A recombinant yarrowia lipolytica strain for producing astaxanthin based on peroxisome surface display technology and application thereof

Abstract

This invention discloses a recombinant *Yersinia lipolytica* strain for astaxanthin production based on peroxisome surface display technology and its applications. By constructing an astaxanthin synthesis pathway in *Yersinia lipolytica* po1f, and subsequently expressing the peroxisome membrane anchoring protein PEX15 in the host strain, the key enzymes for astaxanthin synthesis, β-carotene hydroxylase CrtZ and β-carotene ketolase CrtW, are anchored to either the internal or external surface of the peroxisome in the yeast strain expressing the constructed complete astaxanthin synthesis pathway, resulting in a significant increase in astaxanthin yield. The recombinant *Yersinia lipolytica* construction method of this invention is simple, and the use of peroxisome organelle surface display can more effectively promote astaxanthin synthesis. Through scale-up production in shake flasks and 5 L fermenters, the engineered strain can efficiently synthesize astaxanthin from glucose, which is beneficial for industrial production.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a recombinant Yersinia lipophila strain that produces astaxanthin based on peroxisomal surface display technology and its application. Technical Background

[0002] Yarrowia lipolytica is an unconventional oil-producing yeast belonging to the order Yeastae in the phylum Ascomycota. It holds GRAS (Generally Recognized As Safe) certification and is widely found in lipid-rich natural environments. Its core metabolic advantages are significant: the lipid content in its cell dry weight can reach 30%-73%, possessing extremely high acetyl-CoA flux, providing ample precursors for terpene synthesis; it also exhibits excellent stress resistance, tolerating industrial environments with low pH, high salinity, and high osmotic pressure. Furthermore, it has mature gene-editing tools and a broad substrate utilization spectrum, capable of assimilating various inexpensive carbon sources such as glucose, glycerol, and lignocellulose hydrolysate, making it an ideal chassis for constructing highly efficient microbial cell factories.

[0003] Astaxanthin is a ketocarotenoid, chemically named 3,3'-dihydroxy-4,4'-diketo-β,β'-carotene. It is bright red, fat-soluble, and insoluble in water. Its unique conjugated double bonds and the hydroxyl and ketone groups at both ends end contribute to its exceptional biological activity—its antioxidant capacity is 550 times that of vitamin E and 10 times that of β-carotene, effectively quenching free radicals and protecting cells from oxidative damage. In nature, astaxanthin is mainly found in Haematococcus pluvialis, Rhodotorula rubrum, and crustaceans. It is widely used in nutritional supplements, high-end cosmetics, and aquaculture. The esterified form of astaxanthin exhibits even greater thermal stability, photostability, and bioavailability.

[0004] In recent years, *Yarrowia lipolyticis* has become a star substrate for astaxanthin biosynthesis due to its natural lipid accumulation capacity and metabolic engineering potential. Through strategies such as heterologous pathway reconstruction, subcellular localization optimization, lipid metabolism reprogramming, and product toxicity tolerance engineering, recombinant strains have achieved a significant increase in astaxanthin yield. This demonstrates enormous potential for industrial production and provides a green and efficient solution to addressing the safety controversies surrounding chemically synthesized astaxanthin and the high cost of natural sources. Summary of the Invention

[0005] The first objective of this invention is to provide a recombinant Yersinia lipolyticis strain that produces astaxanthin based on peroxisomal surface display technology. By anchoring the key enzymes for astaxanthin synthesis to the internal surface of the peroxisomal or to the surface of the peroxisomal, the yield of astaxanthin is increased.

[0006] A second objective of this invention is to provide a method for constructing the above-mentioned recombinant Yersinia lipophila strain;

[0007] A third objective of this invention is to provide the application of the above-mentioned recombinant Yersinia lipolyticis in the production of astaxanthin. This includes: adding 1%-30% (v / v) of Tween-80 to the culture medium; and adding 0.1 g / L-10 g / L of sodium citrate to the culture medium.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A recombinant Yersinia lipolytica engineered strain for producing astaxanthin was obtained by expressing, in a host strain, geranyl-geranyl diphosphate synthase CrtE, phytoene synthase / lycopene cyclase CrtYB, and phytoene desaturase CrtI derived from Pharbitis rubescens, 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR derived from Saccharomyces cerevisiae, and β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ derived from Haematococcus pluvialis.

[0010] The host bacterium is Yersinia lipophila po1f.

[0011] The nucleotide sequences of the geraniol geraniol diphosphate synthase CrtE, phytoene synthase / lycopene cyclase CrtYB, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR, β-carotene ketolase CrtW, and β-carotene hydroxylase CrtZ are shown in SEQ ID NO: 1-6, respectively.

[0012] β-Carotene ketolase CrtW and β-carotene hydroxylase CrtZ were fused to peroxisome-anchored protein PEX15 via a linker peptide; the CrtW and CrtZ were bidirectionally fused to PEX15 at the N-terminus and C-terminus, respectively.

