Gssd4 and application thereof for preventing and controlling clubroot

CN122587875APending Publication Date: 2026-08-18HUAZHONG AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610994789.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-06
Publication Date
2026-08-18

AI Technical Summary

Technical Problem

然而,现有技术中关于利用纤毛虫等原生动物防治植物病害的研究报道极为罕见,特别是利用纤毛虫Gonostomum属物种防控油菜根肿病的技术方案在国内外均未见公开

Benefits of technology

[0020] 1) The ciliate GsD4 of the present invention directly preys on dormant spores of clubroot fungus. After co-culturing for 3 days, the spore concentration decreased significantly. After inoculation, it can significantly reduce the disease index of clubroot disease in rapeseed and reduce the relative biomass of clubroot fungus in the root system. It breaks through the bottleneck of existing biological control technology that is difficult to directly remove the primary source of infection in the soil and is of great significance for the source control of clubroot disease in rapeseed.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application relates to a kind of gonostomum strenuum GsD4 for preventing and controlling clubroot and its application.The strain is preserved in China typical culture preservation center, and the preservation date is May 20, 2026, and the preservation number is CCTCC NO:V202663.The gonostomum strenuum GsD4 can directly prey on plasmodiophora brassicae resting spores, and the spore concentration decreases after co-culturing for 3 days;Inoculating gonostomum strenuum GsD4 at 22 DEG C and 28 DEG C can significantly reduce the disease index of brassica napus clubroot and reduce the relative biomass of plasmodiophora brassicae in root system.The present application realizes source control by directly removing initial infection source in soil, breaks through the bottleneck of existing biological control technology, and provides a new strategy for efficient and green biological control of brassica napus clubroot.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bio-agriculture and relates to a ciliate GsD4 for controlling clubroot disease and its application. Background Technology

[0002] Rapeseed (Brassica napus L.) originated in the Mediterranean region and is one of the world's major oilseed crops. Due to its high oil content, stable yield, and potential for increased production, it has been widely cultivated. Currently, it is not only a major oilseed crop and an important honey source in my country, but also a pioneer crop for vegetables, green manure, and saline-alkali land management. However, throughout its growth period, rapeseed is affected not only by drought, low temperatures, and soil salinization, but also by various pathogens, insects, and weeds, severely impacting rapeseed quality. Among these, clubroot disease, caused by Plasmodiophora brassicae, is a devastating soil-borne disease. This pathogen, a low-level single-celled eukaryotic protozoan, can survive in the soil for 8 to 15 years with its dormant spores, leading to widespread global transmission and causing hundreds of billions of yuan in economic losses annually. This seriously threatens the sustainable development of the rapeseed industry and the security of edible oil supply.

[0003] In recent years, the use of microbial agents such as Bacillus, Trichoderma, and Actinomycetes for biocontrol has received widespread attention due to its environmental friendliness. Previous studies have reported the isolation of a strain of Bacillus amyloliquefaciens HB-26 (CN102382781A) from the rhizosphere soil of rapeseed. This strain exhibits antibacterial activity against *Plasmodiophora brassicae*, and its secreted glycosaminoglycan BA20 can inhibit the growth of *Plasmodiophora brassicae*. However, this strain's activity is limited to indirect inhibition of the pathogen through the secretion of antibacterial substances, and does not involve its direct predation on dormant spores of *Plasmodiophora brassicae*. The research focuses on the isolation and identification of the active substances, without addressing the strain's direct ability to eliminate dormant spores, thus failing to reduce the primary source of soil infection.

[0004] Protozoa, as an important component of soil microbial communities, can suppress disease occurrence through direct predation of pathogens and regulation of rhizosphere microecological balance. Ciliates, as an important group of soil protozoa, play a crucial regulatory role in the soil ecosystem. However, research reports on the use of protozoa such as ciliates for the control of plant diseases are extremely rare, especially regarding the use of *Gonostomum* species to control clubroot disease in rapeseed, which has not been publicly disclosed domestically or internationally. The direct predation of pathogenic dormant spores by ciliates and their directed chemotaxis mechanism in the rhizosphere remain unexplained, indicating a research gap in this field. Summary of the Invention

[0005] The purpose of this invention is to address the above-mentioned shortcomings of the prior art by providing a ciliate GsD4 for controlling clubroot disease.

