Microchaete sp. xy7 with functions of synergic enrichment of organic selenium, nano-selenium and carotenoids and application thereof

Abstract

The present application belongs to the field of microbial technology, and particularly relates to a microgonidium XY7 with the functions of synergistically enriching organic selenium, nano selenium and carotenoids and application thereof. The microgonidium XY7 has been preserved in China Center for Type Culture Collection (CCTCC) with a preservation number of CCTCC NO:M 20252714 and a preservation date of November 27, 2025. The present application provides a novel high-selenium-tolerant microalgae strain microgonidium XY7, which has a tolerance concentration of 2000 mg·L ‑1 to inorganic selenium ions. The microgonidium XY7 can grow and reproduce normally in a culture medium with a high selenium concentration, without the need for dilution treatment of high-selenium raw materials or selenium-containing wastewater, thereby greatly reducing the raw material cost and pretreatment cost of selenium-enriched microalgae culture, and also providing an excellent germplasm resource for the bioremediation of high-selenium contaminated water bodies and soil.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a microalgae XY7 with the function of synergistic enrichment of organic selenium, nano-selenium and carotenoids and its application. Background Technology

[0002] Plant health, animal health, and human health are the three cornerstones of building a sustainable society. These three are interconnected and mutually supportive, forming the core of the "One Health" concept. In recent years, the overuse of chemical pesticides, veterinary drugs, and pharmaceuticals has become a prominent global problem, posing a serious challenge to the ecological environment and food safety. Research shows that inorganic selenium can effectively inhibit pests and diseases in vitro, possessing the potential to replace chemical pesticides, veterinary drugs, and pharmaceuticals. After plants and animals absorb inorganic selenium, it can be biotransformed into organic selenium, achieving "dual origin of medicine and fertilizer, medicine and feed, and medicine and food," thereby synergistically promoting the health of plants, animals, and humans. Therefore, the application of selenium in agriculture, animal husbandry, and aquaculture is receiving increasing attention. However, humans and higher animals primarily require selenoproteins (-2 valence selenium). How to efficiently convert inorganic selenium from +6 or +4 valence to 0 and -2 valence has become a key scientific issue for the selenium-enriched industry.

[0003] Selenium is an essential trace element for maintaining cellular redox homeostasis, regulating immune responses, and signal transduction. It participates in various physiological processes through incorporation into selenoproteins (such as glutathione peroxidase and thioredoxin reductase), and is crucial for the function of immune cells such as macrophages, natural killer cells, neutrophils, and T lymphocytes. The World Health Organization recommends a daily selenium intake of 50–200 μg for healthy adults; insufficient intake can lead to endemic diseases such as Keshan disease and Kashin-Beck disease. Carotenoids, as natural antioxidants, have a core function of scavenging free radicals. β-carotene can be converted into vitamin A, participating in the visual cycle, while lutein and zeaxanthin selectively accumulate in the macular region of the retina to form a photoprotective barrier. They also show broad application prospects in cardiovascular protection, cognitive improvement, immune enhancement, and cancer prevention. In plant health, adequate selenium can promote photosynthesis, activate antioxidant defense mechanisms, and enhance tolerance to biotic and abiotic stresses. Nano-selenium fertilizers can synergistically improve crop yield and selenium content through multiple mechanisms. Carotenoids, as core substances of photosynthesis, also play a crucial role in improving crop nutritional quality through the regulation of their synthesis pathways. In animal health, nano-selenium, as a feed additive, can enhance antioxidant capacity, immune function, and growth performance. It can also increase selenium deposition in meat and egg products through biofortification. Carotenoids, on the other hand, significantly affect pigment deposition and appearance quality in aquaculture, while simultaneously enhancing immunity and disease resistance. Therefore, developing novel biomaterials with both selenium and carotenoid functions is of great significance for promoting the high-quality development of the selenium-enriched industry.

[0004] Nano-selenium has attracted much attention in disease treatment, nutritional supplementation, and agricultural applications due to its unique bioactivity, good biocompatibility, and engineering potential. Compared with traditional organic and inorganic selenium, nano-selenium has lower toxicity and higher bioavailability, especially bio-derived nano-selenium, which has unique advantages in regulating redox and immune responses. Currently, the synthesis methods of nano-selenium are mainly divided into chemical, physical, and biological methods. Chemical methods are simple to operate and have high yields, but often involve toxic reagents and harsh conditions, posing environmental and biosafety risks. Physical methods can produce high-purity nano-selenium, but require large equipment investment and consume a lot of energy, limiting large-scale applications. Biological methods utilize microorganisms (bacteria, fungi, yeast, and microalgae, etc.) or plant extracts to reduce selenium salts to produce nano-selenium, which has advantages such as environmental friendliness, low cost, and high biocompatibility. However, current biological methods generally suffer from low synthesis efficiency, uneven product particle size distribution, and unclear synthesis mechanisms, which restrict their industrial application.

[0005] Microalgae, as green cellular factories, possess unique advantages in the biosynthesis of nano-selenium. Microalgae can convert toxic inorganic selenium (selenite / selenate) into less toxic and more active zero-valent nano-selenium through enzymatic reduction. Their abundant proteins and polysaccharides act as natural stabilizers, endowing nano-selenium with excellent dispersion stability. Spirulina, Chlorella, and other microalgae have been proven to possess the ability to synthesize nano-selenium. However, current research still has many shortcomings: most algal strains have poor selenium tolerance, low nano-selenium synthesis efficiency, and a lack of superior algal strains that can simultaneously and efficiently enrich selenium with multiple high-value products such as carotenoids, achieving synergistic effects. Of particular concern is how to achieve the efficient conversion of inorganic selenium to nano-selenium (0-valent) and organic selenium (-2-valent), and construct a diversified selenium source supply system, starting from the key scientific issues of the selenium-enriched industry. This is the core of current technological breakthroughs. If microalgae strains with both nano-selenium and carotenoid high-efficiency enrichment capabilities can be obtained under selenium-enriched stress, then "one algae, two benefits" can be achieved, synergistically exerting the immunomodulatory function of selenium and the antioxidant function of carotenoids. However, such strains are rarely systematically reported at present.

[0006] To address the aforementioned technical problems, this invention isolates and screens a microalgae strain with synergistic enrichment functions of organic selenium, nano-selenium, and carotenoids from the natural environment. Micractinium simplicissimum XY7. This algal strain can grow efficiently in selenium-containing culture media, converting inorganic selenium into organic selenium and nano-selenium while accumulating large amounts of carotenoids, achieving dual high-value enrichment of selenium and carotenoids. This invention provides a novel microbial resource for the green biomanufacturing of nano-selenium and natural carotenoids, and has broad application prospects in functional foods, feed additives, biofertilizers, and medicine. Summary of the Invention

[0007] This invention belongs to the field of microbial technology, specifically relating to a microalgae XY7 with the function of synergistic enrichment of organic selenium, nano-selenium and carotenoids and its application.

[0008] To address the aforementioned technical problems, one of the objectives of this invention is to provide a microalgae ( Micractinium simplicissimum XY7, a type of microalgae, has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCCNO: M 20252714 and deposit date of November 27, 2025.

[0009] One of the objectives of this invention is to provide the aforementioned microalgae ( Micractinium simplicissimum Application of XY7 in the conversion of inorganic selenium into nano-selenium and organic selenium.

[0010] According to a preferred embodiment, the concentration of selenium ions in the inorganic selenium-rich strain is not higher than 2000 mg·L⁻¹. -1 Preferably, the concentration of selenium ions in the inorganic selenium-rich strain does not exceed 1000 mg·L⁻¹. -1 .

[0011] In this application, sodium selenite was used as a representative example of inorganic selenium enrichment. Therefore, selenite can be considered a substance that *Micromeria xylophora* XY7 can enrich. *Micromeria xylophora* XY7 can enrich selenium at concentrations ranging from 0 to 2000 mg·L⁻¹. -1 Inorganic selenium was enriched and converted into nano-selenium in sodium selenite solution. Microsporidium XY7 can be enriched in sodium selenite solution from 5–2000 mg·L⁻¹. -1 Inorganic selenium is enriched and converted into nano-selenium in a sodium selenite solution. Preferably, the microalgae XY7 is tolerant to 5 mg·L⁻¹. -1 Sodium selenite concentration. Micrococcus XY7 tolerates 50 mg·L⁻¹. -1 Sodium selenite concentration. Micrococcus XY7 tolerates 200 mg·L⁻¹. -1 Sodium selenite concentration. Micrococcus XY7 tolerates 500 mg / L. -1 Sodium selenite concentration. Micrococcus XY7 tolerates 2000 mg / L. -1 Sodium selenite concentration.

[0012] Based on molecular weight ratio, sodium selenite has a relative molecular weight of 172.95, and selenium has a relative molecular weight of 78.96. Therefore, 5 mg·L⁻¹ -1 The sodium selenite concentration corresponds to 2.28 mg·L⁻¹. -1 Selenium ion concentration: 50 mg·L⁻¹ -1 The sodium selenite concentration corresponds to 22.8 mg·L⁻¹. -1 Selenium ion concentration: 200 mg·L⁻¹ -1 The sodium selenite concentration corresponds to 91.3 mg·L⁻¹.-1 Selenium ion concentration: 500 mg / L -1 The sodium selenite concentration corresponds to 228 mg·L -1 Selenium ion concentration: 2000 mg·L⁻¹ -1 The sodium selenite concentration corresponds to 913 mg·L -1 Selenium ion concentration. Therefore, *Microcystis aeruginosa* XY7 can be observed at selenium ion concentrations ranging from 0 to 913 mg·L⁻¹. -1 Inorganic selenium is enriched and converted into nano-selenium in sodium selenite solution. Preferably, the microalgae XY7 can be enriched and converted into nano-selenium at a selenium ion concentration of 2.28–913 mg·L⁻¹. -1 Inorganic selenium is enriched and converted into nano-selenium in sodium selenite solution.