[0013] 1) A positive fusion form in which the enzyme protein is located upstream of the linker and PEX15 is located downstream of the linker;

[0014] 2) A reverse fusion configuration where PEX15 is located upstream of the linker and the enzyme protein is located downstream of the linker;

[0015] The CrtW and PEX15, and the CrtZ and PEX15 are each independently paired in any combination of forward or reverse fusion to form a dual-enzyme peroxisome co-anchored fusion protein combination.

[0016] Specifically, the β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ are linked to the peroxisome-anchored protein PEX15 to obtain any of the following combinations: CrtW-Linker-PEX15 and CrtZ-Linker-PEX15, CrtW-Linker-PEX15 and PEX15-Linker-CrtZ, PEX15-Linker-CrtW and CrtZ-Linker-PEX15, PEX15-Linker-CrtW and PEX15-Linker-CrtZ; the nucleotide sequence of PEX15 is shown in SEQ ID No: 7.

[0017] The Linker is GGGGGGGG.

[0018] This invention employs peroxisomal surface display technology to anchor the key enzymes CrtW and CrtZ for astaxanthin synthesis onto the surface of peroxisomes. This strategy not only immobilizes the enzymes and enhances their expression activity, but also catalyzes the conversion of the intermediate metabolite β-carotene into astaxanthin.

[0019] This invention employs a linker approach, using a linker after CrtW and CrtZ to connect them to PEX15, which avoids the influence of PEX15 on the correct folding of astaxanthin synthesis proteins.

[0020] Method for constructing a recombinant Yersinia lipolyticis strain that produces astaxanthin.

[0021] Using BB3-AF-intB as the vector plasmid, recombinant plasmids CrtI, CrtE, CrtYB, CrtW and CrtZ were constructed. The recombinant plasmids were integrated into the intB site of the po1f genome to obtain the Yersinia lipolyticis Yl-C for cytoplasmic engineering production of astaxanthin.

[0022] Using BB3-14-intC1 as the vector plasmid, a recombinant plasmid of tHMGR was constructed, and the recombinant plasmid was integrated into the intC1 site of the Yl-C genome to obtain the Yl-CT with the added MVA rate-limiting step;

[0023] Using BB3-AC-intD as the vector plasmid, recombinant plasmids containing CrtW-Linker-PEX15 and CrtZ-Linker-PEX15 / CrtW-Linker-PEX15 and PEX15-Linker-CrtZ / PEX15-Linker-CrtW and CrtZ-Linker-PEX15 / PEX15-Linker-CrtW and PEX15-Linker-CrtZ were constructed. The recombinant plasmids were integrated into the intD site of the Yl-CT genome to obtain Yl-CTP1, Yl-CTP2, Yl-CTP3, and Yl-CTP4 of Yersinia lipophila displayed on the surface of the peroxisomes.

[0024] The application of the above-mentioned recombinant Yersinia lipolyticis strain in the synthesis of the natural product astaxanthin.

[0025] The applications include:

[0026] (1) The recombinant Yersinia lipolyticis strain constructed above was cultured on a nutrient medium to obtain the fermentation product;

[0027] (2) The fermentation product was extracted with dimethyl sulfoxide and ethanol to obtain astaxanthin.

[0028] The culture medium uses glucose as the carbon source, with a carbon source content of 20-40 g / L, and peptone and yeast extract as the nitrogen source.

[0029] More preferably, 1%-30% (v / v) Tween-80 is added as a surfactant during the fermentation culture.

[0030] More preferably, the fermentation culture is supplemented with 0.1 g / L-10 g / L sodium citrate.

[0031] A further preferred formulation is: a nutrient culture medium consisting of 40 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 10% (v / v) Tween-80, and 1 g / L sodium citrate.

[0032] In a preferred embodiment, the fermentation culture uses glucose as the carbon source.

[0033] More preferably, a fed-batch fermentation method can be adopted, with an initial glucose concentration of 40 g / L in the fermenter. When the glucose is about to be exhausted, glucose is fed in to maintain the glucose concentration in the fermenter below 5 g / L.

[0034] Beneficial effects:

[0035] The recombinant *Yersinia lipolyticis* strain of this invention enables de novo synthesis of astaxanthin from glucose, achieving highly efficient astaxanthin synthesis in *Yersinia lipolyticis*. Furthermore, this invention overexpresses the rate-limiting step of the MVA pathway, and the truncated HMGR exhibits higher stability. Moreover, this invention utilizes peroxisome surface display technology to anchor the key enzyme in astaxanthin synthesis onto the peroxisome surface; this enzyme immobilization technique better promotes the conversion of β-carotene to astaxanthin. Subsequently, the accumulation of astaxanthin is further promoted by adding the surfactant Tween-80 and sodium citrate to the culture medium. Finally, through shake-flask fermentation, the Yl-CTP1 strain achieved 182.40 mg / L of astaxanthin using glucose, and simultaneously achieved 2712.36 mg / L of astaxanthin in a 5 L fermenter, with a content of 28.69 mg / g. Attached Figure Description

[0036] Figure 1 The diagram shows the structure of plasmid BB3-AF-intB-IEYBWZ, which carries URA3 as a selection marker for Yersinia lipophila.