[0006] Another object of the present invention is to provide an application of the ciliate GsD4.

[0007] Another objective of this invention is to provide a method for preventing and controlling clubroot disease in rapeseed.

[0008] The objective of this invention can be achieved through the following technical solutions:

[0009] To solve the above-mentioned technical problems, the present invention provides a ciliate (Gonostomum strenuum), specifically the Gonostomum strenuum GsD4 strain, which was deposited at the China Center for Type Culture Collection on May 20, 2026, with accession number CCTCC NO:V202663.

[0010] Furthermore, the 18S rDNA sequence of the ciliate GsD4 is shown in SEQ ID No. 1.

[0011] This application also provides the application of the aforementioned ciliate GsD4 in inhibiting Plasmodiophora brassicae.

[0012] This application also provides the use of the above-mentioned ciliate GsD4 in controlling clubroot disease of rapeseed caused by Plasmodiophora brassicae or in the preparation of formulations for controlling clubroot disease of rapeseed caused by Plasmodiophora brassicae.

[0013] Another object of the present invention is to provide a culture containing the aforementioned ciliate GsD4.

[0014] This application also provides a method for preparing the above-mentioned culture, which is prepared by the following method: the above-mentioned ciliate GsD4 is inoculated into PAS buffer containing inactivated Escherichia coli and cultured in the dark at 20-28 ℃ for 1-5 days; the PAS buffer is prepared as follows: firstly, solution 1 and solution 2 need to be prepared. The components of solution 1 are 0.142 g disodium hydrogen phosphate (Na2HPO4) and 0.136 g potassium dihydrogen phosphate (KH2PO4), and water is added to a final volume of 500 mL; the components of solution 2 are 0.12 g sodium chloride, 4 mg magnesium sulfate heptahydrate, and 4 mg calcium chloride dihydrate, and water is added to a final volume of 500 mL; 1 L of PAS buffer is prepared by mixing 500 mL of solution 1 and 500 mL of solution 2 and adding water to a final volume of 1 L, and then sterilizing at 121 ℃ for 20 min.

[0015] Furthermore, the above culture is a 96-well plate culture system, and the concentration of ciliate GsD4 in each well is 10. 4 One hole / hole.

[0016] This application also provides the application of the above-mentioned culture in inhibiting Plasmodiophora brassicae.

[0017] This application also provides the use of the above-mentioned culture in the prevention and control of clubroot disease in rapeseed caused by Plasmodiophora brassicae or in the preparation of formulations for the prevention and control of clubroot disease in rapeseed caused by Plasmodiophora brassicae.

[0018] This application also provides a method for preventing and controlling clubroot disease in rapeseed. The method involves applying the above-mentioned culture to the rhizosphere of rapeseed seedlings that have grown to 2 weeks of age at a temperature of 20-28℃. The amount of culture applied is 5 mL / plant, and the concentration of ciliate GsD4 in the culture is 1500 cells / mL.

[0019] Compared with the prior art, the present invention achieves the following beneficial effects:

[0020] 1) The ciliate GsD4 of the present invention directly preys on dormant spores of clubroot fungus. After co-culturing for 3 days, the spore concentration decreased significantly. After inoculation, it can significantly reduce the disease index of clubroot disease in rapeseed and reduce the relative biomass of clubroot fungus in the root system. It breaks through the bottleneck of existing biological control technology that is difficult to directly remove the primary source of infection in the soil and is of great significance for the source control of clubroot disease in rapeseed.

[0021] 2) The ciliate GsD4 of the present invention is a predatory protozoan that controls diseases by preying on pathogen spores. It is less likely to cause pathogens to develop drug resistance. It is also more environmentally friendly than chemical control, with no risk of chemical pesticide residues. It can reduce dependence on and use of traditional chemical pesticides, and at the same time help improve the soil micro-ecological environment, which meets the needs of green agriculture and sustainable development.