[0013] According to a preferred embodiment, the selenium enrichment rate of the strain is greater than 75%. More preferably, the selenium enrichment rate of the strain is 94–99%. Preferably, the selenium enrichment rate of the strain is 75%. The selenium enrichment rate of the strain is 99%. The selenium enrichment rate of the strain is 94%.

[0014] One of the objectives of this invention is to provide the aforementioned microalgae ( Micractinium simplicissimum Application of XY7 in the conversion of inorganic selenium into nano-selenium and organic selenium products.

[0015] According to a preferred embodiment, the product includes selenium-enriched bacterial powder and selenium-enriched bacterial agent. The selenium-enriched bacterial agent has a selenium ion concentration range of not exceeding 1000 mg·L⁻¹. -1 Micrococcus XY7 was cultivated in an inorganic selenium solution, and the algae were collected. Collection methods included, for example, high-speed centrifugation or filtration through a 5 μm membrane. The selenium-enriched bacterial powder contained dried selenium-enriched bacterial agent.

[0016] One of the objectives of this invention is to provide a method for enriching inorganic selenium and converting it into organic selenium, characterized by comprising the following steps: The setting is for a selenium ion concentration range not exceeding 1000 mg·L⁻¹ -1 The aforementioned microalgae XY7 was added to the inorganic selenium solution.

[0017] According to a preferred embodiment, the organic selenium comprises selenomethionine, selenocysteine, and methylselenocysteine.

[0018] One of the objectives of this invention is to provide the aforementioned microalgae ( Micractinium simplicissimum Application of XY7 in the conversion of carotenoids under inorganic selenium environment.

[0019] According to a preferred embodiment, the carotenoid is a primary carotenoid. Preferably, the primary carotenoid is β-carotene, zeaxanthin, or lutein.

[0020] One of the objectives of this invention is to provide a method for converting carotenoids under an inorganic selenium environment, comprising the following steps: Under light conditions, a setting with a selenium ion concentration not exceeding 1000 mg·L⁻¹ is provided. -1 The aforementioned microalgae XY7 was added to the inorganic selenium solution.

[0021] According to a preferred embodiment, the illumination conditions are 0–100 µmol·m⁻¹ -2 ·s -1 It should be noted that 0–100 µmol·m -2 ·s -1 This range represents the suitable light intensity range for the large-scale artificial cultivation, laboratory preservation, and routine expansion of *Micromistonia*, and is considered the optimal light condition for the routine cultivation of this algal strain. Under this light range, *Micromistonia* exhibits stable photosynthetic efficiency and a moderate cell proliferation rate, making it a commonly used light parameter for routine preservation, subculturing, and basic culture.

[0022] According to a preferred embodiment, the inorganic selenium removal rate is not less than 75%.

[0023] One of the objectives of this invention is to provide a method for identifying Microspora XY7, which includes the following steps: The tufA gene, 18S rRNA gene, or RbcL gene of the microalgae were amplified and compared. When the microalgae was *Micromistonia* and the gene sequence was as shown in SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3, it was identified as *Micromistonia* XY7.

[0024] According to a preferred embodiment, the identification method further includes sequence identification using the following primer pair: Sequence pairs such as SEQ ID No. 4 and SEQ ID No. 5; Sequence pairs such as SEQ ID No. 6, SEQ ID No. 7; or Sequence pairs such as SEQ ID No. 8 and SEQ ID No. 9.

[0025] According to a preferred embodiment, the microalgae are identified as Micromistulae based on morphology. The morphology is as follows: the cells are spherical or nearly spherical, with a diameter of 2–5 μm, and have the typical structural characteristics of the Micromistulae genus in the class Chlorophyta.

[0026] One of the objectives of this invention is to provide applications of Micrococcus XY7 in wastewater treatment, soil remediation, functional aquatic feed additives, and health foods.

[0027] The beneficial effects of this technical solution are: 1. This invention provides a novel high-selenium-tolerant microalgae strain, *Microhymenopterus xY7*, which can tolerate inorganic selenium ions at concentrations up to 2000 mg·L⁻¹. -1 Microalgae XY7 can grow and reproduce normally in high-selenium culture media without the need for dilution of high-selenium raw materials or selenium-containing wastewater, which greatly reduces the raw material cost and pretreatment cost of selenium-enriched microalgae cultivation. At the same time, it provides excellent germplasm resources for the bioremediation of high-selenium polluted water and soil.

[0028] 2. The microalgae XY7 of this invention has extremely high inorganic selenium bioconversion efficiency, with a conversion efficiency of not less than 75% and up to 99%. This not only significantly improves the selenium content and quality of selenium-enriched microalgae products, but also greatly reduces the residual inorganic selenium in the culture system, reducing the environmental risks and processing costs in the subsequent separation and purification process, while also improving the comprehensive utilization rate of selenium resources.

[0029] 3. The microalgae XY7 of this invention possesses unique selenium-enriched environment-responsive characteristics, enabling it to simultaneously and efficiently synthesize and accumulate carotenoids under selenium-enriched cultivation conditions. This characteristic achieves the simultaneous enrichment of two high-value-added bioactive substances, organic selenium and carotenoids, breaking through the technical limitations of existing selenium-enriched microalgae that only enrich selenium. Organic selenium and carotenoids have significant synergistic effects in antioxidation, enhancing immunity, protecting vision, and preventing cardiovascular diseases, resulting in selenium-enriched carotenoid microalgae products produced by this invention with higher nutritional value and health benefits, significantly improving the overall economic value of microalgae.

[0030] 4. The microalgae XY7 strain of this invention has simple cultivation conditions, rapid growth rate, and high biomass yield, making it suitable for large-scale industrial cultivation. Using this strain to produce selenium-enriched carotenoid microalgae products offers a simple process route, convenient operation, low production cost, and high added value, demonstrating promising prospects for industrial application. Furthermore, the application of this strain opens up new avenues for the green, efficient, and high-value utilization of selenium resources, yielding significant economic, social, and environmental benefits.

[0031] In summary, the microalgae XY7 can grow and reproduce normally in high-selenium culture media without the need for dilution of high-selenium raw materials or selenium-containing wastewater, which significantly reduces the raw material and pretreatment costs of selenium-enriched microalgae cultivation. At the same time, it provides excellent germplasm resources for the bioremediation of high-selenium polluted water bodies and soils. Attached Figure Description

