acid combinations to produce linkers with desired properties.
[0059] Therefore, in another embodiment, the present invention relates to a fusion protein comprising at least two of the scaffold proteins of the present invention to generate a bispecific or divalent fusion molecule. In another embodiment, the scaffold of the present invention can also be fused to generate a multispecific and / or multivalent fusion molecule.
[0060] In another embodiment, the invention also relates to fusion proteins comprising one or more scaffolds of the invention fused with additional binding domains, such as scFv or other domains having binding activity, to generate multispecific and / or multivalent target affinity binding proteins.
[0061] In another embodiment, the present invention relates to the fusion of the scaffold protein of the invention with one or more proteins, which covalently or non-covalently associate to form a multi-protein complex, thereby producing a protein complex having multivalent and / or multispecific binding activities. The fusion complex can be formed by, for example but not limited to, dimerizing domains, chemical crosslinking, disulfide bonds, isopeptide bonds, amino acid linkers, or other means well known to those skilled in the art.
[0062] In another embodiment, the present invention relates to a fusion protein comprising one or more scaffold proteins of the present invention fused to a functional Fc domain, wherein in some specific embodiments, the functional Fc domain is a human Fc domain. This may include N-terminal or C-terminal Fc fusion, fusion with an internal region of the Fc domain, or a combination thereof. Furthermore, the resulting fusion protein may comprise different binding scaffold proteins of the present invention that are specific to different ligand targets, thereby producing a bispecific or multispecific ligand-binding fusion protein. In another embodiment, one or more scaffold proteins of the present invention may also be fused to existing antibodies to produce enhanced functionality, such as, for example, multispecific binding. In yet another embodiment, the Fc domain may be used to target or redirect an organism's immune response to a specific binding site of the affinity-binding protein of the present invention.
[0063] In further embodiments, monovalent, bispecific, or multispecific constructs of one or more of the scaffold proteins of the present invention can be used for immunotherapeutic applications, such as the development of CAR-T cell-like therapies. Other examples include (but are not limited to) the local or systemic recruitment of T cells around cancer cells or the suppression of immune checkpoints. Those skilled in the art will understand that many biological targets and immune system mechanisms can be effectively utilized to achieve this purpose.
[0064] In another embodiment, the present invention relates to fusion proteins comprising one or more scaffold proteins of the present invention fused with a pharmaceutically and / or diagnostically active component. The fusion protein of the scaffold protein of the present invention may comprise non-peptide components such as non-peptide linkers, non-peptide ligands, or therapeutically or diagnostically relevant radionuclides. In specific embodiments, such pharmaceutically and / or diagnostically active components may be selected from the group consisting of molecules including cytokines, toxic compounds, chemokines, ligands, receptors, fluorescent dyes, photosensitizers, procoagulant factors, anticoagulant factors, enzymes for prodrug activation, and radionuclides. Many other pharmaceutically and / or diagnostically active components are known to those skilled in the art, and the invention is not limited to the representative examples listed herein.
[0065] In another embodiment, the present invention relates to a fusion protein comprising one or more scaffold proteins of the present invention fused to a component that regulates serum half-life, said component being, but not limited to, polyethylene glycol (PEG), immunoglobulins, albumin-binding peptides, and proline-alanine-serine (PAS) polymers. Those skilled in the art may select additional macromolecules or binding domains suitable as fusion partners and also applicable to the purpose of prolonging serum half-life.
[0066] In some embodiments, the scaffold protein of the present invention comprises polypeptide sequence variants with improved developability. Such variants may include, for example, variants lacking cysteine residues, variants lacking predicted N-glycosylation sites, and variants with reduced predicted degradation risks, such as predicted deamidation, isomerization, oxidation, fragmentation, and aggregation.
[0067] In other embodiments, the demonstrative libraries of the present invention are expected to generate highly stable and soluble target-binding candidates with high specificity and affinity, making them particularly suitable for therapeutic and / or diagnostic applications. Therefore, highly relevant embodiments of the present invention relate to the use of the scaffold protein of the present invention or its fusion derivatives in the preparation of pharmaceuticals or diagnostic tools.
[0068] In one specific embodiment, one or more of the scaffold proteins of the present invention, or their fusion derivatives, are used to prepare a medicament or diagnostic tool for the treatment or diagnosis of a disease; in another specific embodiment, they are used to diagnose or treat tumors, cardiovascular diseases, infectious diseases, neurological diseases, metabolic diseases, immune diseases, or inflammatory diseases.
[0069] In one specific embodiment, one or more of the scaffold proteins of the present invention, or their fusion derivatives, are used to prepare diagnostic means, said diagnostic means including devices for detecting binding complexes using surface plasmon resonance, devices for diagnosing tumors, cardiovascular diseases, infectious diseases, neurological diseases, metabolic diseases, immune diseases, or inflammatory diseases.
[0070] Another embodiment of the invention relates to a pharmaceutical or diagnostic composition comprising one or more of the scaffold proteins of the present invention, or fusion derivatives thereof, and, where appropriate, pharmaceutically acceptable excipients and / or carriers. Those skilled in the art will be able to select suitable excipients and carriers from the rich prior art and will be able to determine their suitability using conventional methods.
[0071] In another embodiment, for the treatment or diagnosis of a disease in a subject suspected of having a disease, one or more of the scaffold proteins of the present invention, or fusion derivatives thereof, can be administered in a variety of forms or modalities, making the compound available in an effective amount. Many routes of administration are well known to those skilled in the art and include, but are not limited to, oral, subcutaneous, intramuscular, intravenous, intraperitoneal, intradermal, spinal, local, intranasal, and intraocular administration, and the most suitable can be readily selected based on pharmacokinetic data obtained, for example, from in vivo experiments, routine medical practice, and other sources of knowledge widely available to those skilled in the art. In some embodiments, NMR, PET, CT, fluorescence imaging, and various other well-known in vivo imaging techniques can be used to diagnose diseases using one or more of the scaffolds of the present invention or derivatives thereof.
[0072] Another embodiment of the invention relates to co-administration or treatment with other therapeutic agents, such as cytokines, steroids, chemotherapy agents, antibiotics, radiation, or other therapeutic agents and treatments well known in the art. This is a well-known method of enhancing the efficacy of drug therapy. Appropriate dosages, combinations, and timing of additional therapies can be selected based on various relevant factors known to those skilled in the art.
[0073] The present invention also provides a method for detecting compounds using the scaffold protein of the present invention. Based on the binding specificity of the affinity-binding protein obtained through screening a display library, such a scaffold protein can be used in an assay to detect a specific target in a sample, for example, for diagnostic methods. In one embodiment, the method for detecting a compound includes contacting the compound in a sample with the affinity-binding protein of the present invention under conditions that allow for the formation of a compound:affinity-binding protein complex, detecting the affinity-binding protein, thereby detecting the compound in the sample. In a further embodiment, the scaffold is labeled (e.g., radiolabeled, fluorescent, enzyme-linked, or colorimetrically labeled) to facilitate the detection of the compound. In a further embodiment, the use of an in vivo implantable device utilizing the scaffold protein of the present invention or a derivative thereof can be used to detect compounds of interest.
[0074] The present invention also provides a method for capturing compounds using the scaffold protein of the present invention. Based on the binding specificity of scaffold protein variants obtained through screening of a display library, such affinity-binding proteins can be used in assays to capture specific targets in a sample, for example, for purification methods. In one embodiment, the method for capturing compounds in a sample includes contacting the compound in the sample with the affinity-binding protein of the present invention under conditions that allow the formation of a compound:affinity-binding protein complex, removing the complex from the sample, thereby capturing the compound in the sample. In a further embodiment, the scaffold is immobilized to facilitate the removal of the compound:affinity-binding protein complex.
[0075] Those skilled in the art will recognize or be able to identify many equivalents of the specific embodiments of the invention described herein using only conventional experiments. The invention described herein is intended to cover such equivalents.
[0076] The following embodiments are provided to supplement the foregoing disclosure and to provide a better understanding of the subject matter described herein. These embodiments should not be construed as limiting the described subject matter. It should be understood that the embodiments and implementations described herein are for illustrative purposes only, and various modifications or changes thereto will be apparent to those skilled in the art and should be included within the true scope of the invention, and can be made without departing from the true scope of the invention.
[0077] Example 1: Construction of a DNA library with random mutations SIN1 (SEQ ID NO: 1), SIN2 (SEQ ID NO: 2), SIN3 (SEQ ID NO: 3), SIN4 (SEQ ID NO: 4), SIN5 (SEQ ID NO: 5), SIN6 (SEQ ID NO: 6), SIN7 (SEQ ID NO: 7), SIN8 (SEQ ID NO: 8), SIN9 (SEQ ID NO: 9), and SIN10 (SEQ ID NO: 10) are scaffold proteins composed of variants derived from human Ly6 / uPAR protein and recombined with EGF-like domains of EGF family members. Specifically, they are LU domain variants formed by replacing portions of the amino acid sequences in loops 1, 2, and 3 of the three-finger loop of the LU domain with portions of the amino acid sequences from the A, B, and C loops of the EGF-like domain of epidermal growth factor (EGF) family members. For example, ... Figure 1 As shown, the scaffold proteins represented by amino acid sequences SEQ ID NO: 1-10 are, in order, variants of SLURP-1 recombined with EGF (SEQ ID NO: 1), SLURP-2 recombined with TGFα (SEQ ID NO: 2), PATE1 recombined with Epigen protein (SEQ ID NO: 3), LY6G5B recombined with Neuregulin-1 (SEQ ID NO: 4), LYNX1 recombined with HB-EGF (SEQ ID NO: 5), PLAUR recombined with Amphiregulin (SEQ ID NO: 6), PSCA recombined with Epiregulin (SEQ ID NO: 7), complement regulatory protein CD59 recombined with β-cellular (SEQ ID NO: 8), GPIHBP1 recombined with Neuregulin-2 (SEQ ID NO: 9), and LY6DL recombined with Neuregulin-3. The nucleotide sequences of the encoding genes of the proteins represented by amino acid sequences SEQ ID NO: 1-10 are shown in SEQ ID NO: 31-40.