[0022] 3) This invention is the first to isolate GsD4, a ciliate that can prey on dormant spores of clubroot fungus, from the rhizosphere soil of rapeseed, clarifying its biocontrol mechanism, filling the research gap in this field, laying a theoretical foundation for building a source control technology system for clubroot disease in rapeseed, and opening up new directions for the research on protobiological control of other soil-borne diseases. Attached Figure Description

[0023] Figure 1Phylogenetic tree constructed from the in vivo morphology and 18S rRNA sequence of ciliate GsD4. (A) In vivo morphology of ciliate GsD4 observed under an inverted microscope; (B) Phylogenetic tree constructed from the 18S rRNA sequence of ciliate GsD4.

[0024] Figure 2 The ciliate GsD4 preys on dormant spores of *Plasmodium*. A p-value < 0.05 was considered statistically significant. The significance markers in the figures and tables are as follows: * indicates p < 0.05, meaning the difference is statistically significant; *** indicates p < 0.01, meaning the difference is highly statistically significant; *** indicates p < 0.001, meaning the difference is extremely highly statistically significant.

[0025] Figure 3 Pot experiment of rapeseed inoculated with GsD4 ciliate. (A) Disease phenotypes of Westar rapeseed inoculated with GsD4 ciliate, clubroot bacteria, and co-inoculated with GsD4 ciliate and clubroot bacteria at 22℃ and 28℃ respectively; (B) Disease index of Westar rapeseed inoculated with GsD4 ciliate, clubroot bacteria, and co-inoculated with GsD4 ciliate and clubroot bacteria at 22℃ and 28℃ respectively; (C) Statistical analysis of relative biomass expression of clubroot bacteria in the roots of Westar rapeseed inoculated with GsD4 ciliate, clubroot bacteria, and co-inoculated with GsD4 ciliate and clubroot bacteria at 22℃ and 28℃ respectively. A p-value of <0.05 is considered statistically significant. The significance markers in the charts are as follows: * indicates p <0.05, meaning the difference is statistically significant; *** indicates p <0.01, meaning the difference is highly statistically significant; *** indicates p <0.001, meaning the difference is extremely highly statistically significant.

[0026] Biological Preservation Instructions

[0027] The ciliate GsD4, classified as GsD4 Gonostomum strenuum, was deposited at Wuhan University, China on May 20, 2026; the depository is the China Center for Type Culture Collection; the accession number is CCTCC NO:V202663. Detailed Implementation

[0028] Test materials

[0029] The tested pathogenic microorganism, Plasmodiophora brassicae, was preserved in the laboratory.

[0030] Culture conditions for pathogenic microorganisms: Clubroot spores were extracted from the diseased parts of rapeseed and stored at 4°C.

[0031] Test plant: Rapeseed (Brassica napus L): Westar (preserved in the laboratory)

[0032] Plant cultivation conditions: Rapeseed seedlings were cultivated in a plant cultivation room under the following conditions: 22℃, 12 hours of light, 12 hours of darkness, and 75% relative humidity.

[0033] Test soil: substrate soil in which CBP60g rapeseed was planted and inoculated with clubroot fungus.

[0034] Escherichia coli: Model strain Escherichia coli DH5α.

[0035] LB liquid medium: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, add deionized water, bring to a final volume of 1000 mL, and sterilize at 115 °C for 30 min.

[0036] PAS (Page's amoeba saline) buffer: First, prepare solutions 1 and 2. Solution 1 consists of 0.142 g disodium hydrogen phosphate (Na₂HPO₄). 4) Solution 1 consists of 0.136 g potassium dihydrogen phosphate (KH₂PO₄) and diluted with water to a final volume of 500 mL. Solution 2 consists of 0.12 g sodium chloride, 4 mg magnesium sulfate heptahydrate, and 4 mg calcium chloride dihydrate, diluted with water to a final volume of 500 mL. 1 LPAS buffer consists of 500 mL of Solution 1 and 500 mL of Solution 2, diluted with water to a final volume of 1 L, and sterilized at 121 °C for 20 min.