[0032] Figure 1The figures show the morphological and molecular biological identification results of the algal strain in Example 3; where A shows a schematic diagram of the overall and local morphology of the algal strain cells, B shows a neighbor-joining tree constructed based on the tufA gene sequence of the algal strain, C shows a neighbor-joining tree constructed based on the 18S rRNA gene sequence of the algal strain, and D shows a neighbor-joining tree constructed based on the RbcL gene sequence of the algal strain. Figure 2 The figures show the macroscopic phenotype and cell activity results of Microsporum XY7 under different concentrations of sodium selenite treatment in Example 4; where A shows the change process of the macroscopic phenotype of XY7, and B shows the change process of algal cell activity. Figure 3 The OD values ​​of Microsporum XY7 in Example 4 under different concentrations of sodium selenite treatment. 680 And pH change graph; where A shows the OD of XY7. 680 Changes, B shows the pH changes of XY7; Figure 4 The graph shows the photosynthetic efficiency of *Micromistella xylinum* XY7 under different concentrations of sodium selenite treatment in Example 5; where A shows the changes in chlorophyll fluorescence in *Micromistella xylinum* XY7 cells, and B shows the maximum photochemical quantum yield of photosystem II in *Micromistella xylinum* XY7 cells. F v / F The change in m, C shows the actual photochemical quantum yield of the photosystem II in the XY7 cell of *Microcera microphylla*. Y (II) shows the change in the non-photochemical quenching coefficient NPQ of Micromistletoe XY7 cells, and E shows the change in the photochemical quenching coefficient qP of Micromistletoe XY7 cells. Figure 5 This is a graph showing the results of the carotenoid metabolic pathway and content of Micrococcus XY7 under different concentrations of sodium selenite treatment in Example 6; Figure 6 This is a high-performance liquid chromatography (HPLC) result of the detection of carotenoids in *Microcera xylinum* XY7 under different concentrations of sodium selenite treatment in Example 6; where A shows 0 mg·L⁻¹. -1 The high-performance liquid chromatography peak chromatogram of sodium selenite treatment, B shows 5 mg·L⁻¹. -1 The high-performance liquid chromatography peak chromatogram of sodium selenite treatment, C indicates 50 mg·L⁻¹. -1 The high-performance liquid chromatography peak chromatogram of sodium selenite treated with D shows 200 mg·L⁻¹. -1 The high-performance liquid chromatography peak chromatogram of sodium selenite treatment, E indicates 500 mg·L⁻¹ -1 The high-performance liquid chromatography peak chromatogram of sodium selenite treatment, F indicates 2000 mg·L⁻¹. -1 High-performance liquid chromatography peak chromatogram of sodium selenite treated with sodium selenite; peaks numbered 1–4 represent the metabolites of zeaxanthin, lutein, β-cryptoxanthin and β-carotene, respectively. Figure 7 The following are standard curves (high performance liquid chromatography) of different carotenoids in Example 6; where A shows the standard curve of zeaxanthin, B shows the standard curve of lutein, C shows the standard curve of β-cryptoxanthin, and D shows the standard curve of β-carotene. Figure 8 The figure shows the results of selenium content in *Micromeria XY7* under different sodium selenite concentrations in Example 7. A shows the phenotype of *Micromeria XY7* collected by centrifugation under different sodium selenite concentrations; B shows the residual sodium selenite in the effluent and the amount of sodium selenite absorbed by *Micromeria XY7* after treatment with different sodium selenite concentrations; C shows the content of organic selenium, inorganic selenium, and total selenium, and the proportion of organic selenium; D shows the content of different forms of selenoamino acids in organic selenium. Figure 9 This is an ICP-MS peak diagram of different forms of organic selenium in *Microcera xylinum* XY7 under different concentrations of sodium selenite treatment in Example 7; where A shows 0 mg·L⁻¹. -1 ICP-MS peak chromatogram of sodium selenite treated with sodium selenite, B shows 5 mg·L -1 ICP-MS peak chromatogram of sodium selenite treatment, C shows 50 mg·L -1 ICP-MS peak chromatogram of sodium selenite treated with 200 mg·L⁻¹, D shows the peak chromatogram of sodium selenite treated with 200 mg·L⁻¹. -1 ICP-MS peak chromatogram of sodium selenite treated with 500 mg·L⁻¹, E shows the peak chromatogram of sodium selenite treated with 500 mg·L⁻¹. -1 ICP-MS peak chromatogram of sodium selenite treated with sodium selenite, F shows 2000 mg·L -1 ICP-MS peak diagram of sodium selenite treatment; numbered 1–5 represent the metabolite peaks of selenate, selenite, selenocysteine, methylselenocysteine ​​and selenomethionine, respectively. Figure 10 The following are standard curves (ICP-MS method) of different forms of organic selenium in Example 7; wherein, A shows the standard curve of selenate Se(IV), B shows the standard curve of selenite Se(VI), C shows the standard curve of selenocysteine ​​SeCys2, D shows the standard curve of methylselenocysteine ​​MeSeCys, and E shows the standard curve of selenomethionine SeMet. Figure 11 For example, the microalgae XY7 in Example 8 at 0 and 200 mg·L -1 The enrichment results of nano-selenium under sodium selenite treatment are shown in the figure. A shows the process flow diagram for the extraction and characterization of nano-selenium from microalgae; B shows a transmission electron microscope image of *Mimosa pudica* XY7 without sodium selenite treatment; C shows the enrichment of *Mimosa pudica* XY7 at 200 mg·L⁻¹. -1Transmission electron micrograph of *Microcera xylophila* XY7 treated with sodium selenite at 200 mg·L⁻¹. -1 Analysis diagram of nano-selenium present in intracellular, extracellular, intracellular and extracellular regions under sodium selenite treatment. E shows the elemental content analysis corresponding to Figure D. Figure 12 For example, the microalgae XY7 in Example 8 at 200 and 2000 mg·L⁻¹ -1 The characterization results of purified nano-selenium after treatment with sodium selenite are shown in Figure A; where A shows the concentration of *Microcystis aeruginosa* XY7 at 200 mg·L⁻¹. -1 Transmission electron microscopy (TEM) results, particle size distribution results, and Fourier transform infrared (FTIR) spectroscopy results of purified nano-selenium after sodium selenite treatment. Figure B shows the nano-selenium XY7 at 2000 mg·L⁻¹. -1 Transmission electron microscopy (TEM) results, particle size distribution results, and Fourier transform infrared spectroscopy results of purified nano-selenium after treatment with sodium selenite.

[0033] Figure 13 For example, the microalgae XY7 in Example 8 at 200 and 2000 mg·L⁻¹ -1 Scanning electron microscopy (SEM) images and energy dispersive spectroscopy (EDS) elemental analysis diagrams of purified nano-selenium after treatment with sodium selenite; A shows the concentration of *Microcystis aeruginosa* XY7 at 200 mg·L⁻¹. -1 and 2000 mg·L -1 Scanning electron microscopy (SEM) results and energy dispersive spectroscopy (EDS) elemental analysis of purified nano-selenium after treatment with sodium selenite. Figure B shows the elemental analysis corresponding to Figure A. Detailed Implementation

[0034] In the description of this invention, terminology is used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. In the description of this invention, "a plurality of" means two or more, unless otherwise explicitly defined.

[0035] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials, reagents or instruments used, unless otherwise specified by the manufacturer, are all commercially available reagents and materials; the conditions not specified in the examples are all carried out according to conventional conditions or conditions recommended by the manufacturer. At the same time, the present invention does not limit the source of the raw materials used. Unless otherwise specified, the raw materials used in the present invention are all commercially available products in this technical field.

[0036] Unless the context otherwise requires, throughout the specification and claims, the term "comprising" is interpreted as open and encompassing, that is, "including, but not limited to".

[0037] In describing some embodiments, the expression "A and / or B" may be used. It is readily understood that "A and / or B" includes the following three combinations: A only, B only, and a combination of A and B.

[0038] In describing some embodiments, the expressions "at least one of A, B and C" and "at least one of A, B or C" may be used, both of which have the same meaning and include the following combinations of A, B and C: only A, only B, only C, a combination of A and B, a combination of A and C, a combination of B and C, and a combination of A, B and C.

[0039] The culture medium involved in the following examples includes BG11 medium.

[0040] BG11 medium has the following formula: sodium nitrate 1.4–1.6 g·L⁻¹ -1 , K2HPO4·3H2O 0.03–0.05 g·L -1 , MgSO4·7H2O 0.065–0.085 g·L -1 , CaCl2·2H2O 0.026–0.046 g·L -1 Citric acid 0.005–0.007 g·L -1 Ferric ammonium citrate 0.005–0.007 g·L -1 EDTA 0.0005–0.0015 g·L -1 Sodium carbonate 0.015–0.025 g·L -1 Boric acid 0.0027–0.0029 g·L -1 , MnCl2·H2O 0.0017–0.0019 g·L -1 , ZnSO4·7H2O0.00021–0.00023 g·L -1 , CuSO4·5H2O 0.00007–0.00009 g·L -1 , Na2MoO4·2H2O 0.0003–0.0005 g·L -1 And Co(NO3)2·6H2O 0.00004–0.00006 g·L -1 The pH value is 6.8–7.2.

[0041] The microalgae involved in this invention are *Micromistella* species independently isolated in our laboratory. Micractinium simplicissimumRXZ-XY7, its accession information is as follows: deposited on November 27, 2025 at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China, with accession number CCTCC NO: M 20252714.

[0042] It should be noted that selenium nanoparticles (i.e., nano-selenium) are nanoparticles of elemental selenium or selenides existing in the form of nanoscale particles. Organoselenoselenium, on the other hand, is a compound formed by the combination of selenium with organic molecules (such as amino acids and proteins), specifically selenium compounds bound to organic groups (such as methyl and ethyl groups). Compared to organoselenoselenium, the preparation cost of selenium nanoparticles is higher. It can be said that not all algae capable of converting organoselenoselenium can generate selenium nanoparticles, and vice versa. The conversion of microalgae into organoselenoselenium and the synthesis of selenium nanoparticles belong to two independent metabolic pathways, with significant differences in the required enzyme systems and physiological functions. Organoselenoselenium synthesis relies on the selenium assimilation pathway, using related synthetic enzymes to integrate selenium into amino acids and proteins, which is a routine nutritional metabolic process. Selenium nanoparticle generation, however, requires a specific reductase to reduce selenium to its zero valence state, followed by particle assembly with the help of intracellular active substances; this is a specialized mechanism by which algae cope with selenium stress. These two capabilities are regulated by different genes and metabolic networks and are not necessarily related; possessing one conversion capability does not necessarily mean possessing the other function simultaneously.

[0043] Example 1 Culture medium 1. BG11 medium, its composition is: NaNO3 1.500 g·L -1 0.030 g·L⁻¹ K₂HPO₄ -1 MgSO4·7H2O 0.075 g·L -1 0.020 g·L⁻¹ Na₂CO₃ -1 Citric acid 0.006 g·L -1 CaCl2·2H2O 0.036 g·L -1 Ferric ammonium citrate 0.006 g·L -1 EDTA·2Na 0.001 g·L -1 1 mL of trace elements; The composition of trace elements is: H3BO3 2.860 g·L -1 MnCl2·4H2O 1.810 g·L -1 ZnSO4·7H2O 0.222 g·L -1 Na₂MoO₄·2H₂O 0.390 g·L⁻¹ -1CuSO4·5H2O 0.079 g·L -1 Co(NO3)2·6H2O 0.049 g·L -1 .

[0044] 2. BG11 liquid culture medium, the composition of which is: ddH2O 1 L, BG-11 medium 1.7 g, anhydrous sodium acetate 1.5 g.

[0045] 3. BG11 solid plates, composed of: 1 L ddH2O, 1.7 g BG-11 medium, 1.5 g anhydrous sodium acetate, and 15 g agar.