[0078] In the amino acid sequence of the aforementioned scaffold protein, an expression gene consisting of 16 amino acid residues was selected. This gene was randomly mutated using the NNK codon (where N = A, C, T, or G, and K = T or G) to obtain the coding DNA strand for the scaffold protein variant. A tac promoter sequence (TTGACAATTAATCATGGCTCGTATAATG) was added to the 5' end of the DNA strand, and a RepA coding sequence, a cis element, and an ori element were added to the 3' end. The DNA was then sent to a gene company for synthesis. Using the synthesized DNA as a template, and with TAC_F (TCCCCCTGTTGACAATTAATCAT) and ORI_R (GGAAACAGCTATGACCATGATT) as upstream and downstream primers, the DNA was amplified by PCR.
[0079] The PCR reaction system consisted of 12.5 μL of Pfu PCR mix, 1 μL of template, 1 μL of each primer, and 9.5 μL of ddH2O added to a 25 μL reaction system.
[0080] The PCR reaction conditions were: 95℃ pre-denaturation for 30s; 95℃ denaturation for 10s, 60℃ annealing for 20s, 72℃ extension for 30s, 35 cycles; 72℃ extension for 2min.
[0081] After the PCR reaction, agarose gel electrophoresis was performed according to EZNA. TM Following the instructions of the Gel Extraction Kit (cat.#D2501, Omega Bio-tek, Inc.), DNA products were recovered, and the content was detected using an ultra-micro spectrophotometer to obtain high-capacity synthetic DNA libraries (SDLs) with random mutations. The DNA sequences within the libraries can be used to encode scaffold protein variants. Based on the amino acid expression genes in the SIN1, SIN2, SIN3, SIN4, SIN5, SIN6, SIN7, SIN8, SIN9, and SIN10 sequences, the resulting SLDs were named SDL1, SDL2, SDL3, SDL4, SDL5, SDL6, SDL7, SDL8, SDL9, and SDL10, respectively.
[0082] Example 2: In vitro CIS display of affinity protein (AP) Using the SARS-CoV-2 S protein as a target, DNA products for expressing affinity-binding proteins targeting the SARS-CoV-2 S protein were obtained through SDL1 screening. The specific steps are as follows: Take 3 μg of purified SDL1 and add it to E. coli. E. coliIn the S30 extract system (cat. #L030, Promega), the total reaction volume was 50 μL, and the reaction was carried out at 37 °C for 90 min to produce DNA-protein complexes. The reaction was then terminated by standing on ice for 10 min. Then, Dynabeads M-280 streptavidin magnetic beads (1:1) (Thermo Fisher Scientific) were added, and the mixture was kept at 25°C for 10 min. 5 μL of 7.3 μM biotin-labeled SARS-CoV-2 S protein S1 subunit was added, and the mixture was kept at 25°C for 5 min. The mixture was then placed on a magnetic rack and washed three times with HBST buffer [50 mM Hepes-KOH (pH 7.5), 300 mM NaCl, 0.05% (v / v) Tween 20]. After heating at 95°C for 5 min, the mixture was placed on a magnetic rack, the supernatant was removed, and 12.5 μL of Pfu PCR mix was added. Then, 1 μL each of TAC_F and ORI_R were added as upstream and downstream primers, along with 10.5 μL of ddH2O. After PCR amplification, the product was recovered. The PCR reaction system, reaction conditions, and recovery process were as described in Example 1. The recovered DNA product was then added back to E. coli. E. coli The above steps were repeated in the S30 extract system for cyclic screening for a total of 6 rounds, finally obtaining the DNA product for expressing the affinity-binding protein AP-121 targeting the SARS-CoV-2 S protein.
[0083] Following the above method, based on SDL2, SDL4, SDL5, SDL6, SDL7, SDL8, SDL9, and SDL10, six rounds of in vitro CIS display and affinity screening were conducted to obtain the following affinity-binding proteins for expressing epidermal growth factor receptor-2 (HER2): AP-215, AP-417, AP-536, AP-658, and AP-658. DNA products of CD47 affinity-binding protein AP-716, affinity-binding protein AP-824 targeting milk fat globule epidermal growth factor VIII (MFG-E8), affinity-binding protein AP-972 targeting proprotein convertase subtilisin 9 (PCSK9), and affinity-binding protein AP-1022 targeting angiogenic factor receptor-2 (VEGFR-2) were obtained. Based on SDL3, DNA product for expressing affinity-binding protein AP-302 targeting tumor necrosis factor α (TNF-α) was obtained through 5 rounds of in vitro CIS display and affinity screening.
[0084] Example 3: Expression and purification of affinity-binding protein Using DNA expressing the SARS-CoV-2 S protein affinity-binding protein AP-121 as a template, PCR amplification of AP-121-expressing DNA was performed using pAP121_F (5'-GGATCGCATCACCATCACCATCACGGCCCTCAAGTGCTACAC-3') and pAP121_R (5'-GAGTCCAA GCTCAGCTAATTAAGCTGAGTTCCGAGTTGCAGAG-3') as upstream and downstream primers. The PCR reaction system and conditions were as described in Example 1. After the PCR reaction, agarose gel electrophoresis was performed, and the DNA was recovered and purified using a gel extraction kit (Promega). The concentration was then determined using a micro spectrophotometer.
[0085] Following the instructions of the Seamless Cloning Kit (cat. #D7010S, Beyotime), purified DNA was ligated with pQE-80L plasmid digested with BamHI / HindIII to construct a recombinant vector. 10 μL of the recombinant vector was transformed into DH5α competent cells using a 42℃ heat shock method. The transformed cells were then evenly spread on LB solid agarose medium (ampicillin-resistant) and incubated at 37℃ for 14-16 h. Single colonies were selected and added to 5 mL of LB medium (ampicillin-resistant) in a shaker flask and cultured at 37℃ and 220 rpm for 15 h. The bacterial culture was then sequenced. Bacterial cultures with correctly sequenced DNA were analyzed using EZNA. TM Plasmids were extracted using the Plasmid Mini Kit I (cat. #D6942, Omega Bio-tek, Inc.) according to the manufacturer's instructions. Then, 10 μL of the plasmid was transformed again using a 42°C heat shock method. Rosetta (DE3) competent cells (cat. #D1065M, Beyotime) were evenly spread on LB solid agarose medium (ampicillin resistant) in culture dishes and incubated at 37°C for 14-16 h. Colonies were selected and added to shake flasks containing 5 mL of LB medium (ampicillin resistant). The flasks were then incubated at 37°C and 220 rpm for 15 h. Finally, the colonies were transferred to 4 × 500 mL Erlenmeyer flasks containing fresh LB medium containing ampicillin and incubated at 18°C and 220 rpm until D… 600When the concentration of the virus was 0.4-0.6, isopropyl-β-D-thiogalactoside (IPTG) was added to induce expression, and the cells were cultured at 18°C and 220 rpm for 24 h. After the culture, the cells were collected by centrifugation at 8000 rpm for 10 min, suspended in lysis buffer, sonicated, and centrifuged at 4°C and 12000 rpm for 25 min to collect the supernatant. The product was purified by Ni-NTA affinity chromatography to obtain AP-121, an affinity-binding protein targeting the SARS-CoV-2 S protein. Its amino acid sequence is shown in SEQ ID NO: 61, which is a protein-targeting drug targeting the SARS-CoV-2 S protein.
[0086] Following the method described above, using the DNA product encoding the affinity-binding protein obtained in Example 2 as a template, PCR amplification was performed using the forward and reverse primers listed in Table 1 below. Using the E. coli expression system, affinity-binding proteins AP-215 targeting HER2, AP-302 targeting TNF-α, AP-417 targeting TLR4, AP-536 targeting C5aR, AP-658 targeting IL-6, AP-716 targeting CD47, AP-824 targeting MFG-E8, AP-972 targeting PCSK9, and AP-1022 targeting VEGFR-2 were prepared.
[0087] Table 1: Forward and reverse primers used for expressing and purifying affinity-binding proteins Take 40 μL of each of AP-121, AP-215, AP-302, AP-417, AP-536, AP-658, AP-716, AP-824, AP-972, and AP-1022, respectively, and add 10 μL of 5×SDS-PAGE loading buffer. Mix well, heat at 98℃ for 10 minutes, centrifuge at 12000 rpm for 1 minute, and take 20 μL of the supernatant. Add it to the wells of a 12% SDS-PAGE gel for electrophoresis. Stain with Coomassie blue to visualize the purified proteins. The results are as follows: Figure 4 As shown. By Figure 4 It was observed that the affinity-binding protein solution showed a band at approximately 10 kDa, consistent with the expected size. Then, the protein concentration was determined according to the instructions of the BCA protein concentration assay kit (Cat. NO: BL521A, Biosharp, Beijing Lanjieke Technology Co., Ltd.).