[0037] Main reagents and instruments: inverted microscope, vertical shaking incubator, constant temperature incubator, ultraviolet-visible spectrophotometer, etc.

[0038] Example 1: Isolation and Identification of Ciliate GsD4

[0039] 5 g of rapeseed rhizosphere soil was placed in a tissue culture flask, and 200 mL of sterile water was added. The flask was then placed in a shaker and shaken thoroughly at 180 rpm / min until the ciliate GsD4 was evenly dispersed in the soil suspension. The mixture was allowed to stand for a short time until the soil particles precipitated. 10 μL of the supernatant was added to a 96-well plate. Then, 90 μL of PAS buffer and 10 μL of inactivated E. coli solution prepared with sterile water were added to each well as the sole food source. The 96-well plate was placed in an incubator in the dark and incubated at 20 °C. Every 24 h, the plate was removed and the growth of ciliate GsD4 was observed in each well using an inverted microscope at 400x magnification. Inactivated E. coli solution was periodically added to each well.

[0040] From day 7 to day 14 of dark incubation, the growth of GsD4 ciliates in the 96-well plates was observed daily using an inverted microscope. After a period of continued incubation, 10 μL of the stock solution was aspirated from the original wells and added to a new buffer-E. coli culture system. This incubation process was repeated until only a single GsD4 ciliate was observed in a well. The GsD4 ciliates from that well were then aspirated separately, and buffer and E. coli were added for further culture. If only one type of GsD4 ciliate was observed, the liquid in the glass micropipettes was transferred to a new 96-well microplate containing soil-borne GsD4 culture medium. After culturing for 2 to 3 days, the GsD4 ciliates in the wells were checked for proliferation and morphological uniformity. If the morphology was uniform, 10 μL of the culture medium containing the morphologically uniform GsD4 ciliates was aspirated from the culture system containing the morphologically uniform GsD4 ciliates and added to a new 96-well microplate. This process was repeated 2 to 3 times. This step is to remove most of the soil bacteria and fungi from the purified ciliate GsD4 sample, ensuring that the GsD4 sample is not impure during subsequent DNA extraction and sequence alignment.

[0041] The isolated and purified ciliate GsD4 was added to a ciliate GsD4 culture medium and cultured in a low-temperature incubator at 20 ℃ in the dark for 24 h. The culture was then removed and photographed in vivo under an inverted microscope. The 18S rDNA of the isolated ciliate GsD4 was sequenced and compared with the NCBI database. A phylogenetic tree was then constructed using the neighbor-joining method with MEGA11 software. The results showed that the 18S rRNA sequence coverage of ciliate GsD4 with Gonostomum strenuum was 100%. After comparison with the NCBI database, the ciliate GsD4 was identified as belonging to the kingdom Protista, phylum Ciliophora, class Polyhymenophorea, order Hypotrichida, family Gonostomatidae, genus Gonostomum, and finally Gonostomum strenuum. like Figure 1As shown in Figure A, in its live form, the ciliate is a firm oval or egg-shaped body, dorsoventrally flattened, with a flat ventral surface and a raised dorsal surface. The posterior half is slightly narrower than the anterior half, and the posterior part is rounded. The oral region is large and long, with obvious tufts of spiny hairs at both the anterior and posterior ends, which can be used for crawling or paddling. In its cyst form, the ciliate shrinks into a spherical shape, with a significantly reduced volume, about 1 / 3 to 1 / 2 of the live size, and a diameter of about 20 to 30 μm. There is little morphological difference between individuals. The cyst wall is relatively thick, and the internal structure is dense. The phylogenetic tree of the ciliate GsD4 is shown in Figure 1B. The comparison results from the NCBI database show that the 18S rRNA sequence coverage of GsD4 and Gonostomum strenuum is 100%, and the sequence identity is 98.87%.