[0046] Example 2: Collection, isolation, culture, and purification of algal strains 1. Collection of algal strains Water samples were collected on October 6, 2023, from No. 128 Shangling Road, Xunyang City, Ankang City, Shaanxi Province (109°22′34.32″E, 32°50′1.96″N) using a phytoplankton net with a pore size of 64 μm (200 mesh).

[0047] 2. Algal Strain Activation Transfer the collected water sample to a 15 mL centrifuge tube and let it stand for 1–2 h. Gently remove most of the supernatant, retaining 2–3 mL of liquid at the bottom. Mix thoroughly and then incubate on a shaker for 6 h at a temperature of 25±1℃ and a rotation speed of 100–180 rpm to fully activate the sample.

[0048] 3. Isolation and culture of algal strains 10 μL of the activated sample was aspirated and dropped onto a glass slide. After confirming the presence of suspected target algal cells under a microscope, a single cell was picked up under the microscope using a capillary siphon method. This process of aspiration, microscopic examination, and dilution was repeated until only a single target algal cell was contained in the droplet. The sample was then transferred to a 96-well plate containing 100 μL of BG11 liquid medium (antibiotic-free) and incubated statically at a light / dark cycle of 12 h / 12 ​​h and a light intensity of 20–30 µmol·m⁻². -2 ·s -1 The culture temperature is 25±1℃. During the static culture period, BG11 liquid culture medium is added to about 100 μL as needed.

[0049] 4. Purification of algal strains After static culture of a single target algal cell for 20–30 days, the growth of the algal species was examined under a microscope. If the algal cells grew well, they were serially diluted to 10-1. 0 10 -1 10 -2 and 10 -3The concentrations were thoroughly mixed, and 200 μL of each gradient dilution was applied to a solution containing 50 mg / L ampicillin (Amp). 50+ ), 50 mg / L kanamycin (Kan 50+ ) and 100 mg / L cephalosporin (Cef 100+ Place the plates on BG-11 solid plates and invert them in a constant temperature and light incubator. The light-dark cycle is 12 h / 12 ​​h, and the light intensity is 10–30 µmol·m⁻¹. -2 ·s -1 The culture temperature was 23±1℃, and the plates were inverted for 7–15 days until single algal colonies appeared. The growth of single algal colonies and other microorganisms on the plates was then observed. If obvious microorganisms were present on the plates, single algal colonies were transferred to 200 μL of BG-11 liquid medium (containing Amp) 100+ Kan 50+ Cef 100+ Mix thoroughly by suction and whisk, then dilute in a gradient to 10⁻⁶. -1 and 10 -2 The concentration was thoroughly mixed and recoated onto a BG-11 solid plate (which also contains Amp). 100+ Kan 50+ Cef 100+ The algae were cultured on a plate. The algal strain was purified through multiple platings until no obvious contaminating bacteria were observed on either the plate or individual algal colonies. Then, individual algal colonies were transferred to BG11 liquid medium (containing Amp...). 25+ Cef 50+ The culture was carried out by inoculation at a ratio of 1:10 and scaled up stepwise. The culture temperature was 25±1℃, the rotation speed was 150–180 rpm, the light / dark cycle was 12h / 12h, and the light intensity was 30–50 µmol·m⁻¹. -2 ·s -1 This process yields algal solutions from the algal strain, thus storing algal cells for subsequent steps.

[0050] Example 3: Identification and Preservation of Algal Strains 1. Morphological observation of algal strains First, algal solutions from algal strains at different growth stages were collected, and 10 μL was dropped onto a clean glass slide. The slide was then placed on the stage of an inverted microscope (Axio Observer 7, ZEISS, Germany). The morphological characteristics of the algal cells were carefully observed at an appropriate magnification, and the cells were imaged in real time using the microscope's accompanying image acquisition device, ZEN 3.2 software (ZEISS, Germany).

[0051] The submicroscopic structure of microalgal cells was observed using a transmission electron microscope (JEM-1400-FLASH, JEOL, Tokyo, Japan). Cells were pre-fixed with 3% glutaraldehyde and then post-fixed with 1% osmium tetroxide. Subsequently, samples were dehydrated stepwise with gradient concentrations of acetone solutions (30%, 50%, 70%, 80%, 90%, 95%, 100%), and then infiltrated with different ratios (3:1, 1:1, 1:3) of dehydrating agent mixed with Epon-812 epoxy resin. Finally, the samples were embedded in pure Epon-812 resin. Ultrathin sections of 60–90 nm thickness were prepared using a diamond scalpel and mounted on a copper grid. Sections were stained with uranium acetate for 10–15 min, followed by lead citrate staining at room temperature for 1–2 min, and observed under a transmission electron microscope. Typical characteristics are as follows: Figure 1 As shown in Figure A, the cells are spherical or nearly spherical, approximately 2–5 μm in diameter, exhibiting typical structural features of the genus *Micromistella* in the class Chlorophyta. The nucleus is located centrally or near centrally, approximately 1 μm in diameter. The chloroplasts are pericentric, cup-shaped, occupying most of the cell volume (approximately 3 / 4), with their thylakoids arranged closely together. Each chloroplast contains a typical pyrenoid, approximately 1 μm long and 0.75 μm wide, surrounded by four layers of starch sheaths. Multiple lipid droplets and vacuoles are distributed around the periphery of the chloroplasts and in the region between the cell membrane and the thylakoids. Furthermore, organelles such as mitochondria and endoplasmic reticulum can be observed in the cytoplasm. The outermost layer of the cell is enclosed by a smooth and clearly defined cell wall.

[0052] 2. Molecular identification of algal strains The purified algal strains were centrifuged at 5000 rpm for 5 min to collect the algal cells. The cells were repeatedly resuspended in PBS buffer to remove the liquid culture medium, and then collected for further molecular identification. Microalgal genomic DNA was extracted using a polysaccharide-polyphenol plant genomic DNA extraction kit (Tiangen Biotech, Beijing, China), following the manufacturer's instructions. The extracted DNA samples were then amplified by PCR using Q5 high-fidelity polymerase (New England Biolabs, Ipswich, Massachusetts, USA).

[0053] The 50 μL PCR reaction system consisted of: 2 μL of algal genomic DNA, 10 μL of 5×Q5® Reaction Buffer, 4 μL of 2.5 mM dNTP, 2.5 μL each of 10 μM forward and reverse primers, 0.5 μL of Q5® High-Fidelity DNA Polymerase, and 28.5 μL of ddH2O.

[0054] The translation elongation factor Tu (tufA), the ribulose-1,5-bisphosphate carboxylase / oxygenase large subunit gene (rbcL), and the 18S ribosomal RNA gene (18S rRNA) were identified by PCR. The reaction conditions were as follows: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, for 35 cycles; and 72℃ extension for 2 min.

[0055] Among them, there are three pairs of primers for molecular identification, namely: 1) Amplify the tufA region using upstream primer 5'-TGAAACAGAAMAWCGTCATTATGC-3' (SEQ ID No. 4) and downstream primer 5'-CCTTCNCGAATMGCRAAWCGC-3' (SEQ ID No. 5); 2) Amplify the 18S rRNA region using the upstream primer 5'-GCGGAGGGATCATTGAATCTATC-3' (SEQ ID No. 6) and the downstream primer 5'-AGTACATGGGGTAGGGGCCTGTTT-3' (SEQ ID No. 7); 3) Amplify the RbcL region using the upstream primer 5'-ATGGATGGTGCTATTYTMGTRG-3' (SEQ ID No. 8) and the downstream primer 5'-TTCGATCTCCAGGCTAKACC-3' (SEQ ID No. 9).

[0056] The products obtained from PCR amplification of the tufA, 18S rRNA, and RbcL regions were recovered and purified using a Takara gel extraction kit and sent to the Chengdu branch of Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were submitted to the National Center for Biotechnology Information (NCBI) database for Nucleotide BLSAT sequence alignment. The joint neighbor-joining phylogenetic trees of the tufA, 18S rRNA, and RbcL gene sequences of this algal strain are shown below. Figure 1As shown in BD. The gene sequences of tufA, 18S rRNA, and RbcL of this algal strain are shown in SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3, respectively. The NCBI accession numbers of the gene sequences of tufA, 18S rRNA, and RbcL of this algal strain are PZ347771, PZ324787, and PZ347772, respectively.

[0057] Analysis showed that this algal strain was related to Micromistletoe ( Micractinium simplicissimum They belong to the same evolutionary branch.

[0058] 3. Preservation of algal strains Based on the combined results of morphological observation and molecular identification, the algal strain obtained in this embodiment is *Micromistella*. Micractinium simplicissimum The algal strain was named Micromianthus (Micromianthus spp.) Micractinium simplicissimum XY7 was deposited on November 27, 2025, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China, with accession number CCTCC NO: M 20252714.

[0059] Example 4: Effects of different concentrations of sodium selenite treatment on the growth kinetics and cell viability of Micrococcus XY7. 1. Experimental Methods 1.1 Experimental Treatment Scheme Algal strain XY7 was cultured in BG11 liquid medium (Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd., Shandong, China) for 3 days to the logarithmic growth phase, and then subjected to 1,246 × 10⁻⁶ molten silicate. g Centrifuge at 4 °C for 5 min, remove the supernatant, transfer the algae to fresh BG11 liquid medium, and measure the OD using a full-wavelength scanning multi-function reader (Spark, TECAN, Männedorf, Switzerland). 680 The initial algal density was adjusted to 0.5. Then, 50 mL of the algal solution was dispensed into 100 mL Erlenmeyer flasks for selenium treatment experiments.