[0088] Example 4: Detection of the binding activity of affinity-binding proteins to targets SARS-CoV-2 S protein, HER2, TNF-α, TLR4, C5aR, IL-6, CD47, MFG-E8, PCSK9 or VEGFR-2 were diluted with PBS to 5 μg / mL and added to 96-well ELISA plates, and incubated overnight at 4°C. ELISA plates were blocked at 37°C for 2 h with 200 μL of 2% TBST (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 2 mM CaCl2, 0.1% Tween-20). After washing with TBST, different concentrations of biotin-labeled affinity-binding proteins AP-121, AP-215, AP-302, AP-417, AP-536, AP-658, AP-716, AP-824, AP-972, or AP-1027 diluted with TBST were added, and the plates were incubated at 37°C for 1 h. A BSA control group was included. Then, HRP-conjugated streptavidin diluted with TBST (1:10000, Biospa) was added, and the plates were incubated at 37°C for 1 h. After washing the plates three times with TBST, 3,3',5,5'-tetramethylbenzidine (TMB, Thermo Fisher Scientific) was added. The reaction was terminated by adding 2M H2SO4 after 15-30 minutes using a scientific colorimetric reagent. The OD value was read at 450 nm. The results are as follows: Figure 5 As shown. By Figure 5 According to AJ, compared with the BSA group, AP-121, AP-215, AP-302, AP-417, AP-536, AP-658, AP-716, AP-824, AP-972, and AP-1027 can bind to SARS-CoV-2 S protein, HER2 protein, TNF-α, TLR4 protein, C5aR protein, IL-6, CD47 protein, MFG-E8, PCSK9, and VEGFR-2 in a concentration-dependent manner, respectively, indicating that each affinity-binding protein can directly recognize and bind to its corresponding target.
[0089] Example 5: Detection of the inhibitory activity of AP-121 against SARS-CoV-2 pseudovirus infection 293T cells in good growth condition were harvested and treated with 2.4 × 10⁻⁶ cells. 5The cells were seeded at a density of 1 cell / well in 24-well plates and cultured overnight. Then, 7.5 μg of pcDNA3.1-SARS-CoV-2-S plasmid (purchased from Wuhan Miaoling Biotechnology Co., Ltd.), 7.5 μg of pLentipuro3-TO-V5-GW-EGFP Firefly Luciferase plasmid (purchased from Shanghai Haijihaoge Biotechnology Co., Ltd.), 7.5 μg of psPAX27 helper plasmid (purchased from Shanghai Haijihaoge Biotechnology Co., Ltd.), and 4.5 μg of polyethyleneimine 40000 solution were mixed and transfected into 293T cells. The cells were cultured at 37℃ for 8-10 h, then the medium was replaced with fresh medium and cultured for another 48-72 h. The supernatant containing pseudovirus was collected from the cell culture, centrifuged, and the supernatant was used as the pseudovirus suspension.
[0090] 293 T / ACE2 cells were harvested and cultured at a concentration of 2.4 × 10⁻⁶. 5 Cells were seeded at a density of 10 cells / well in 24-well cell culture plates and cultured in DMEM medium containing 10% fetal bovine serum for 12 h at 37°C in a 5% CO2 incubator. Cells were divided into AP-121 and BSA groups. In the AP-121 group, AP-121 diluted with PBS was added at 7 concentration gradients. In the BSA group, BSA diluted with PBS was added at 7 concentration gradients, with 3 replicates for each concentration gradient. Cells were incubated at 37°C for 30 min. Then, 315 μL of pseudovirus suspension was added to each well of each group, and the cells were incubated at 37°C for 6 h. After incubation, the supernatant was removed, and the medium was replaced with fresh DMEM medium containing 2% fetal bovine serum. Cells were incubated at 37°C for another 48 h. After incubation, the cell culture supernatant was removed, the cells were washed with PBS, digested with trypsin, and resuspended. The number of cells carrying EGFP was detected by flow cytometry, and the half-maximal inhibitory concentration (IC50) was calculated using computer software. 50 ), the result is as follows Figure 6 As shown, AP-121 can effectively inhibit SARS-CoV-2 pseudovirus infection, IC 50 The concentration was 2.8 ng / mL, while the BSA control showed no inhibitory effect.
[0091] Therefore, it can be seen that the Ly6 / uPAR protein variant scaffold protein based on the present invention can be effectively screened for affinity-binding proteins targeting the target through CIS display technology, which is suitable for screening protein-based targeted drugs with high affinity.
[0092] Example 6: Construction of a DNA library with random mutations SIN11 (SEQ ID NO: 11), SIN12 (SEQ ID NO: 12), SIN13 (SEQ ID NO: 13), SIN14 (SEQ ID NO: 14), SIN15 (SEQ ID NO: 15), SIN16 (SEQ ID NO: 16), SIN17 (SEQ ID NO: 17), SIN18 (SEQ ID NO: 18), SIN19 (SEQ ID NO: 19), and SIN20 (SEQ ID NO: 20) are scaffold proteins derived from the clostridium neurotoxin receptor binding domain H. CC The variants formed by recombination of the sub-structural domain and the lectin glycosyl recognition domain share a common sequence. For example... Figure 2 As shown, this scaffold protein is specifically the H chain receptor-binding domain of clostridium neurotoxin. CC Subdomain variants are based on the H chain receptor binding domain H of wild-type clostridium neurotoxin. CC Based on sub-domains, H CC The H sequence obtained by replacing the complete amino acid sequence of gangliosides and neuronal proteins in the subdomain with the amino acid sequence of the glycosyl recognition domain of the lectin. CC Subdomain variants. Among them, the proteins represented by the amino acid sequences SEQ ID NO: 11-20 are, in order, variants of BoNT / A recombined with MBL (SEQ ID NO: 11), BoNT / B recombined with E-Selectin (SEQ ID NO: 12), BoNT / C recombined with Siglec-3 (SEQ ID NO: 13), BoNT / D recombined with Siglec-5 (SEQ ID NO: 14), BoNT / DC recombined with DC-SIGN (SEQ ID NO: 15), BoNT / E recombined with Siglec-7 (SEQ ID NO: 16), BoNT / F recombined with Siglec-9 (SEQ ID NO: 17), BoNT / G recombined with Ficolin-3 (SEQ ID NO: 18), BoNT / X recombined with Ficolin-1 (SEQ ID NO: 19), and TeNT recombined with Ficolin-2 (SEQ ID NO: 20). The nucleotide sequences of the gene encoding the protein shown in SEQ ID NO: 11-20 are shown in SEQ ID NO: 41-50.
[0093] In the amino acid sequence of the scaffold protein, an expression gene consisting of 16 amino acid residues was selected. After randomized mutation using the NNK codon (where N = A, C, T, or G, and K = T or G), the coding DNA strand for the scaffold protein variant was obtained. The tac promoter sequence TTGACAATTAATCATGGCTCGTATAATG was added to the 5' end of the DNA strand, and the RepA coding sequence, a cis element, and an ori element were added to the 3' end. The DNA was then sent to a gene company for synthesis. Using the synthesized DNA as a template, and with TAC_F and ORI_R as upstream and downstream primers, respectively, the DNA was amplified by PCR. The PCR reaction system and conditions were as described in Example 1. Following this, agarose gel electrophoresis was performed according to EZNA. TM Following the instructions of the Gel Extraction Kit (cat. #D2501, Omega Bio-tek, Inc.), DNA products were recovered, and the content was detected using an ultra-micro spectrophotometer to obtain high-capacity DNA libraries (SDLs) with random mutations. Based on the amino acid expression genes in the SIN11, SIN12, SIN13, SIN14, SIN15, SIN16, SIN17, SIN18, SIN19, and SIN20 sequences, the resulting SLDs were named SDL11, SDL12, SDL13, SDL14, SDL15, SDL16, SDL17, SDL18, SDL19, and SDL20, respectively.
[0094] Example 7: In vitro CIS display of affinity proteins (AP) Based on SDL11 and SDL13, DNA products for expressing AP-1106, an affinity-binding protein targeting SPP1, and AP-1312, an affinity-binding protein targeting CD36, were obtained through five rounds of in vitro CIS display and affinity screening. Based on SDL12, SDL14, SDL15, SDL16, SDL17, SDL18, SDL19, and SDL20, DNA products for expressing AP-1225, an affinity-binding protein targeting the glutamine transporter ASCT2, AP-1407, an affinity-binding protein targeting chemokine receptor 8 (CCR8), AP-1512, an affinity-binding protein targeting interleukin-35 (IL-35), and a protein targeting Nipah virus fusion protein (NiV) were obtained through six rounds of in vitro CIS display and affinity screening. DNA products of the affinity-binding protein AP-1619 (F), the affinity-binding protein AP-1723 (targeting transforming growth factor β (TGF-β)), the affinity-binding protein AP-1855 (targeting tight junction protein 18.2 (Claudin 18.2)), the affinity-binding protein AP-1926 (targeting B cell maturation antigen (BCMA)), and the affinity-binding protein AP-2011 (targeting programmed death-ligand 1 (PD-L1)). For specific operating procedures, refer to Example 2.
[0095] Example 8: Expression and purification of affinity-binding protein Using the DNA product encoding the affinity-binding protein obtained in Example 7 as a template, PCR amplification was performed using the forward and reverse primers listed in Table 2 below. An E. coli expression system was used to prepare the following affinity-binding proteins: AP-1106 targeting SPP1, AP-1225 targeting ASCT2, AP-1312 targeting CD36 (its amino acid sequence is shown in SEQ ID NO: 62), AP-1407 targeting CCR8, AP-1512 targeting IL-35, AP-1619 targeting NiVF, AP-1723 targeting TGF-β, AP-1855 targeting Claudin 18.2, AP-1926 targeting BCMA, and AP-2011 targeting PD-L1. Specific operating procedures are described in Example 3.