[0042] Example 2: Experiment on the predation of clubroot spores by the ciliate GsD4

[0043] The experiment was conducted in 96-well plates. The experimental group consisted of 50 μL of GsD4 at a concentration of 2000 ciliates / mL + 10 μL of GsD4 at a concentration of 1.0 × 10⁻⁶. 7 spores / mL spore suspension; spore control group: 50 μL sterile buffer + 10 μL 1.0×10⁻⁶ spores / mL spore suspension. 7 Spores / mL spore suspension; Ciliate GsD4 control group: 50 μL of 2000 spores / mL Ciliate GsD4 + 10 μL of sterile buffer, 5 replicates per treatment, and the well plates were incubated in a 20-25℃ incubator in the dark. The concentrations of Ciliate GsD4 and spores were counted at 0d, 1d, 2d, 3d, 4d, and 5d. The results showed that Ciliate GsD4 had a predatory effect on dormant spores of *Plasmodiophora*, and compared with the control group, the spore concentration in the co-culture group began to decrease from day 3. Figure 2 ).

[0044] Example 3: Pot Experiment of Rapeseed with Ciliate GsD4

[0045] Pre-culture of GsD4 ciliates: Initially, use a large number of 1 L tissue culture flasks, each containing 700 mL of PAS buffer, and add OD... 600 =0.04% Escherichia coli was used to prepare soil ciliate GsD4 medium, and then GsD4 ciliates were inoculated into it. The culture flasks were placed at 20 ℃ and incubated in the dark for 5 days. After that, the number of GsD4 ciliates in the culture flasks was counted by aspirating the GsD4 culture medium in a clean bench, and then diluted with PAS buffer to a concentration of 1500 cells / mL for inoculation of pot experiments.

[0046] Inoculation with GsD4 ciliates: Add 5 mL of GsD4 ciliates at a concentration of 1500 ciliates / mL to the roots of each rapeseed plant after 14 days of culture, water regularly, and manage in pots.

[0047] Co-culturing of GsD4 ciliates with dormant spores of Plasmodium: A culture medium containing 1500 GsD4 spores / mL was mixed with a 1×10⁻⁶ dormant spore medium of GsD4. 7 Mix equal proportions of dormant spores of *Plasmodiophora* per mL and incubate at 20 °C in the dark for 5 days.

[0048] Extraction of dormant spores of *Plasmodiophora stylosa*: Chop 10 g of clubroot tissue, add 50 mL of sterile water, and grind finely in a mortar or juicer; filter through four layers of gauze, transfer the filtrate to a clean 50 mL centrifuge tube, centrifuge at 3100 r / min for 15 min, and discard the supernatant; redissolve the precipitate in 50 mL of sterile water, centrifuge at 3100 r / min for 10 min, this step can be repeated 2-3 times. Discard the supernatant; add 5 mL of 50% sucrose solution to the precipitate, mix well, and centrifuge at 3100 r / min for 10 min; carefully transfer the supernatant to a clean centrifuge tube using a pipette, add 30 mL of sterile water, centrifuge at 3100 r / min for 10 min, and discard the supernatant; redissolve the precipitate in 30 mL of sterile water, centrifuge at 3100 r / min for 10 min, this step can be repeated 2-3 times. The precipitate is dissolved in 5 mL of sterile water for later use; it can be stored at 4℃ protected from light.

[0049] Inoculation with *Cladophora stylosa*: After culturing rapeseed for approximately 2 weeks (14 days), use a pipette to take 1 mL of a 1×10⁻⁶ solution. 6 Or 1×10 7 Dormant spores of *Plasmodiophora* per mL were applied to the roots of the plants and the disease index was recorded 21 days after inoculation.

[0050] Rapeseed treatment: When the wild-type rapeseed Westar reached 2 weeks of growth, the roots of the experimental group were inoculated with 5 mL of GsD4 ciliates at a concentration of 1500 ciliates / mL, and then pretreated at 22 ℃ and 28 ℃ for 2 days. After 2 days, they were returned to the culture room and inoculated with 5 mL of GsD4 ciliates at a concentration of 1000 ciliates / mL. 7 The experimental group was treated with 5 mL of GsD4 ciliate culture medium containing 1500 spores / mL of dormant spores of *Plasmodiophora stylosa* and 5 mL of GsD4 ciliate culture medium every 5 days. The control group, which was not inoculated with *Plasmodiophora stylosa*, was also treated with the same temperature.