[0060] The experiment was conducted with sodium selenite concentrations of 0, 5, 50, 200, 500, and 2000 mg·L⁻¹. -1 Each concentration was replicated in triplicate. The conical flasks were incubated in a shaker with the following parameters: temperature 25℃, rotation speed 0.6540×g, and continuous light (light intensity 50 µmol·m⁻¹). -2 ·s -1The microalgae were cultured for 9 days under the conditions determined by a PLA-30 plant light analyzer, during which the condition of the microalgae was observed.

[0061] On days 0, 1, 3, 5, 7, and 9 of cultivation, the macroscopic color and morphological changes of the algal solution were recorded using a camera (EW-83M, Canon, Tokyo, Japan). Samples were also collected for the detection of other relevant indicators.

[0062] 1.2 Algal cell viability detection Evans blue staining was used to detect microalgal cell viability. Microalgal suspensions of different concentrations were collected on days 5, 7, and 9 of culture, and the OD500 of the algal suspension was adjusted. 680 Add Evans blue staining solution to a final concentration of 1%, mix gently for 3–5 seconds, and incubate at room temperature in the dark for 3 minutes. After incubation, centrifuge at 1,246 × g for 5 minutes, discard the supernatant, resuspend the cells in an equal volume of PBS buffer, and repeat the washing three times. Observe and photograph the resuspended algal solution under an inverted fluorescence microscope (Axio Observer 7, ZEISS, Germany). Dead cells are stained blue, while live cells show no color change.

[0063] 1.3 Detection of algal cell concentration Algal cell concentration was monitored using a full-wavelength scanning multi-function reader (Spark, TECAN, Männedorf, Switzerland) to measure OD. 680 value.

[0064] 1.4 Determination of pH of algal solution The pH of the algal solution was measured using a calibrated pH meter. The electrode was directly immersed in the homogeneous algal solution, and the reading was recorded after it stabilized. The electrode was rinsed with deionized water before and after the measurement.

[0065] 2. Experimental Results 2.1 Effects of different concentrations of sodium selenite treatment on the macroscopic phenotype of Micromangifera XY7 like Figure 2 As shown in Figure A, the concentration of sodium selenite and the culture time both affect the color change of the *Microcystis aeruginosa* XY7 algal solution. At low concentrations (e.g., 5 mg·L⁻¹), the color change is more pronounced. -1 Under the treatment, the color of the algal solution was similar to that of the control group (0 mg·L⁻¹). -1 The concentration was close to 50–200 mg·L⁻¹, indicating that algal cell growth was not significantly inhibited. -1 During cultivation, from day 1 to day 3, the color of the algal solution gradually changed from green to red, indicating that algal cell growth was inhibited to some extent, accompanied by the accumulation of red substances. At 500 mg / L... -1 and 2000 mg·L -1Although the algal solution also changed from green to red under high concentration treatment, the rate of reddening was faster than that at 50–200 mg·L⁻¹. -1 The treatment group showed a significant slowdown.

[0066] 2.2 Effects of different concentrations of sodium selenite treatment on the viability of Micrococcus microcarpa XY7 cells like Figure 2 As shown in Figure B, the viability of algal cells in different treatment groups was evaluated using Evans blue staining. Evans blue dye cannot penetrate living cells, while dead cells are stained blue. The staining results showed that 0 mg·L⁻¹… -1 With 5 mg·L -1 The cells in the treatment group were morphologically intact and all appeared green, indicating good cell viability; at 50 mg·L⁻¹ -1 In the treatment group, most cells were stained a distinct blue, indicating a significant decrease in cell viability at this concentration. However, when the sodium selenite concentration was further increased to 200, 500, and 2000 mg·L⁻¹, the cell viability improved. -1 At that time, the proportion of cells stained blue actually decreased, showing a trend of "rebound" in cell activity. This may be related to the fact that cell aggregation or changes in cell wall structure under high concentration stress affected dye penetration.

[0067] 2.3 Effects of different concentrations of sodium selenite on the cell concentration and pH of Micrococcus microcarpa XY7 algae solution like Figure 3 As shown, compared with the control group (0 mg·L⁻¹) -1 Compared to sodium selenite, 5 mg·L -1 Sodium selenite treatment slowed the growth rate of algal cells; when the sodium selenite concentration reached 50–2000 mg·L⁻¹, the growth rate decreased. -1 At this point, algal cell growth almost ceased. It is noteworthy that treatments with different concentrations of sodium selenite had no significant effect on the pH of the algal solution.

[0068] Example 5: Effects of different concentrations of sodium selenite on the photosynthetic efficiency of Micrococcus XY7 1. Experimental Methods 1.1 Preprocessing The experimental treatment method is the same as in Example 4.

[0069] 1.2 Determination of chlorophyll fluorescence parameters in cells The chlorophyll fluorescence characteristics of algal cells were evaluated using a chlorophyll fluorescence imaging system (MAXI-Imaging-PAM, WALZ, Germany). 200 µL of thoroughly mixed algal solution was added to the wells of a black 96-well plate, with three replicates per treatment. The plate was placed in the center of the instrument's detection platform. After 10 min of dark adaptation, the measurement light (110 µmol·m⁻¹) was turned on. -2 ·s-1 The maximum photon yield of the photosystem II (PSII) under dark-adapted conditions was determined. F v / F m. Then, a 5-minute light adaptation period was performed (110 µmol·m⁻¹). -2 ·s -1 Apply saturated pulsed light (280 µmol·m -2 ·s -1 The actual photon yield of PSII under light-adapted conditions was measured at 480 ms. Y (II). Finally, use biological software according to the formula ( F m F 0) / F m get F v / F The value of m is determined according to the formula ( F m' F ) / F m'get Y The value of (II), according to the formula ( F m F m') / F m' obtains the value of the non-photochemical quenching coefficient (NPQ), according to the formula ( F m' F s) / ( F m' F 0') Obtain the value of the photochemical quenching coefficient (qP).

[0070] 1.3 Data Processing Experimental data are expressed as mean ± standard error (n=3). Duncan's least significant difference (LSD) method was used for multiple comparisons to determine specific differences between treatment groups. Statistical analysis was performed using biological software.

[0071] 2. Experimental Results To investigate the effects of different concentrations of sodium selenite on the photosynthetic physiology of *Microcera xylostella* XY7, chlorophyll fluorescence parameters of PSII were measured during cultivation, including... F v / F m、 Y (II) NPQ and qP. Results are as follows: Figure 4 As shown.

[0072] Significant differences were observed in the trends of fluorescence parameters among the treatment groups during the 9-day culture period. The control group (0 mg / L) showed the following differences. -1 )of F v / FThe m value slowly increased from an initial 0.6500 to 0.6857, indicating good photosynthetic activity of the algal cells. 5 mg L -1 Processing group F v / F The m value gradually decreased from 0.6473 to 0.5593, showing mild inhibition. Meanwhile, the other concentration treatment groups (50, 200, 500, 2000 mg·L⁻¹) showed no significant inhibition. -1 )of F v / F The m value continued to decrease in the early stage of cultivation, and almost all treatments dropped to near 0 by day 5, indicating that high concentrations of sodium selenite caused irreversible damage to PSII.

[0073] Y (II) The changing patterns of NPQ and qP F v / F The results were largely consistent: the parameters in the control group fluctuated less and remained at a high level; all treatment groups (except the control group) showed a downward trend, with the high-concentration treatment group showing a more drastic decrease. Among them, the decrease in NPQ was particularly critical, reflecting the loss of heat dissipation capacity of algal cells under high selenium stress and the failure of photoprotection mechanisms.

[0074] F v / F The m-value is widely used to characterize the potential activity of PSII reaction centers, and its significant reduction is a typical marker of environmental stress in photosynthetic organisms. In this study, high-concentration sodium selenite treatment led to... F v / F m、 Y (II) The comprehensive decrease in qP and NPQ fully demonstrates that the photosynthetic activity of *Micromistletoe* XY7 is severely inhibited, the PSII reaction center is damaged, the electron transport chain is blocked, the light energy capture and conversion capacity decreases, and the photoprotection system is also on the verge of collapse. These results indicate that the tolerance threshold of *Micromistletoe* XY7 to sodium selenite is 5... 50 mg·L -1 Between these ranges, exceeding this range will trigger a significant photosynthetic inhibition effect.

[0075] Example 6: Effects of different concentrations of sodium selenite treatment on the composition and content of carotenoids in Micrococcus XY7. 1. Experimental Methods 1.1 Preprocessing The experimental method was the same as in Example 4. Algal samples were collected on day 9 for subsequent determination of carotenoid content.