[0096] Table 2: Forward and reverse primers used for expressing and purifying affinity-binding proteins The affinity-binding protein was subjected to SDS-PAGE gel electrophoresis according to the method in Example 3, and the purified protein was visualized by staining with Coomassie blue. The protein concentration was then determined, and the results are as follows: Figure 7 As shown. By Figure 7 It can be seen that the affinity-binding protein solution shows a band at around 23kD, which is consistent with the expected size.
[0097] Example 9: Surface plasmon resonance (SPR) detection of the interaction between affinity-binding proteins and targets SPP1, ASCT2, CD36, CCR8, IL-35, NiV F, TGF-β, Claudin 18.2, BCMA, and PD-L1 proteins were diluted with 10 mM sodium acetate (pH 4.5) and flowed through the surface of a CM5 sensor chip at a flow rate of 10 μL / min. The chips were then blocked by flowing through the chip surface with 1 M hydrochloric acid aminoethanol (pH 8.5). Affinity-binding proteins AP-1106, AP-1225, AP-1312, AP-1407, AP-1512, AP-1619, AP-1723, AP-1855, AP-1926, and AP-2011 were then dissolved in buffer to prepare different concentrations. 80 μL of affinity-binding protein samples at different concentrations were continuously passed through the chip surface at a flow rate of 10 μL / min and detected using a Biacore 8K SPR instrument (GE Healthcare). The dissociation equilibrium constant (k) was obtained. D The binding affinity of the affinity-binding protein to the target was evaluated. The results are shown in Table 3.
[0098] Table 3: Binding affinity between affinity-binding proteins and targets Table 3 shows that the dissociation equilibrium constants of both the affinity-binding proteins and their target proteins are below 23 nM, with most below 10 nM, especially AP-1312 and AP-2011, whose dissociation equilibrium constants with their target proteins are both below 1 nM. This indicates that the affinity-binding proteins exhibit high affinity for their target proteins.
[0099] Example 10: AP-1312 and CD36 interact to inhibit lipid uptake by cancer cells Bodipy FL C12 is a transmembrane fluorescent probe that can enter cells to detect lipid uptake. Human breast cancer cells MCF-7 and MDA-MB-468 were seeded into 48-well plates and cultured at 37°C for 24 h, divided into AP-1312 experimental group and BSA control group. Cells were washed three times with PBS. The AP-1312 experimental group was treated with 5 μg / mL AP-1312, while the BSA control group was treated with 5 μg / mL BSA. Cells were incubated at 37°C in serum-free medium for 12 h. To detect fatty acid uptake, cells were washed three times with PBS, then incubated again at 37°C in serum-free medium for 2 h. Then, 0.5 μM Bodipy FLC12 was added, and the cells were incubated at 37°C for 45 min. Cells were washed twice with PBS. Cells were observed and analyzed using a fluorescence microscope and a Celigo full-field cell analyzer. The results of fluorescence microscopy observation of MCF-7 and MDA-MB-468 cells are shown below. Figure 8 and Figure 9 As shown, compared with the BSA group, the fluorescence intensity of Bodipy FL C12 in the AP-1312 group was significantly reduced, indicating that AP-1312 inhibited lipid uptake in MCF-7 and MDA-MB-468 cells. Further analysis of MCF-7 and MDA-MB-468 cells using a full-field cell analyzer yielded the following results: Figure 10 As shown, compared with the BSA group, the uptake of Bodipy FL C12 by cells in the AP-1312 group was significantly reduced, confirming that AP-1312 inhibited lipid uptake by MCF-7 and MDA-MB-468 cells.
[0100] Example 11: AP-1312 inhibits cancer cell growth MCF-7 and MDA-MB-468 cells were placed in 6-well plates and cultured at 37°C for 24 h, divided into AP-1312 experimental group and BSA control group. After 24 h, the cells were washed and the culture medium was replaced. Then, AP-1312 or BSA was added to each group at a dose of 5 μg / mL, and the cells were cultured at 37°C for 48 h. Cells were then stained according to the Annexin V-FITC / PI apoptosis detection kit instructions, and apoptotic cells were analyzed by flow cytometry. Results are as follows: Figure 11 As shown, compared with the BSA group, the AP-1312 group showed a significant increase in apoptosis.
[0101] MCF-7 and MDA-MB-468 cells were separately placed in 96-well plates and cultured at 37°C for 24 h, divided into AP-1312 experimental group and BSA control group. After 24 h, the cells were washed and the culture medium was replaced. Subsequently, AP-1312 or BSA was added to each group at different concentration gradients, and the cells were cultured at 37°C for 48 h. The absorbance was measured at 450 nm using a microplate reader according to the CCK-8 assay kit instructions. The results are as follows. Figure 12 As shown, the proliferation of cells in the AP-1312 group was significantly inhibited compared with the BSA group.
[0102] Example 12: Construction of a DNA library with random mutations SIN21 (SEQ ID NO: 21), SIN22 (SEQ ID NO: 22), SIN23 (SEQ ID NO: 23), SIN24 (SEQ ID NO: 24), SIN15 (SEQ ID NO: 25), SIN26 (SEQ ID NO: 26), SIN27 (SEQ ID NO: 27), SIN28 (SEQ ID NO: 28), SIN29 (SEQ ID NO: 29), and SIN30 (SEQ ID NO: 30) are scaffold proteins. Figure 3 As shown, the N-terminus of the scaffold protein is composed of a variant formed by recombination of an EGF-like domain derived from the Ly6 / uPAR protein and an EGF family member, and the N-terminal amino acid sequences are shown in SEQ ID NO: 1-10; the C-terminus of the scaffold protein is composed of a variant derived from the H-domain of the clostridium neurotoxin receptor. CC The scaffold protein is composed of variants that recombine the sub-domain with the lectin glycosyl recognition domain, and the C-terminal amino acid sequences are shown in SEQ ID NO: 11-20. The scaffold protein is connected to the N-terminus and C-terminus by a translocation domain of the clostridium neurotoxin L-chain variant and the clostridium neurotoxin H-chain (H... N Clostridium neurotoxin H chain receptor binding domain H CN The amino acid sequence composition of the subdomain. Among them, the Clostridium neurotoxin L-chain variant is obtained by mutating the HEXXH motif at the active site of the wild-type Clostridium neurotoxin L-chain enzyme to AQXXA, where X represents the original amino acid within the motif. Clostridium neurotoxin L-chain variant, Clostridium neurotoxin H-chain translocation domain H N A fluoropolymer restriction site GNRVRRSV is added between them. Specifically, the protein with the amino acid sequence SEQ ID NO: 21-30 is as follows: the amino acid sequence shown in SEQ ID NO: 1 and the L chain variant and H chain translocation domain of BoNT / A. N ), BoNT / A H chain receptor binding domain H CNThe recombinant protein consisting of the subdomain and the amino acid sequence shown in SEQ ID NO: 11 (SEQ ID NO: 21); the amino acid sequence shown in SEQ ID NO: 2 and the L-chain variant and H-chain translocation domain of BoNT / B (H N ), BoNT / B's H chain receptor binding domain H CN The recombinant protein containing the subdomain and the amino acid sequence shown in SEQ ID NO: 12 (SEQ ID NO: 22); the amino acid sequence shown in SEQ ID NO: 3 and the L-chain variant and H-chain translocation domain of BoNT / C (H N ), BoNT / C H chain receptor binding domain H CN Subdomains, and variants of the recombinant protein with the amino acid sequence shown in SEQ ID NO: 13 (SEQ ID NO: 23); the amino acid sequence shown in SEQ ID NO: 4 and the L chain variant of BoNT / D, H chain translocation domain (H N ), BoNT / D's H chain receptor binding domain H CN The recombinant protein containing the subdomain and the amino acid sequence shown in SEQ ID NO: 14 (SEQ ID NO: 24); the amino acid sequence shown in SEQ ID NO: 5 and the L-chain variant and H-chain translocation domain of BoNT / DC (H N ), BoNT / DC H chain receptor binding domain H CN The recombinant protein containing the subdomain and the amino acid sequence shown in SEQ ID NO: 15 (SEQ ID NO: 25); the amino acid sequence shown in SEQ ID NO: 6 and the L chain variant and H chain translocation domain of BoNT / E (H N ), BoNT / E H chain receptor binding domain H CN The recombinant protein containing the subdomain and the amino acid sequence shown in SEQ ID NO: 16 (SEQ ID NO: 26); the amino acid sequence shown in SEQ ID NO: 7 and the L chain variant and H chain translocation domain of BoNT / F (H N ), BoNT / F H chain receptor binding domain H CN The recombinant protein containing the subdomain and the amino acid sequence shown in SEQ ID NO: 17 (SEQ ID NO: 27); the amino acid sequence shown in SEQ ID NO: 8 and the L chain variant and H chain translocation domain of BoNT / G (H N ), BoNT / G H chain receptor binding domain H CN The recombinant protein containing the subdomain and the amino acid sequence shown in SEQ ID NO: 18 (SEQ ID NO: 28); the amino acid sequence shown in SEQ ID NO: 9 and the L-chain variant and H-chain translocation domain of BoNT / X (HN ), BoNT / X H chain receptor binding domain H CN The recombinant protein containing the subdomain and the amino acid sequence shown in SEQ ID NO: 19 (SEQ ID NO: 29); the recombinant protein containing the amino acid sequence shown in SEQ ID NO: 10 and the L-chain variant and H-chain translocation domain of TeNT (H N ), the H chain receptor binding domain H of TeNT CN The recombinant protein (SEQ ID NO: 30) contains the subdomain and the amino acid sequence shown in SEQ ID NO: 20. The nucleotide sequences of the gene encoding the protein with the amino acid sequences shown in SEQ ID NO: 21-30 are shown in SEQ ID NO: 51-60, respectively.