[0051] Clubroot disease severity index statistical standards: According to a five-level grading system: Level 0, no disease; Level 1, a very small number of tumors mainly on lateral roots, with negligible damage to the main root; Level 2, the main root and a few lateral roots are covered with small tumors; Level 3, the main root has medium to large spherical tumors; Level 4, the lateral and main roots have severe tumors, the main root is completely swollen, and the fine roots on the lateral roots are completely damaged; Level 5, the roots are completely swollen and rotten. Severity index = [∑(number of diseased plants at each level × corresponding level value)] / (total number of plants surveyed × highest level value) × 100.

[0052] Total DNA extraction from clubroot: Clean the diseased roots of clubroot, cut them into small pieces, place them in a clean mortar, flash-freeze with liquid nitrogen, grind thoroughly, and transfer to a 2 mL centrifuge tube. Add 800 μL of 2% CTAB extraction buffer preheated to 65 °C, quickly invert to mix, and incubate at 65 °C for 15-30 min, gently inverting to mix every 5 min. Add 400 μL of chloroform and Tris-saturated phenol solution to the mixture, and centrifuge at 12000 r / min for 15 min. Transfer 500 μL of the supernatant to another 2 mL centrifuge tube, add an equal volume of chloroform for extraction again, centrifuge at 12000 r / min for 15 min, take 450 μL of the supernatant, add an equal volume of isopropanol, mix, and precipitate at -20 °C for 10-15 min. Centrifuge at 12000 r / min for 15 min, discard the supernatant and keep the precipitate, wash the precipitate twice with 1 mL of 75% ethanol, and place at 37 °C. The DNA was dried in an oven at -20 °C, dissolved in 30 μL of deionized water (containing 25 µg / mL RNase A), and the DNA concentration was measured. The DNA was then stored at -20 °C (Allen et al 2006).

[0053] Detection of relative biomass of clubroot bacteria in diseased roots: Wild-type rapeseed (Westar) was inoculated according to the clubroot inoculation experiment method. Roots of diseased rapeseed were collected 23 days after inoculation as experimental materials. Two diseased roots from each family were used as one sample. Total DNA was extracted from the diseased roots of rapeseed with clubroot infection using the CTAB method. The DNA concentration was determined using Nanodrop and the total DNA concentration was diluted to 100-200 ng / μL. Using the diluted DNA as a template, the content of the clubroot reference gene relative to the rapeseed reference gene (BnaGDI1) was detected by qPCR using V4_1f (CCAGCASCYGCGGTAATWCC) and TAReukREV3 (ACTTTCGTTCTTGATYRA) as primers. qPCR was performed on a CFX96 Real-time PCR system (BioRad), and the relative content was calculated using the 2-ΔΔCt method. The qPCR reaction system was as follows: PS qMix 5 μL, Forward primers 0.5 μL, Reverse primers 0.5 μL, cDNA 2 μL, and ddH2O 2 μL. The reaction program was: 95 ℃ for 2 min, 95 ℃ for 15 sec, 60 ℃ for 30 sec, and 72 ℃ for 20 sec, repeated for 35-40 cycles; melting curves were plotted at 65 ℃-95 ℃.

[0054] Westar rapeseed inoculated with clubroot fungus was subjected to temperature treatments of 22 ℃ and 28 ℃, as well as treatments with and without inoculation using the ciliate GsD4, to determine the control effect of GsD4 on clubroot fungus at different temperatures. The results showed that inoculation with GsD4 at both 22 ℃ and 28 ℃ alleviated the root nodular protrusion symptoms in wild-type Westar plants. At 22 ℃, inoculation with GsD4 reduced the clubroot index of Westar by 40.7% and 30.8%, respectively. At 28 ℃, the disease index of the corresponding lines decreased by 76.9% and 46.8%, respectively. Simultaneously, the relative abundance of *P. brassicae* in diseased roots inoculated with GsD4 was significantly reduced. These results indicate that the predatory ciliate GsD4 can serve as a potential novel biocontrol agent for clubroot disease. Figure 3 ).