[0076] 1.2 Extraction of carotenoids The pigment in the sample was extracted according to the method specified in GB / T31520—2015, "National Standard of the People's Republic of China: Determination of Astaxanthin in Haematococcus pluvialis by Liquid Chromatography". Specifically, the cultured microalgal cells were washed with sterile water more than three times to remove residual extracellular contents. After centrifugation, the supernatant was discarded, and the microalgal cells were freeze-dried to obtain algal powder. Accurately weigh 20 mg of lyophilized microalgae sample into a 2 mL centrifuge tube, add 0.1 mL of dichloromethane-methanol solution, and grind completely to break the cell walls using a steel ball grinding method. Transfer the suspension to a 10 mL centrifuge tube, wash the 2 mL centrifuge tube three times with 1 mL of dichloromethane-methanol solution, and combine the extracts. Sonicate the suspension for 5 min, centrifuge at 8000 rpm for 5 min at 5 °C. Then transfer the supernatant to a new 10 mL centrifuge tube, add 2 mL of dichloromethane-methanol solution and mix with the algal residue, and repeat the above steps at least 3 times, combining the supernatants until the extracted algal residue is white. Make up the volume of the supernatant to 10 mL with dichloromethane-methanol solution and let it stand for 15 min. Take 5 mL of the supernatant after standing and put it into a new centrifuge tube, add 0.7 mL of sodium hydroxide-methanol solution, vortex mix, seal, and react overnight at 5 °C for 12 minutes. 14 h; then, 0.4 mL of 2% phosphoric acid-methanol solution was added to the reaction solution to neutralize the remaining alkali, and the mixture was filtered through a 0.45 μm filter membrane. The filtrate was used as the sample solution.

[0077] 1.3 Detection of carotenoids Carotenoid content was determined by high-performance liquid chromatography (HPLC). An HPLC system equipped with a 120EC-C18 column (150 mm × 3 mm, 2.7 μm) was used. Chromatographic conditions were as follows: mobile phase A was a methanol-water solution containing 0.1% (v / v) formic acid (50:50, v / v); mobile phase B was a methyl tert-butyl ether-methanol solution containing 0.1% (v / v) formic acid (80:20, v / v); column temperature 35℃; detection wavelength 475 nm; injection volume 10 μL; flow rate 1.0 mL·min⁻¹. -1 Set up a gradient elution program: Initially, the mobile phase is 65% phase A and 35% phase B; at 30 min, it becomes 50% phase A and 50% phase B; at 40 min, the ratio becomes 10% phase A and 90% phase B; maintain this ratio until 44 min; at 45 min, the ratio returns to 65% phase A and 35% phase B; maintain this ratio until 55 min.

[0078] 1.4 HPLC Standard Information Zeaxanthin (14681, Sigma-Aldrich, Saint Louis, MO, USA), lutein (07168, Sigma-Aldrich), β-cryptoxanthin (C6368, Sigma-Aldrich), and β-carotene (C4582, Sigma-Aldrich) were used. Five concentration gradients were prepared for each standard. The standard solutions were injected sequentially in ascending order of concentration. Before analyzing each sample, the retention time of the standard peaks was calibrated using the standard solutions to ensure that the deviation from the analytical method was less than 1%.

[0079] 1.5 Data Processing The same data processing method as in Example 4.

[0080] 2. Experimental Results To analyze the carotenoid metabolic response of *Micromeria nivea* XY7 under different selenium stress levels, high-performance liquid chromatography (HPLC) was used to determine the composition and content of carotenoids in each treatment group. The results are as follows: Figure 5-7 As shown.

[0081] At low concentrations (0) 5 mg·L -1 Under sodium selenite treatment, the levels of primary carotenoids such as β-carotene, β-cryptoxanthin, zeaxanthin, and lutein remained high, with lutein reaching 4.71 mg / g. -1 (DW). This result is consistent with the results in Example 4 where the algal solution remained green and the cell activity was good, and in Example 5 where the Fv / Fm remained at a high level, indicating that this concentration did not significantly interfere with the metabolism of photosynthetic pigments and the algal cells were still in a normal physiological state.

[0082] When the selenium concentration rises to 50 mg·L -1 At that time, the content of all types of pigments dropped to their lowest values. Among them, β Carotene was completely undetectable, and lutein levels were also low, ranging from 5 mg / L. -1 4.71mg g -1 DW dropped sharply to 0.46 mg g -1 DW. This indicates that the concentration has exceeded the tolerance threshold of the microalgae XY7. Cellular structural damage caused by high-concentration selenium stress may lead to pigment leakage.

[0083] At higher concentrations (200) 2000 mg·L -1 Under the treatment, β The contents of carotene, zeaxanthin, and lutein all showed varying degrees of recovery. For example, the content of lutein at 2000 mg / L... -1The treatment yielded 2.68 mg / g. -1 This phenomenon suggests that although the photosynthetic electron transport chain is essentially disrupted under high selenium stress, algal cells may still initiate the synthesis of some carotenoids (especially lutein and zeaxanthin with antioxidant activity) through metabolic pathways independent of functional PSII, as a non-photochemical oxidative stress protection mechanism.

[0084] It is noteworthy that no secondary carotenoids such as sea urchinone, canthaxanthin, calendula xanthophyll, and astaxanthin were detected in any of the treatment groups, indicating that Microspora XY7 lacks a complete astaxanthin synthesis pathway and its pigment accumulation is mainly based on primary carotenoids.

[0085] The above results indicate that sodium selenite exhibits a clear concentration-dependent regulation of carotenoid metabolism in Micromangifera XY7, reflecting a multi-level response strategy of algal cells under different stress stages.

[0086] Example 7 Effect of different concentrations of sodium selenite treatment on the enrichment of organic selenium in Microspora XY7 1. Experimental Methods 1.1 Preprocessing The experimental treatment method was the same as in Example 4. Algal samples were collected on day 7 for subsequent index determination.

[0087] 1.2 Determination of total selenium content The total selenium content of the sample was pretreated and determined according to GB 5009.268-2025, "National Food Safety Standard - Determination of Multiple Elements in Food". 0.1 g (accurate to 0.001 g) of the solid sample was weighed and placed in a digestion tube. 8 mL of 65% nitric acid was added, and the sample was pretreated until no more yellow fumes were produced. Then, 2 mL of nitric acid and 1 mL of 30% hydrogen peroxide were added, and the mixture was shaken to mix. The digestion tube was placed in a microwave digester and digested according to the following procedure: first, heat to 150℃ and hold for 10 min, then increase the temperature to 180℃ and hold for 5 min, and finally increase the temperature to 200℃ and hold for 15 min. After digestion and cooling, the digest was transferred to an Erlenmeyer flask, several glass beads were added, and the mixture was heated on a hot plate until nearly dry (do not evaporate to dryness). Then, 5 mL of hydrochloric acid solution (6 mol·L⁻¹) was added. 1 Continue heating until the solution becomes clear and colorless and white fumes appear. After cooling, transfer the mixture to a 10 mL volumetric flask and add 2.5 mL of potassium ferricyanide solution (100 g·L⁻¹). 1 The solution was diluted to the mark with water, mixed well, and set aside. All treatments were performed in triplicate.

[0088] Total selenium was determined using ion-coupled mass spectrometry (ICMMS). To eliminate interference from polyatomic ions, helium collision mode was employed at a gas flow rate of 5.5 mL / min. 1 The RF power was set to 1550 W, and the sampling depth was 10.0 mm. The sample was introduced via a nebulizer, using a concentric glass nebulizer, with a nebulizing gas flow rate of 1.05 L·min. 1 .by 7 ²Ge、 103 Rh and 115 In was added online as an internal standard element to correct for matrix effects and signal drift; isotopes were selected. 78 Se was used for quantitative analysis. Total selenium standards were serially diluted to 0, 5, 10, 100, 200, 500, and 1000 μg / L. 1 The standard solution is used to obtain a standard curve that shows the linear relationship between mass spectrometry signal intensity and selenium concentration. The selenium content in the sample can be inferred from the standard curve.

[0089] 1.3 Determination of selenoamino acids and inorganic selenium content Separation and quantification of selenoamino acids and inorganic selenium were performed using ion-coupled mass spectrometry (ICMMS). 0.1 g of the freeze-dried sample was weighed and crushed by shaking with a steel bead. The centrifuge tube was rinsed with water, and the sample was transferred to a new centrifuge tube. The volume was brought to a final depth of 10 mL with water. The mixture was sonicated at room temperature for 30 min, and 5 mg of XIV protease was added. The mixture was then incubated overnight at 37°C using a shaker. The mixture was centrifuged at 10,000 rpm and filtered twice through a 0.22 μm aqueous filter before analysis. All treatments were performed in triplicate, with a blank assay also performed. Chromatographic separation was performed using an Agilent ZORBAX SB micrometer. Aq reversed-phase column (4.6 mm × 250 mm, 5 μm). Mobile phase A is 20 mmol·L⁻¹. -1 Citric acid and 5 mmol·L -1 Sodium hexanesulfonate was added, and the pH was adjusted to 4.4 with ammonia. Mobile phase B was methanol, and elution was performed with an instrument isocratic ratio of A:B = 99:1 v / v at a flow rate of 1.0 mL / min. -1 The injection volume was 20 μL.

[0090] ICP The MS detection section employs oxygen mass migration mode at a flow rate of 21% to eliminate polyatomic interference, and monitors product ions. 78 Se 16 O +Selenium quantification was performed. The instrument parameters were set as follows: RF power 1550 W; concentric glass nebulizer; peristaltic pump rate 0.30 rps; carrier gas flow rate 0.8 L·min. 1 The sampling depth was 8.0 mm. Data was acquired using time-resolved analysis mode, with an integration time of 0.5 s per point.

[0091] The standard reference materials used in this determination are as follows: selenate solution standard (No.: GBW0033), selenite solution standard (No.: GBW10032), selenocysteine ​​solution standard (No.: GBW10087), selenomethionine solution standard (No.: GBW10034), methylselenocysteine ​​solution standard (No.: GBW10088), and selenium solution standard (No.: GBW(E)081589). All the above standard reference materials were purchased from the National Center for Standard Materials Research, and relevant information can be found on its official website (https: / / www.ncrm.org.cn / ). All selenoamino acid and inorganic selenium standard solutions were serially diluted to 0, 1, 5, 10, 50, and 100 μg / L. 1 Selenium standard solution: The standard curve obtained from the standard solution shows the linear relationship between mass spectrometry signal intensity and selenium concentration. The selenium content in the sample can be inferred from the standard curve.