[0103] The expression genes from the 16 amino acid residues at the N-terminus were randomly mutated using the NNK codon (where N = A, C, T, or G, and K = T or G) to obtain the coding DNA strands for the scaffold protein variants. A Tac promoter sequence was added to the 5' end of the DNA strand, and a RepA coding sequence, a cis element, and an ori element were added to the 3' end. The DNA strands were then sent to a gene company for synthesis. Using the synthesized DNA as a template, PCR amplification was performed using TAC_F and ORI_R as upstream and downstream primers, respectively. The PCR reaction system and conditions were as described in Example 1. Following this, agarose gel electrophoresis was performed according to EZNA. TM Following the instructions of the Gel Extraction Kit (cat. #D2501, Omega Bio-tek, Inc.), DNA products were recovered, and the content was detected using an ultra-micro spectrophotometer to obtain high-capacity DNA libraries (SDLs) with random mutations. Based on the amino acid expression genes in each N-terminal sequence, randomized mutations were performed to create SLDs named: SDL21-N, SDL22-N, SDL23-N, SDL24-N, SDL25-N, SDL26-N, SDL27-N, SDL28-N, SDL29-N, and SDL30-N.
[0104] Next, expression genes consisting of 16 amino acid residues were selected from the C-terminal sequence and randomly mutated using the NNK codon (where N = A, C, T, or G, and K = T or G). A Tac promoter sequence was added to the 5' end of the DNA strand, and a RepA coding sequence, a cis element, and an ori element were added to the 3' end. The DNA was then sent to a gene company for synthesis. Using the synthesized DNA as a template, and with TAC_F and ORI_R as upstream and downstream primers, respectively, the DNA was amplified by PCR. The PCR reaction system and conditions were as described in Example 1. Following this, agarose gel electrophoresis was performed according to EZNA. TMFollowing the instructions of the Gel Extraction Kit (cat. #D2501, Omega Bio-tek, Inc.), DNA products were recovered, and the content was detected using an ultra-micro spectrophotometer to obtain high-capacity DNA libraries (SDLs) with random mutations. Based on the amino acid expression genes in each C-terminal sequence, randomized mutations were performed to create SLDs named: SDL21-C, SDL22-C, SDL23-C, SDL24-C, SDL25-C, SDL26-C, SDL27-C, SDL28-C, SDL29-C, and SDL30-C.
[0105] Example 13: In vitro CIS display of affinity proteins (AP) Based on SDL21-N, SDL22-N, SDL23-N, SDL25-N, SDL26-N, SDL27-N, SDL28-N, SDL29-N, and SDL30-N, respectively, through six rounds of in vitro CIS display and affinity screening, the following affinity-binding proteins were obtained for expressing ALKBH5: AP-N2105; AP-N2211; AP-N2308; AP-N2517; AP-N2612; AP-N2517; AP-N2612; and AP-N2612. These proteins were used to express the following proteins: AP-N2105 (targeting ALKBH5), AP-N2211 (targeting mammalian target of rapamycin (mTOP)), AP-N2308 (targeting nicotinamide adenine dinucleotide phosphate oxidase 4 (NOX4)), AP-N2517 (targeting androgen receptor (AR)), AP-N2612 (targeting ubiquitin E3 ligase 1 (WWP1) containing the WW domain), and AP-N2612 (targeting hepatitis B virus capsid protein (HBV)). DNA products were obtained for the expression of AP-N2721 (an affinity-binding protein targeting Cp), AP-N2814 (an affinity-binding protein targeting myosin light chain kinase 1 (MLCK1), AP-N2965 (an affinity-binding protein targeting forkhead box protein O-1 (FoxO1), and AP-N3033 (an affinity-binding protein targeting poly(ADP-ribose) polymerase 1 (PARP1)). Based on SDL24-N, DNA products for expressing AP-N2436 (an affinity-binding protein targeting phosphatidylinositol 3-kinase-γ (PI3K-γ)) were obtained through five rounds of in vitro CIS display and affinity screening.
[0106] Based on SDL21-C, SDL22-C, SDL23-C, SDL25-C, SDL26-C, SDL27-C, SDL28-C, SDL29-C, and SDL30-C, respectively, through six rounds of in vitro CIS display and affinity screening, the following DNA products were obtained: one for expressing the affinity-binding protein AP-C2135 targeting ASGPR, used to transfer the affinity-binding protein targeting ALKBH5 into hepatocytes to lower blood lipids; another for expressing the affinity-binding protein AP-C2262 targeting epidermal growth factor receptor (EGFR), used to transfer the affinity-binding protein targeting mTOP into cancer cells to inhibit cancer cell proliferation; and a third for expressing the DNA product targeting kidney injury molecule-1. DNA products of the (KIM-1) affinity-binding protein AP-C2317 are used to transfer NOX4-targeting affinity-binding proteins into renal cells to treat renal dysfunction; DNA products of the prostate-specific antigen (PSA) affinity-binding protein AP-C2521 are used to transfer AR-targeting affinity-binding proteins into prostate cancer cells to exert anti-tumor effects; DNA products of the fatty acid-binding protein-3 (FABP3) affinity-binding protein AP-C2624 are used to transfer WWP1-targeting affinity-binding proteins into cardiomyocytes to alleviate myocardial ischemia-reperfusion injury; and DNA products of the sodium taurocholic acid cotransport polypeptide (NTCP) affinity-binding protein AP-C2712 are used to transfer HBV-targeting affinity-binding proteins into prostate cancer cells to exert anti-tumor effects. Cp affinity-binding proteins are used to transfer into hepatocytes for the treatment of hepatitis B; AP-C2846, an affinity-binding protein targeting glucagon-like peptide-1 receptor (GLP1R), is used to transfer MLCK1 affinity-binding proteins into pancreatic islet cells for the treatment of diabetes; AP-C2912, an affinity-binding protein targeting claudin-6, is used to transfer FoxO1 affinity-binding proteins into intestinal cells for the treatment of Crohn's disease; and AP-C3028, an affinity-binding protein targeting the amino acid transporter SLC4A11, is used to transfer PARP1 affinity-binding proteins into ovarian cancer cells for anti-tumor effects.
[0107] Based on SDL24-C, through five rounds of in vitro CIS display and affinity screening, a DNA product for expressing the CD206-targeting affinity-binding protein AP-C2408 was obtained. This product was then used to transfer the PI3K-γ-targeting affinity-binding protein into M2 macrophages, thereby reversing M2 macrophages into M1 macrophages and exerting an immune effect.
[0108] For specific operating methods, please refer to Example 2.
[0109] Example 14: Expression and purification of dual-target recombinant affinity-binding protein First, to enable the ALKBH5-targeting affinity-binding protein AP-N2105 to enter the cell nucleus, a nuclear localization signal with the amino acid sequence PAKRARRGYK was inserted at the N-terminus of AP-N2105. Specifically, using the DNA of the ALKBH5-targeting affinity-binding protein AP-N2105 as a template, PCR amplification was performed using pAP_F2105_F1: TAAGAGGGCTCGCAGAGGCTACAAGGCCCTCAAGTGCTACACC and pAP_F2105_R: ACCGCCACCGCCGCTACCGCCACCGCCGAGTTCCGAGTTGCAGAGG as upstream and downstream primers. The PCR reaction system and conditions are as described in Example 1. Following agarose gel electrophoresis, DNA was recovered and purified using a gel extraction kit (Promega). Using the purified DNA as a template, PCR amplification was performed using pAP_F2105_F2: GGATCGCATCACCATCACCATCACGCCCGCTAAGAGGGCTCGCAGAG and pAP_F2105_R: ACCGCCACCGCCGCTACCGCCACCGCCGAGTTCCGAGTTGCAGAGG as upstream and downstream primers. The PCR reaction system and conditions were as described in Example 1. Agarose gel electrophoresis was then performed, and the purified DNA, named DNA_F2105, was recovered and purified using a gel extraction kit (Promega). The concentration was determined using a micro-spectrophotometer.
[0110] Next, using DNA encoding amino acids 82-1195 of the SIN21 (SEQ ID NO: 21) sequence (synthesized by a gene company) as a template, PCR amplification was performed using pAP_S2105_F: GGTGGCGGTAGCGGCGGTGGCGGTAGCATGCCATTTGTTAATAAAC and pAP_S2105_R: GTCTTTTAAAATACCTGAATTTGATTGATTATCA as upstream and downstream primers. The L-strand variant encoding BoNT / A and the H-strand translocation domain (H) were obtained. N ), BoNT / A H chain receptor binding domain H CN DNA of the subdomain. The PCR reaction system was the same as in Example 1, and the reaction conditions were: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 10 s, 60℃ annealing for 20 s, 72℃ extension for 2 min, 30 cycles; 72℃ extension for 2 min. Subsequently, agarose gel electrophoresis was performed, and the DNA was recovered and purified using a gel extraction kit (Promega), named DNA_S2105, and its content was detected using a micro spectrophotometer.
[0111] Then, using DNA targeting the ASGPR affinity-binding protein AP-C2135 as a template, PCR amplification was performed using pAP_T2105_F (GATAATCAATCAAATTCAGGTATTTTAAAAGACTTTTG) and pAP_T2105_R (GAGTCCAAGCTCAGCTAATTAAGCTCAGTGGCCTTTCTCCCCATC) as upstream and downstream primers. The PCR reaction system and conditions were as described in Example 1. Agarose gel electrophoresis was performed, and the DNA was recovered and purified using a Promega gel extraction kit, named DNA_T2105, and its concentration was determined using a micro spectrophotometer.