[0055] 18S rDNA sequencing results:

[0056] CCACCCCTTCCGCACATGTCTTTTACGCTAAGTTAGTCTTTAACAAATCCGAGAATTTCACCTCTGACAATTAAATACTAATGCCCCCAACTATCCCTATTAATCATTACTTCAGTCCCTCAAACCAACAAAGGAGACTAAAGTCCTATTCTATTATTCCATGCTAATGTATTCCGGCGCAAGCCTGCCTGAAACACTCTAATTTTCTCAAGGTAAAATATCTGAGCCCGAAACCAGTAAGTGAATACCAAGAAACGTTAACAGAAGGATGGAAGGACGCCGCTGCACACGCTAACAAGCGGACATTGGCATCCTCCCAGAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTTAATATACGCTATTGGAGCTGGAATTACCGCAGCTGCTGGA(SEQ ID No.1)。

Claims

1. A ciliate (Gonostomum strenuum) GsD4, characterized in that, This strain was deposited at the China Center for Type Culture Collection on May 20, 2026, with accession number CCTCC NO:V202663.

2. The ciliate GsD4 according to claim 1, characterized in that, The 18S rDNA sequence of the ciliate GsD4 is shown in SEQ ID No.

1.

3. The use of the ciliate GsD4 as described in claim 1 or 2 in inhibiting Plasmodiophora brassicae.

4. The use of the ciliate GsD4 as described in claim 1 or 2 in the prevention and control of clubroot disease in rapeseed caused by Plasmodiophora brassicae or in the preparation of a formulation for the prevention and control of clubroot disease in rapeseed caused by Plasmodiophora brassicae.

5. A culture, characterized in that, Contains the ciliate GsD4 as described in claim 1 or 2.

6. A method for preparing the culture according to claim 5, characterized in that, The PAS buffer was prepared by the following method: The ciliate GsD4 described in claim 1 was inoculated into PAS buffer containing inactivated Escherichia coli and cultured in the dark at 20-28 ℃ for 1-5 days. The PAS buffer was prepared as follows: Solution 1 and Solution 2 were prepared. Solution 1 consisted of 0.142 g disodium hydrogen phosphate (Na2HPO4) and 0.136 g potassium dihydrogen phosphate (KH2PO4), and water was added to a final volume of 500 mL. Solution 2 consisted of 0.12 g sodium chloride, 4 mg magnesium sulfate heptahydrate, and 4 mg calcium chloride dihydrate, and water was added to a final volume of 500 mL. 1 L of PAS buffer was prepared by mixing 500 mL of Solution 1 and 500 mL of Solution 2 and adding water to a final volume of 1 L, followed by sterilization at 121 ℃ for 20 min.

7. The culture according to claim 5, characterized in that, The culture was a 96-well plate culture system, and the concentration of ciliate GsD4 in each well was 10. 4 One hole / hole.

8. The use of the culture according to claim 5 or 7 in inhibiting Plasmodiophora brassicae.

9. The use of the culture according to claim 5 or 7 in the prevention and control of clubroot disease in rapeseed caused by Plasmodiophora brassicae or in the preparation of a formulation for the prevention and control of clubroot disease in rapeseed caused by Plasmodiophora brassicae.

10. A method for controlling clubroot disease in rapeseed, characterized in that, The culture prepared by the method described in claim 6 was applied to the rhizosphere of rapeseed seedlings that had grown to 2 weeks of age at a temperature of 20-28℃. The amount of culture applied was 5 mL / plant, and the concentration of ciliate GsD4 in the culture was 1500 cells / mL.

Citation Information

Patent Citations

  • Bacillus amyloliquefaciens for inhibiting bird rape plasmodiophora brassicae and separation and application of active substances thereof

    CN102382781A