[0092] 1.4 Calculation of Organic Selenium Content The content of organic selenium is obtained by subtracting the content of inorganic selenium from the total selenium content.

[0093] 2. Experimental Results 2.1 Effects of different concentrations of sodium selenite treatment on selenium enrichment and transformation in Microspora XY7 like Figure 8 As shown in A, different concentrations of sodium selenite treatment significantly affected the cell color and morphology of Micrococcus XY7 at harvest time. This phenotype is consistent with that in Example 4. Figure 2 Similar to A. Further, the absorption and conversion capacity of algal strain XY7 for inorganic selenium was evaluated by measuring the residual inorganic selenium concentration in the culture medium, and the ratio of inorganic selenium removal rate in the algal solution to inorganic selenium absorption rate in the algal cells was calculated for each treatment group. Figure 8 B), the formula is: Inorganic selenium absorption rate = (Selenium addition amount - Selenium residue amount) / Selenium addition × 100%. The results showed that at sodium selenite concentrations of 5, 50, 200, 500, and 2000 mg·L⁻¹, the absorption rate was significantly higher. -1 At that time, the absorption rates of inorganic selenium in the supernatant were 94.10%, 99.01%, 94.94%, 75.93%, and 75.16%, respectively. Microsporidium XY7 was absorbed at concentrations of 5–200 mg·L⁻¹. -1It exhibits extremely high selenium absorption capacity across a wide concentration range (removal rates all above 94%), even at 2000 mg·L⁻¹. -1 Even under high concentration stress, the removal rate can still be maintained at over 75%, demonstrating excellent inorganic selenium tolerance and conversion potential.

[0094] like Figure 8 As shown in Figure C, the total selenium and organic selenium content in algal cells both increased significantly with increasing sodium selenite concentration. At 200 mg·L⁻¹... -1 Under treatment, the total selenium content reached its maximum value (27.29 g kg). -1 DW), with an organic selenium content of 27.22 g / kg. -1 DW, accounting for as high as 99.73%. Regarding the proportion of organic selenium in total selenium, except for 5 mg·L... -1 Except for the treatment group which had a rate of 87.87%, the remaining concentrations (50%)... 2000 mg·L -1 The treatment groups all achieved over 99%, with the highest reaching 99.85% (e.g., at 50 mg / L). -1 (This is a partial translation of the original text, which is not translated here.) This indicates that *Micromeria xylophora* XY7 has extremely high bioconversion efficiency for inorganic selenium, and can assimilate the vast majority of absorbed sodium selenite into organic selenium compounds. In summary, *Micromeria xylophora* XY7 can not only efficiently absorb sodium selenite, but also assimilate it in large quantities into organic selenium compounds.

[0095] 2.2 Effects of different concentrations of sodium selenite treatment on the organic selenium speciation of Microspora XY7 To further clarify the specific forms of organic selenium in the powder of Microspora XY7, this study analyzed the changes in the content of three major selenoamino acid components under different concentrations of sodium selenite treatment. Figure 8 D), its peak diagram and standard curve are shown in [D], respectively. Figure 9 and Figure 10 The results showed that selenomethionine (SeMet) was the most abundant organic selenium form in algae, with a concentration of 5 mg·L⁻¹. -1 The sodium selenite content reached its highest level of 184.79 mg / kg during treatment. -1 DW; The contents of selenocysteine ​​(SeCyS2) and methylselenocysteine ​​(MeSeCys) were relatively low, with the peak of SeCyS2 occurring at 500 mg·L⁻¹. -1 Treatment group (30.71 mg kg) -1 MeSeCys, at 2000 mg·L⁻¹ -1 The treatment group reached its maximum (6.06 mg kg). -1 ).

[0096] Example 8: Effect of different concentrations of sodium selenite treatment on the enrichment of selenium nanoparticles in Microspora XY7 1. Experimental Methods 1.1 Preprocessing The experimental method was the same as in Example 4. Algal samples were collected on day 7 for subsequent experiments.

[0097] 1.2 Transmission electron microscopy and energy dispersive spectroscopy analysis of algae Following the same experimental method as in Example 3, the microalgae samples were fixed and loaded onto a copper grid. Observation and elemental surface scanning analysis were performed using a transmission electron microscope (JEM-F200, JEOL, Tokyo, Japan) equipped with an energy dispersive spectrometer (JED-2300T, JEOL, Tokyo, Japan) with an accelerating voltage of 200 kV to obtain information on the morphology of microalgae cells and the distribution of selenium.

[0098] 1.3 Extraction and purification of microalgal selenium nanoparticles After cultivation, the selenium-enriched microalgae culture medium was centrifuged at 1,340 × g for 5 min at 4 ℃, and the cell pellet was collected and washed three times with PBS buffer. The cell pellet was resuspended in PBS (precipitate volume: PBS volume = 1:5 to 1:10), and n-hexanol (final concentration 2.0%, v / v) and Tween-80 (final concentration 5.0%, v / v) were added. After vortexing and sonication for 45 min, the sample was centrifuged at 335 × g for 5 min, the supernatant was collected, and then centrifuged at 6,700 × g for 10 min to collect the pellet.

[0099] Selenium nanoparticles were purified using a sucrose density gradient centrifugation method. Sucrose solutions of 60%, 70%, and 80% (w / v) were prepared, and 0.4 mL of the 80% and 70% sucrose solutions were added sequentially to 2 mL centrifuge tubes as a buffer. The precipitate was mixed with 0.4 mL of the 60% sucrose solution and carefully added to the surface of the buffer solution. The mixture was centrifuged at 4 °C and 3,350 × g for 10 min, and the middle and lower layers were collected. After filtration through a 0.22 μm aqueous microporous membrane, the mixture was centrifuged at 6,700 × g for 10 min, washed three times with deionized water, and the precipitate was freeze-dried to obtain the purified selenium nanoparticles.

[0100] 1.3 Ultramorphic analysis of microalgal selenium nanoparticles using transmission electron microscopy and scanning electron microscopy Transmission electron microscopy (TEM) observation: Samples were prepared using phosphotungstic acid negative staining. 20 μL of purified selenium nanoparticle suspension was dropped onto a sample plate, and a copper mesh was placed face down on the droplet surface for 3 min to allow adsorption, followed by air drying at room temperature. Subsequently, the sample was stained with 2% phosphotungstic acid for 1–2 min, and excess stain was blotted away with filter paper. The ultrastructure of the selenium nanoparticles was observed and images were acquired using a transmission electron microscope (JEM-1400FLASH, JEOL, Tokyo, Japan).

[0101] Scanning electron microscopy (SEM) observation: The purified selenium nanoparticle sample was collected by centrifugation, gently rinsed with phosphate buffer, and the supernatant was discarded. The sample was then fixed with 3% glutaraldehyde. The sample was dehydrated stepwise with a gradient of ethanol (30%, 50%, 70%, 90%, 100%, with 100% ethanol replaced three times, 15 min each time), and the solution was dropped onto a coverslip. After critical point drying, the sample was sputter-coated with gold. The morphology of the selenium nanoparticles was observed using a scanning electron microscope (JSM-IT700HR, JEOL, Tokyo, Japan).

[0102] Energy dispersive spectroscopy (EDS): Elemental surface scanning analysis was performed using a transmission electron microscope (JEM-F200, JEOL, Tokyo, Japan) equipped with an energy dispersive spectrometer (JED-2300T, JEOL) to confirm the distribution of selenium.

[0103] 1.4 Particle size, zeta potential and infrared spectral analysis of microalgal selenium nanoparticles Purified selenium nanoparticles were dispersed in deionized water, and their hydrated particle size and zeta potential were determined using a nanoparticle size and zeta potential analyzer (Nanotrac Wave II, Microtrac, Krefeld, Germany). Infrared spectroscopy analysis was performed using a Fourier transform infrared spectrometer (Spectrum One, PerkinElmer, Waltham, MA, USA): lyophilized selenium nanoparticle samples were mixed with potassium bromide, pressed into pellets, and analyzed at 400–4000 cm⁻¹. -1 Collect spectral data within the range.

[0104] 1.5 Data Processing Data are expressed as mean ± standard error of the mean (n=3), and the standard error was calculated using statistical software. The Duncan Least Significant Difference (LSD) test was used to examine the statistical significance of differences between the means. 0.05 This is a basic statistical concept for comparing the means of multiple groups, commonly seen in comparisons following analysis of variance. If the difference between the means of two groups is greater than the LSD... 0.05 If the difference is within a certain range, then the difference between the two groups is considered statistically significant. (LSD) 0.05 Calculated using DPS Data Processing System version 9.01 (DPS, Hangzhou, China). Based on LSD. 0.05 The calculation results were compared to determine whether the differences were significant. Statistical analysis graphs were drawn using biostatistics software.