[0112] Referring to the specific operation method in Example 3, the purified DNA_F2105, DNA_S2105, and DNA_T2105 were ligated with the pQE-80L plasmid that had been double-digested with BamHI / HindIII to construct a recombinant vector. This vector was then transformed into competent E. coli cells for expression and purification to obtain AP-2105 (its amino acid sequence is shown in SEQ ID NO: 63), a dual-target affinity binding protein that simultaneously targets hepatocyte membrane ASGPR and intracellular ALKBH5. Then, 50 mg of Tri-GalNAc-DBCO (cat. #2999748-27-3, MCE) was dissolved in 1 mL of DMF to form a Tri-GalNAc-DBCO / DMF solution. Add 1.36 mg of AP-2105 to 10 mL of binding buffer (50 mM NaH2PO4, 150 mM NaCl, 10 mM EDTA, pH 7.8), then add 11.7 μg of Bis-sulfone-PEG3-N3 (cat. #1802908-01-5, MCE) and mix well. Incubate at room temperature for 16 h. Cool the sample to 4 °C, add sodium triacetoxyborohydride (final concentration 25 mM), and react for 40 min. Add 20 μL of Tri-GalNAc-DBCO / DMF solution and incubate at room temperature (20-30 °C) in the dark for 16 h. After the reaction, concentrate by centrifugation using a 30 kDa ultrafiltration tube to obtain Tri-GalNAc-AP-2105, which is used to target ALKBH5 affinity-binding protein into hepatocytes to lower blood lipids.
[0113] Following the method described above, using DNA targeting the mTOP affinity-binding protein AP-N2211 as a template, and with pAP_F2211_F: GGATCGCATCACCATCACCATCACGGCCATATGGTGTCACCAGTG and pAP_F2211_R: CCGCCACCGCCGCTACCGCCACCGCCGTCATGGTTGCAGAGGCTG as upstream and downstream primers, the DNA was amplified by PCR to form DNA_F2211. Next, using DNA encoding amino acids 76-1096 of the SIN22 (SEQ ID No: 22) sequence (synthesized by a gene company) as a template, and with pAP_S2211_F: CGGTGGCGGTAGCGGCGGTGGCGGTAGCATGCCAGTTACAATTAAC and pAP_S2211_R: GTCCTTCAAGTATTCGCTGTACGATTGGATCTTGTAGC as upstream and downstream primers, the DNA was amplified by PCR to produce DNA_S2211. Then, using DNA targeting the EGFR affinity-binding protein AP-C2262 as a template, DNA_T2211 was prepared by PCR amplification using pAP_T2211_F (GATCCAATCGTACAGCGAATACTTGAAGGACTTTTGGG) and pAP_T2211_R (GAGTCCAAGCTCAGCTAATTAAGCTTTCAGTCCACCCTTCATC) as upstream and downstream primers. Following the specific procedures in Example 3, the purified DNA_F2211, DNA_S2211, and DNA_T2211 were ligated with the pQE-80L plasmid digested with BamHI / HindIII to construct a recombinant vector. This vector was then transformed into competent E. coli cells for expression. The product was purified using Ni-NTA affinity chromatography to obtain AP-2211, an affinity-binding protein that simultaneously targets EGFR on the tumor cell membrane and mTOP within tumor cells, thus exhibiting anti-tumor effects.
[0114] Similarly, following the method described above, using DNA targeting the NOX4 affinity-binding protein AP-N2308 as a template, and with pAP_F2308_F: GGATCGCATCACCATCACCATCACGATTGTTCGGTGTAGGATGTG and pAP_F2308_R: GCCACCGCCTGAACCGCCACCGCCTAAATCTTCATTGCACAGGT as upstream and downstream primers, the DNA was amplified by PCR to form DNA_F2308. Next, using DNA encoding amino acids 81-1200 of the SIN23 (SEQ ID No: 23) sequence (synthesized by a gene company) as a template, and with pAP_S2308_F: GCGGTGGCGGTTCAGGCGGTGGCGGTTCAATGCCAATTACAATTAAC and pAP_S2308_R: GTAGTCCTTCACCACGTTGGTGTACTGCAGGCTGTT as upstream and downstream primers, the DNA was amplified by PCR to produce DNA_S2308. Then, using DNA targeting the KIM-1 affinity binding protein AP-C2317 as a template, DNA_T2308 was prepared by PCR amplification using pAP_T2308_F: TAACAGCCTGCAGTACACCAACGTGGTGAAGGACTACTG and pAP_T2308_R: GAGTCCAAGCTCAGCTAATTAAGCTTTCACTTACAGGTACGAAG as upstream and downstream primers. Referring to the specific operation method in Example 3, the purified DNA_F2308, DNA_S2308, and DNA_T2308 were ligated with the pQE-80L plasmid digested with BamHI / HindIII to construct a recombinant vector, which was then transformed into E. coli competent cells for expression. The product was purified by Ni-NTA affinity chromatography to obtain AP-2308, a dual-target affinity-binding protein that targets KIM-1 in the renal cell membrane and NOX4 in the renal cells. This protein is used to target NOX4 affinity-binding protein into renal cells to reduce renal tissue damage.
[0115] Alternatively, using the same method, DNA targeting the PI3K-γ affinity-binding protein AP-N2436 was used as a template. PCR amplification was performed using pAP_F2436_F: GGATCGCATCACCATCACCATCACGATCCGGACGTGCCACTTCTG and pAP_F2436_R: GCCACCGCCTGAACCGCCACCGCCTGACCAAGAATTGCAATAATC as upstream and downstream primers, resulting in DNA_F2436. Next, using DNA encoding amino acids 86-1191 of the SIN24 (SEQ ID No: 24) sequence (synthesized by a gene company) as a template, PCR amplification was performed using pAP_S2436_F: GGCGGTGGCGGTTCAGGCGGTGGCGGTAGTATGACTTGGCCTGTGAAG and pAP_S2436_R: CCTTAATCACGTTGCGTAAGATCTGGCCCTCATAC as upstream and downstream primers, producing DNA_S2436. Then, using DNA targeting the CD206 affinity binding protein AP-C2408 as a template, DNA was amplified by PCR using pAP_T2436_F:TGAGGGCCAGATCTTACGCAACGTGATTAAGGATTATTGGG and pAP_T2436_R:GAGTCCAAGCTCAGCTAATTAAGCTCTCTACCCATCCTGGATC as upstream and downstream primers to prepare DNA_T2436. Referring to the specific operation method in Example 3, the purified DNA_F2436, DNA_S2436, and DNA_T2436 were ligated with the pQE-80L plasmid digested with BamHI / HindIII to construct a recombinant vector, which was then transformed into competent E. coli cells for expression. The product was purified by Ni-NTA affinity chromatography to obtain AP-2436, a dual-target affinity binding protein that targets CD206 and PI3K-γ of M2 macrophages, thereby reversing M2 macrophages into M1 macrophages and exerting an immune effect.
[0116] To enable the AR-targeting affinity-binding protein AP-N2517 to enter the cell nucleus, a nuclear localization signal with the amino acid sequence RRARPRG was inserted at the N-terminus of AP-N2517. Specifically, using the DNA of the AR-targeting affinity-binding protein AP-N2517 as a template, and using pAP_F2517_F1: GCGCGAGAAGACCTCGTGGGGCCTTGGACTGCCACGTG and pAP_F2517_R: CACCGCCTGAACCGCCACCGCCGGTACCATTGCATAAGTCGTACT as upstream and downstream primers, the DNA was amplified by PCR. The PCR reaction system and reaction conditions are as described in Example 1. Following agarose gel electrophoresis, DNA was recovered and purified using a gel extraction kit (Promega). Using the purified DNA as a template, PCR amplification was performed using pAP_F2517_F2: GGATCGCATCACCATCACCATCACCGCCGCGCGAGAAGACCTCGTG and pAP_F2517_R: CACCGCCTGAACCGCCACCGCCGGTACCATTGCATAAGTCGTACT as upstream and downstream primers. The PCR reaction system and conditions were as described in Example 1. Agarose gel electrophoresis was then performed, and the purified DNA, named DNA_F2517, was recovered and purified using a gel extraction kit (Promega). The concentration was determined using a micro-spectrophotometer. Next, using DNA encoding amino acids 77-1192 of the SIN25 (SEQ ID No: 25) sequence (synthesized by a gene company) as a template, DNA was amplified by PCR using pAP_S2517_F: GGCGGTGGCGGTTCAGGCGGTGGCGGTAGTATGACTTGGCCTGTGAAG and pAP_S2517_R: CTTTTACCACGTTGGTATACTGCAGGCTGTTGAAC as upstream and downstream primers to generate DNA_S2517. Then, using DNA targeting the PSA affinity-binding protein AP-C2521 as a template, DNA was amplified by PCR using pAP_T2517_F: AGCCTGCAGTATACCAACGTGGTAAAAGATTATTGGGG and pAP_T2517_R: GAGTCCAAGCTCAGCTAATTAAGCTTTCACTTGCAGGTACGAAG as upstream and downstream primers to prepare DNA_T2517.Referring to the specific operation method in Example 3, the purified DNA_F2517, DNA_S2517, and DNA_T2517 were ligated with the pQE-80L plasmid digested with BamHI / HindIII to construct a recombinant vector, which was then transformed into E. coli competent cells for expression. The product was purified by Ni-NTA affinity chromatography to obtain AP-2517, an affinity-binding protein that simultaneously targets PSA on the membrane of prostate cancer cells and AR within prostate cancer cells, thus exerting an anti-tumor effect.
[0117] Using the same method described above, DNA targeting the WWP1 affinity-binding protein AP-N2612 was used as a template. PCR amplification was performed using pAP_F2612_F: GGATCGCATCACCATCACCATCACGTATCTGGAATGCATTAGCTG and pAP_F2612_R: CCACCGCCACTACCGCCACCGCCTTCATTACATTTGGTAGTATTGCAG as upstream and downstream primers, resulting in DNA_F2612. Next, DNA encoding amino acids 86-1183 of the SIN26 (SEQ ID No: 26) sequence (synthesized by a gene company) was used as a template. PCR amplification was performed using pAP_S2612_F: GCGGTGGCGGTAGTGGCGGTGGCGGTAGCATGCCAAAGATTAACAGTT and pAP_S2612_R: AGTCCTTCAGGATGTTGGTGTTAGGCTCGTTACTGTA as upstream and downstream primers, producing DNA_S2612. Then, using DNA targeting the FABP3 affinity-binding protein AP-C2624 as a template, DNA was amplified by PCR using pAP_T2612_F (GTAACGAGCCTAACACCAACATCCTGAAGGACTTCTG) and pAP_T2612_R (GAGTCCAAGCTCAGCTAATTAAGCTTTTTTCTTGCCATCCATG) as upstream and downstream primers to prepare DNA_T2612. Following the specific procedures in Example 3, the purified DNA_F2612, DNA_S2612, and DNA_T2612 were ligated with the pQE-80L plasmid, which had been double-digested with BamHI / HindIII, to construct a recombinant vector. This vector was then transformed into competent E. coli cells for expression. The product was purified by Ni-NTA affinity chromatography to obtain AP-2612, a dual-target affinity-binding protein targeting both FABP3 on the cardiomyocyte membrane and WWP1 within cardiomyocytes. This protein is used to target WWP1 affinity-binding proteins into cardiomyocytes, reducing myocardial damage.
[0118] Next, following the method described above, using DNA targeting the HBV Cp affinity-binding protein AP-N2721 as a template, and using pAP_F2721_F: GGATCGCATCACCATCACCATCACGACTGCCCTGCTGTGCTACTC and pAP_F2721_R: CCGCCACCGCCACTACCGCCACCGCCAGAAGCATTACATAAATCAGT as upstream and downstream primers, the DNA was amplified by PCR to form DNA_F2721. Then, using DNA encoding amino acids 78-1188 of the SIN27 (SEQ ID No: 27) sequence (synthesized by a gene company) as a template, and using pAP_S2721_F: CGGTGGCGGTAGTGGCGGTGGCGGTTCTATGCCAGTGGTAATCAACAGT and pAP_S2721_R: GTCCTTCAGGATGCTTGGGTCTGGCTCGTCGCTGTACAG as upstream and downstream primers, the DNA was amplified by PCR to produce DNA_S2721. Then, using DNA targeting the NTCP affinity-binding protein AP-C2721 as a template, DNA_T2721 was prepared by PCR amplification using pAP_T2721_F: TACAGCGACGAGCCAGACCCAAGCATCCTGAAGGACTT and pAP_T2721_R: GAGTCCAAGCTCAGCTAATTAAGCTGTTTTCTTGCCATCCATGC as upstream and downstream primers. Referring to the specific operation method in Example 3, the purified DNA_F2721, DNA_S2721, and DNA_T2721 were ligated with the pQE-80L plasmid digested with BamHI / HindIII to construct a recombinant vector, which was then transformed into E. coli competent cells for expression. The product was purified by Ni-NTA affinity chromatography to obtain AP-2721, a dual-target affinity-binding protein targeting hepatocyte membrane NTCP and HBV Cp. This protein is used to deliver the HBV Cp-targeting affinity-binding protein into hepatocytes to exert an anti-hepatitis B effect.
[0119] Furthermore, following the above method, using DNA targeting the MLCK1 affinity-binding protein AP-N2814 as a template, and using pAP_F2814_F: GGATCGCATCACCATCACCATCACGAGCCTGCAGTGCTACAACTG and pAP_F2814_R: GCCACCGCCACTACCGCCACCGCCTTCATTGAAATTACAAAGATCC as upstream and downstream primers, the DNA was amplified by PCR to form DNA_F2814. Next, using DNA encoding amino acids 76-1189 of the SIN28 (SEQ ID No: 28) sequence (synthesized by a gene company) as a template, and using pAP_S2814_F: GGCGGTGGCGGTAGTGGCGGTGGCGGTTCTATGCCAGTGAACATTAAG and pAP_S2814_R: CCTTCAGGGTGTTGGTGCTTGACTGGATCCAGTACAG as upstream and downstream primers, the DNA was amplified by PCR to generate DNA_S2814. Then, using DNA targeting the GLP1R affinity-binding protein AP-C2846 as a template, DNA was amplified by PCR using pAP_T2814_F: GTACTGGATCCAGTCAAGCACCAACACCCTGAAGGACTTCTG and pAP_T2814_R: GAGTCCAAGCTCAGCTAATTAAGCTTTCTGTCCATCCTTCATCC as upstream and downstream primers to prepare DNA_T2814. Referring to the specific operation method in Example 3, the purified DNA_F2814, DNA_S2814, and DNA_T2814 were ligated with the pQE-80L plasmid digested with BamHI / HindIII to construct a recombinant vector, which was then transformed into E. coli competent cells for expression. The product was purified by Ni-NTA affinity chromatography to obtain AP-2814, a dual-target affinity-binding protein that targets GLP1R on the pancreatic islet cell membrane and MLCK1 in the islet cells. This protein is used to transfer the MLCK1-targeting affinity-binding protein into islet cells for the treatment of diabetes.
[0120] According to the aforementioned method, in order to enable the FoxO1-targeting affinity-binding protein AP-N2965 to enter the cell nucleus, a nuclear localization signal with the amino acid sequence KLGPRKATGRW is inserted at the N-terminus of AP-N2965. Specifically, using DNA expressing AP-N2965 as a template, pAP_F2965_F1: GGTCCACGCAAGGCGACGGGCCGGTGGCTGCTGCGGTGCTACACC and pAP_F2965_R: CCGCCACCGCCACTACCGCCACCGCCAACATTACACAA ACTAGACTG are used as upstream and downstream primers for PCR amplification of DNA. The PCR reaction system and reaction conditions are as described in Example 1. Following agarose gel electrophoresis, DNA was recovered and purified using a gel extraction kit (Promega). Using the purified DNA as a template, PCR amplification was performed using pAP_F2965_F2: GGATCGCATCACCATCACCATCACAAGCTGGGTCCACGCAAGGCGACG and pAP_F2965_R: CCGCCACCGCCACTACCGCCACCGCCAACAT TACACAAACTAGACTG as upstream and downstream primers. The PCR reaction system and conditions were as described in Example 1. Afterwards, agarose gel electrophoresis was performed, and the purified DNA, named DNA_F2965, was recovered and purified using a gel extraction kit (Promega). The concentration was detected using a micro spectrophotometer. Next, using DNA encoding amino acids 78-1207 of the SIN29 (SEQ ID No: 29) sequence (synthesized by a gene company) as a template, DNA was amplified by PCR using pAP_S2965_F: CGGTGGCGGTAGTGGCGGTGGCGGTTCTATGAAGCTGGAAATTAACAAG and pAP_S2965_R: CGCGGATGTAGTTGCTGTTGAAGTAGTAGTTGTAC as upstream and downstream primers to generate DNA_S2965. Then, using DNA targeting the Claudin-6 affinity-binding protein AP-C2912 as a template, DNA was amplified by PCR using pAP_T2965_F: CTACTACTTCAACAGCAACTACATCCGCGATATTTGG and pAP_T2965_R: GAGTCCAAGCTCAGCTAATTAAGCTATCTTCATCCCAGCCTTC as upstream and downstream primers to prepare DNA_T2965.Referring to the specific operation method in Example 3, the purified DNA_F2965, DNA_S2965, and DNA_T2965 were ligated with the pQE-80L plasmid digested with BamHI / HindIII to construct a recombinant vector, which was then transformed into competent E. coli cells for expression. The product was purified by Ni-NTA affinity chromatography to obtain AP-2965, a dual-target affinity-binding protein that targets Claudin-6 on the intestinal cell membrane and FoxO1 in the intestinal cell. This protein was used to transfer the FoxO1-targeting affinity-binding protein into intestinal cells for the treatment of Crohn's disease.