[0105] 2. Experimental Results 2.1 Ultrastructure and selenium accumulation characteristics of Microspora XY7 cells treated with sodium selenite (TEM-EDX) Figure 11 A demonstrates the process flow for the extraction and characterization of selenium nanoparticles from the microalgae XY7, including selenium enrichment, extraction and purification of selenium nanoparticles, and physical characterization of the purified samples. Further analysis was conducted using transmission electron microscopy coupled with energy-dispersive X-ray spectroscopy (TEM-EDX) to compare and analyze the results at 0 mg·L⁻¹. -1 (Control) and 200 mg·L -1 Ultrastructure and selenium distribution characteristics of Micrococcus microcarpa XY7 cells after 7 days of sodium selenite treatment Figure 11 ).

[0106] Transmission electron microscopy observation results ( Figure 11 B and C) show that the control group cells had intact morphology, clear chloroplast structure, and orderly arranged thylakoid lamellae; no selenium nanoparticles were observed. In contrast, at 200 mg / L... -1 Significant changes were observed in the chloroplast structure of the treated cells, with grana and thylakoids becoming blurred and indistinctly defined; however, the overall cell morphology did not show obvious shrinkage or damage, and the cell wall structure remained intact. Notably, a large number of spherical nanoparticles were distributed both inside and outside the cells of the treated group, presumably selenium nanoparticles synthesized under selenium stress.

[0107] Energy dispersive spectroscopy further revealed the accumulation characteristics of selenium at the elemental level. Figure 11 D). The elemental surface distribution imaging results show the bright-field and dark-field morphological images, as well as the distribution maps of the four elements: carbon (C), nitrogen (N), oxygen (O), and selenium (Se). At 200 mg·L⁻¹... -1 In the treated group, selenium signals showed significant punctate and cluster-like aggregation in the corresponding regions of the nanoparticles. Further area scanning energy dispersive spectroscopy (EDS) analysis revealed a clear selenium characteristic peak at approximately 1.40 keV in all three samples (representing intracellular nanoparticles, extracellular nanoparticles, and nanoparticles present both intracellularly and extracellularly), with relative selenium content ranging from 0.06% to 0.31%. These results confirm that sodium selenite treatment can induce the simultaneous intracellular and extracellular enrichment of selenium nanoparticles in the microalgae XY7.

[0108] 2.2 Comparison of morphology, particle size and surface chemical composition of selenium nanoparticles treated with different concentrations of sodium selenite Figure 12 Comparison of 200 mg·L -1 With 2000 mg·L -1 Morphology, particle size distribution, and surface chemical composition of selenium nanoparticles synthesized from *Microcystis aeruginosa* XY7 under sodium selenite treatment. The results showed that the selenium nanoparticles synthesized at the two concentrations exhibited highly consistent characteristics.

[0109] Morphological observation: Transmission electron microscopy showed that 2000 mg·L -1The number of particles in the treatment group was significantly less than 200 mg·L⁻¹ -1 The two treatment groups showed no significant difference in particle size distribution and spherical morphology. Particle size analysis results showed that the SeNPs synthesized under both treatment conditions exhibited a narrow single-peak distribution, with a particle size range of 120–205 nm, a median particle size of approximately 170 nm, and a main peak at 171.9 nm.

[0110] Zeta potential: The results of zeta potential measurement showed that 200 mg·L -1 With 2000 mg·L -1 The potential values ​​of the treatment groups are respectively 28.5 mV and The values ​​were 37.5 mV, and the absolute values ​​were all greater than 25 mV, indicating that both SeNPs had good dispersion stability in aqueous solution.

[0111] Fourier transform infrared (FTIR) spectroscopy: The FTIR spectra of the two types of selenium nanoparticles are highly consistent, with characteristic absorption peaks including 3382.74 / 3409.07 cm⁻¹. - ¹(OH stretching vibration), 2919.07 / 2923.39 cm - ¹(CH stretching vibration), 1633.29 / 1636.88 cm - ¹(Amide I band), 1403.26 / 1411.81 cm - ¹(COH bending vibration), 1050.72 / 1051.26 cm - ¹(CO stretching vibration) and 589.85 / 593.23 cm - ¹(Se-Se stretching vibration). Furthermore, 677–698 cm⁻¹ - The weak absorption peak near ¹ may be attributed to Se. O vibration.

[0112] Scanning electron microscope images ( Figure 13 Further analysis revealed numerous irregular protrusions adhering to the surface of the selenium nanoparticles, indicating the presence of a distinct coating layer. (200 mg·L⁻¹) -1 With 2000 mg·L -1 The mass percentages of Se in the treatment groups were 83.42% and 78.06%, respectively.

[0113] The above results indicate that the surface of the selenium nanoparticles synthesized under different selenium concentrations is stably coated with proteins and polysaccharides, and the inorganic core is elemental selenium, confirming that this microalgae strain has a stable ability to synthesize selenium nanoparticles.

[0114] SEQ ID No.1 。

[0115] SEQ ID No.2

[0116] SEQ ID No.3 GGTGGACGGTACAGCAGATCATCACTGGTACTTGGACGACTGTATGGACTGATGGTTTAACTAGCTTAGACCGTTACAAAGGTCGTTGTTATGATATCGAGCCAGTTCCAGGTGAAGAAAACCAATACATCGCGTACATTGCATATCCTTTAGACCTTTTTGAAGAAGGATCTGTAACTAACTTATTTACTTCAATCGTAGGTAACGTATTTGGTTTCAAAGCTCTTCGTGCTTTACGTTTAGAAGATCTTCGTATTCCTGCAGCTTACGTTAAAACTTTCCAAGGACCTCCACACGGTATTCAAGTAGAACGTGATAAACTTAACAAATATGGTCGTGGTTTATTAGGTTGTACAATTAAACCGAAATTAGGCCTTTCAGCTAAAAACTACGGTCGTGCTGTATACGAATGTTTACGTGGTGGGCTTGACTTTACAAAAGATGATGAAAACGTAAACTCTCAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTGTAGCAGAAGCGATTTACAAATCTCAAGCTGAAACAGGTGAAATCAAAGGTCACTATTTAAACGCTACTGCAGCAACATCTGAGGAAATGCTTAAACGTGCTGAGTGTGCTAGAGATTTAGGTGTACCTATTATCATGCACGATTACTTAACTGGTGGTTTCACAGCAAACACAAGCTTAGCTCACTACTGTCGTGACAATGGTCTTCTTTTACACATTCACCGTGCAATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGATCACTTACACTCTGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACATTAGGCTTTGTTGATTTAATGCGTGATGACTACATTGAAAAAGATCGTAGTCGTGGTATTTACTTCACTCAAGACTGGGTTCTTACCAGGTACAATGCCGTAGCTACTGG。

[0117] It should be noted that the specific embodiments described above are exemplary, and those skilled in the art can devise various solutions inspired by the disclosure of this invention. These solutions all fall within the scope of this invention and its protection. Those skilled in the art should understand that this specification and its accompanying drawings are illustrative and not intended to limit the scope of the claims. The scope of protection of this invention is defined by the claims and their equivalents.

Claims

1. A type of microalgae XY7, characterized in that, The microalgae XY7 has been deposited at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20252714, on November 27, 2025. The microalgae XY7 is classified and named... Micractinium simplicissimum .

2. The application of the microalgae XY7 described in claim 1 in the conversion of inorganic selenium into nano-selenium and organic selenium, wherein the selenium ion concentration of the inorganic selenium is 2.28-913 mg·L⁻¹. -1 ,in, The inorganic selenium is a selenite.

3. The application of the microalgae XY7 described in claim 1 in the preparation of nano-selenium and organic selenium products by converting inorganic selenium, wherein the product is a selenium-enriched bacterial agent, and the concentration of selenium ions in the inorganic selenium is 2.28-913 mg·L⁻¹. -1 ,in, The inorganic selenium is a selenite.

4. A method for converting inorganic selenium into nano-selenium and organic selenium, characterized in that, It includes the following steps: The concentration of selenium ions was set within the range of 2.28-913 mg·L⁻¹. -1 The microalgae XY7 described in claim 1 is added to an inorganic selenium solution, wherein the inorganic selenium is a selenite.

5. The method according to claim 4, characterized in that, The organic selenium contains selenomethionine, selenocysteine, and methylselenocysteine.

6. The application of the microalgae XY7 described in claim 1 in the enrichment of carotenoids in an inorganic selenium environment, wherein the inorganic selenium is selenite, wherein... At a selenium ion concentration of 91.3-913 mg·L -1 In an inorganic selenium environment, it accumulates β-carotene, zeaxanthin, and lutein; At a selenium ion concentration of 2.28 mg·L⁻¹ -1 In an inorganic selenium environment, it accumulates β-carotene, β-cryptoxanthin, zeaxanthin, and lutein.

7. A method for enriching carotenoids under an inorganic selenium environment, characterized in that, The process includes the following steps: the inorganic selenium is a selenite, wherein, Under illumination, a selenium ion concentration of 2.28 mg·L⁻¹ was set. -1 The microalgae XY7 described in claim 1 was added to an inorganic selenium solution to enrich β-carotene, β-cryptoxanthin, zeaxanthin, and lutein. Or, under illumination, a setting with a selenium ion concentration of 91.3-913 mg·L⁻¹ -1 The microalgae XY7 described in claim 1 was added to an inorganic selenium solution to enrich β-carotene, zeaxanthin, and lutein.

8. The application of the microalgae XY7 according to claim 1 in the removal of inorganic selenium, characterized in that, The inorganic selenium removal rate is not less than 75%, and the selenium ion concentration of the inorganic selenium is 2.28-913 mg·L⁻¹. -1 The inorganic selenium is a selenite.

Images