[0121] Referring to the aforementioned method, in order to enable the PARP1 affinity-binding protein AP-N3033 to enter the cell nucleus, a nuclear localization signal with the amino acid sequence RKHKTNRKPR was inserted at the N-terminus of AP-N3033. Specifically, using DNA expressing AP-N3033 as a template, pAP_F3033_F1: GCATAAGACAAACAGGAAGCCCCGTAGTTTGAGATGCCATGAC and pAP_F3033_R: GCCACCGCCACTACCGCCACCGCCAGCATTACA CACCATACTGTT were used as upstream and downstream primers for PCR amplification of DNA. The PCR reaction system and reaction conditions are as described in Example 1. Following agarose gel electrophoresis, DNA was recovered and purified using a gel extraction kit (Promega). Using the purified DNA as a template, PCR amplification was performed using pAP_F3033_F2: GGATCGCATCACCATCACCATCACGAGAAAGCATAAGACAAACAGGAAG and pAP_F3033_R: GCCACCGCCACTACCGCCACCGCCAGCATTACACACCATACTGTT as upstream and downstream primers. The PCR reaction system and conditions were as described in Example 1. Afterwards, agarose gel electrophoresis was performed, and the purified DNA, named DNA_F3033, was recovered and purified using a gel extraction kit (Promega). The concentration was detected using a micro spectrophotometer. Next, using DNA encoding amino acids 88-1222 of the SIN30 (SEQ ID No: 30) sequence (synthesized by a gene company) as a template, DNA was amplified by PCR using pAP_S3033_F: GCGGTGGCGGTAGTGGCGGTGGCGGTTCTATGCCAATCACCATTAAC and pAP_S3033_R: CGCGCAGGAAGGTAATGCTCAGGTAGCTGGTGTAC as upstream and downstream primers to generate DNA_S3033. Then, using DNA targeting the SLC4A11 affinity binding protein AP-C3028 as a template, DNA was amplified by PCR using pAP_T3033_F: CCAGCTACCTGAGCATTACCTTCCTGCGCGATTTCTG and pAP_T3033_R: GAGTCCAAGCTCAGCTAATTAAGCTATCATTTGTCCATCCTTC as upstream and downstream primers to prepare DNA_T3033.Referring to the specific operation method in Example 3, the purified DNA_F3033, DNA_S3033, and DNA_T3033 were ligated with the pQE-80L plasmid digested with BamHI / HindIII to construct a recombinant vector, which was then transformed into E. coli competent cells for expression. The product was purified by Ni-NTA affinity chromatography to obtain AP-3033, a dual-target affinity-binding protein that targets SLC4A11 on the membrane of ovarian cancer cells and PARP1 in ovarian cancer cells. This protein is used to target and deliver the PARP1 affinity-binding protein into ovarian cancer cells to exert an anti-tumor effect.
[0122] Take 40 μL of each of the following proteins: AP-2105, AP-2211, AP-2308, AP-2436, AP-2517, AP-2612, AP-2721, AP-2814, AP-2965, and AP-3033. Add 10 μL of 5×SDS-PAGE loading buffer, mix well, heat at 98℃ for 10 minutes, centrifuge at 12000 rpm for 1 minute, and take 20 μL of the supernatant. Add it to the wells of a 12% SDS-PAGE gel for electrophoresis. Stain with Coomassie blue to visualize the purified proteins. The results are as follows: Figure 13 As shown, the affinity-binding protein solution exhibited a band at approximately 160 kDa, consistent with the expected size. Then, the protein concentration was determined according to the instructions of the BCA protein assay kit (Cat. NO: BL521A, Biosharp, Beijing Lanjieke Technology Co., Ltd.).
[0123] Example 15: Detection of affinity-binding protein binding activity against dual targets The binding affinity of each affinity-binding protein to its target protein was assessed using the procedures described in Example 9, following the methods employed for the following proteins: AP-2105 target proteins ASGPR and ALKBH5; AP-2211 target proteins EGFR and mTOP; AP-2308 target proteins KIM-1 and NOX4; AP-2436 target proteins CD206 and PI3K-γ; AP-2517 target proteins PSA and AR; AP-2612 target proteins FABP3 and WWP1; AP-2721 target proteins NTCP and HBV Cp; AP-2814 target proteins GLP1R and MLCK1; AP-2965 target proteins Claudin-6 and FoxO1; and AP-3033 target proteins SLC4A11 and PARP1. The results are shown in Table 4.
[0124] Table 4: Binding affinity of affinity-binding proteins to dual-target proteins As shown in Table 4, the dissociation equilibrium constants of the affinity-binding proteins and the dual-target proteins are all below 22 nM, with most below 10 nM. This indicates that the affinity-binding proteins exhibit high affinity for their target proteins.
[0125] Example 16: AP-2105 interacts with hepatocytes ASGPR and ALKBH5 to reduce blood lipids HepG2 liver cells were administered at a concentration of 1×10⁻⁶ per vial. 7 Cells were cultured in culture flasks and cultured in DMEM high-glucose complete medium containing 10% fetal bovine serum for 24 h. Cells were divided into an AP-2105 experimental group and a BSA control group. After washing and changing the medium, AP-2105 or BSA was added to each group at a dose of 1 μg / mL, and the cells were cultured at 37°C for 48 h. The supernatant was collected from each group, and the TC and TG levels were measured according to the instructions of the cholesterol (TC) and triglyceride (TG) kits. Results are as follows: Figure 14 As shown, compared with the BSA control group, the contents of TG and TC in HepG2 cells were significantly increased and significantly decreased after AP-2105 treatment.
[0126] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A scaffold protein derived from Ly6 / uPAR protein and / or clostridium neurotoxin, characterized in that, Including at least one of the Ly6 / uPAR protein variants and clostridium neurotoxin variants; The Ly6 / uPAR protein variants include variants in which two or more amino acid changes are made on any one or more rings of ring 1, ring 2 and ring 3 of the molecular structure of wild-type Ly6 / uPAR protein; The clostridium neurotoxin variants include H CC Subdomain variants; the H CC The subdomain is derived from the H chain receptor-binding domain of clostridium neurotoxin, wherein the H... CC Subdomain variants are found in the wild-type Clostridium neurotoxin H chain receptor binding domain H. C H CC Variants in which eight or more amino acids are changed in the subdomain.
2. The scaffold protein according to claim 1, characterized in that, It also includes heteropeptides inserted within the Ly6 / uPAR protein variant or clostridium neurotoxin variant; the heteropeptides are derived from at least one of an EGF-like domain and a glycosyl recognition domain of a lectin.
3. The scaffold protein according to claim 2, characterized in that, The Ly6 / uPAR protein variants include LU domain variants; the LU domain variants are variants formed by replacing and / or recombinating amino acid sequences consisting of two or more amino acids on each of the loops 1, 2, and 3 of the three-finger loop of the LU domain of the wild-type Ly6 / uPAR protein with amino acid sequences consisting of two or more amino acids on the loops A, B, and C of the EGF-like domain; the H CC Subdomain variant is wild-type Clostridium neurotoxin H chain receptor binding domain H C H CC A variant in which a portion of the amino acid sequence of the subdomain is replaced and / or recombined with an amino acid sequence that binds to the sugar structure in the lectin glycosyl recognition domain, wherein the H CC The partial amino acid sequence of the subdomain includes H CC The amino acid sequences of the ganglioside receptor-binding region and the neuronal protein receptor-binding region of the subdomain; the Ly6 / uPAR protein includes at least one of SLURP-1, SLURP-2, PATE1, LY6G5B, LYNX1, PLAUR, PSCA, CD59, GPIHBP1, and LY6DL; the EGF-like domain is derived from EGF, TGFα, Epigen protein, Neuregulin-1, HB-EGF, Amphiregulin, Epiregulin, β-cellular, and Neuregulin. The clostridial neurotoxins include at least one of in-2 and Neuregulin-3; the clostridial neurotoxins include at least one of BoNT / A, BoNT / B, BoNT / C, BoNT / D, BoNT / DC, BoNT / E, BoNT / F, BoNT / G, BoNT / X, and TeNT; the lectins include at least one of MBL, E-Selectin, Siglec-3, Siglec-5, DC-SIGN, Siglec-7, Siglec-9, Ficolin-3, Ficolin-1, and Ficolin-2.
4. The scaffold protein according to claim 3, characterized in that, The scaffold protein also includes a recombinant protein comprising the Ly6 / uPAR protein variant and the clostridium neurotoxin variant; the recombinant protein comprises the Ly6 / uPAR protein variant, the clostridium neurotoxin L-chain variant, and the clostridium neurotoxin H-chain translocation domain H. N Clostridium neurotoxin H chain receptor binding domain H CN Sub-domain, H CC Recombinant proteins of the subdomain variant or variants thereof; the L-chain variant is a variant in which three or more amino acid changes have been made to the L-chain of wild-type Clostridium neurotoxin.
5. The scaffold protein according to claim 4, characterized in that, The amino acid sequence of the scaffold protein is shown in any one of SEQ ID NO: 1-30; wherein, the amino acid sequence of the Ly6 / uPAR protein variant is shown in any one of SEQ ID NO: 1-10; the H CC The amino acid sequences of the subdomain variants are shown in any one of SEQ ID NO: 11-20; the amino acid sequences of the recombinant proteins of the Ly6 / uPAR protein variant and the Clostridium neurotoxin variant are shown in any one of SEQ ID NO: 21-30.
6. Displaying a document library, characterized in that, Includes libraries generated by directed and / or random mutations of 5 to 60 amino acid residues of the scaffold protein according to any one of claims 1-5.
7. A nucleic acid molecule, characterized in that, The scaffold protein according to any one of claims 1-5 has a nucleotide sequence as shown in any one of SEQ ID NO: 31-60.
8. The use of the scaffold protein according to any one of claims 1-5 in screening affinity-binding proteins for a target, characterized in that, The affinity-binding protein includes at least one of protein-targeted drugs and detection reagents for the target.
9. A method for screening affinity-binding proteins, characterized in that, The method includes the following steps: obtaining a display library by directional and / or random mutation of 5-60 amino acid residues of the amino acid sequence of the scaffold protein according to any one of claims 1-5; screening DNA expressing the affinity-binding protein of the target in the display library by in vitro display technology; and expressing and purifying the DNA to obtain the affinity-binding protein.
10. A protein-targeted drug, characterized in that, Based on the scaffold protein of any one of claims 1-5 or the display library of claim 6, the target is obtained by screening using display technology; the protein-targeted drug includes any one or more of the following: AP-121, an affinity-binding protein targeting the SARS-CoV-2 S protein, whose amino acid sequence is shown in SEQ ID NO: 61; AP-1312, an affinity-binding protein targeting CD36, whose amino acid sequence is shown in SEQ ID NO: 62; and AP-2105, an affinity-binding protein targeting ASGPR and ALKBH5, whose amino acid sequence is shown in SEQ ID NO: 63.