[0037] Figure 2 The diagram shows the structure of plasmid BB3-14-intC1-tHMGE, which carries URA3 as a selection marker for Yersinia lipophila.

[0038] Figure 3 The diagram shows the structure of plasmid BB3-AC-intD-CrtW-PEX15-CrtZ-PEX15, which carries URA3 as a selection marker for Yersinia lipophila.

[0039] Figure 4 The graph shows the yield of astaxanthin produced by engineered strains Yl-C, Yl-CT, Yl-CTP1, Yl-CTP2, Yl-CTP3, and Yl-CTP4 using glucose as a carbon source.

[0040] Figure 5 The engineered strain Yl-CTP1 was subjected to OD450 treatment with 1%-30% (v / v) Tween-80. 600 A graph showing the production volume of astaxanthin.

[0041] Figure 6 The OD of engineered strain Yl-CTP1 was increased by adding 0.1 g / L to 10 g / L sodium citrate. 600 A graph showing the production volume of astaxanthin.

[0042] Figure 7 The graph shows the yield of astaxanthin produced by engineered strain Yl-CTP1 in a 5 L fermenter using glucose as the carbon source, with the addition of Tween-80 and sodium citrate. Detailed Implementation

[0043] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0044] The original strain used in the examples was *Yarrowia lipolytica* po1f. *Yarrowia lipolytica* po1f is commercially available.

[0045] In this embodiment, the extraction and quantitative analysis steps of astaxanthin are as follows:

[0046] 1. Extraction of astaxanthin

[0047] (1) Take 1 mL of the mixed fermentation broth and centrifuge at 12000 rpm for 5 min (wash twice with pure water).

[0048] (2) After draining the water, resuspend the contents in 2 mL of dimethyl sulfoxide (DMSO) (preheated at 60℃) and shake evenly on a vortex mixer. Then place the container in a 55℃ water bath for 15 min.

[0049] (3) Add 4 mL of anhydrous ethanol.

[0050] (4) Centrifuge the sample at 12,000 rpm for 5 min. Transfer the supernatant to a new centrifuge tube and store it away from light.

[0051] 2. Quantitative analysis of astaxanthin: High performance liquid chromatography was used to detect the concentration of astaxanthin.

[0052] The liquid chromatograph used in this study was an Agilent Technologies 1200 Infinity series; the column was an Acclaim™ 120 C30 column; the UV absorption wavelength was 450 nm; the mobile phase was methanol and methyl tert-butyl ether; the flow rate was controlled at 1.0 mL / min; and the column temperature was 25℃.

[0053] Example 1: Amplification of Gene Elements and Preparation of Target Plasmids

[0054] Based on the nucleotide sequences of the geranylgeranyl diphosphate synthase gene crtE, the phytoene synthase / lycopene cyclase gene crtYB, and the phytoene desaturase gene crtI from X. denrorhous provided on NCBI, the gene sequences shown in SEQ ID No: 1, SEQ ID No: 2, and SEQ ID No: 3 were obtained after codon optimization. The optimized gene codons resulted in better compatibility between the exogenous gene and the chassis of Yersinia lipolytica.

[0055] Based on the coding gene sequences of 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase tHMGR and peroxisome anchoring protein PEX15 from Saccharomyces cerevisiae provided on NCBI, PCR amplification was performed using the Saccharomyces cerevisiae genome as a template. The gene sequences of tHMGR and PEX15 are shown in SEQ ID No: 4 and SEQ ID No: 7, respectively.

[0056] Based on the nucleotide sequences of β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ from H. pluvialis provided on NCBI, the gene sequences shown in SEQ ID No: 5 and SEQ ID No: 6 were obtained after codon optimization. The optimized gene codons made the exogenous gene more compatible with the chassis of Yersinia lipolytica.

[0057] (II) Construction of recombinant plasmids

[0058] 1. The recombinant plasmids BB1-23-CrtI, BB1-23-CrtE, and BB1-23-CrtYB were constructed by Genscript Biotech Inc., which synthesized the crtI, crtE, and crtYB gene sequences. The recombinant plasmid BB1-23-tHMGR was amplified by PCR using the Saccharomyces cerevisiae genome as a template to obtain the tHMGR gene sequence. Each gene fragment was inserted into plasmid BB1-23 using the Goldengate method to obtain the recombinant plasmids BB1-23-CrtI, BB1-23-CrtE, BB1-23-CrtYB, and BB1-23-tHMGR.

[0059] Using crtI-F and crtI-R as primers and the crtI gene sequence as a template, the crtI fragment was amplified. The primer sequences are shown in Table 1.

[0060] Using crtE-F and crtE-R as primers and the crtE gene sequence as a template, the crtE fragment was amplified. The primer sequences are shown in Table 1.

[0061] Using crtYB-F and crtYB-R as primers and the crtYB gene sequence as a template, the crtYB fragment was amplified. The primer sequences are shown in Table 1.

[0062] Using tHMGR-F and tHMGR-R as primers and the Saccharomyces cerevisiae gene sequence as a template, the tHMGR fragment was amplified. The primer sequences are shown in Table 1.

[0063] Using CrtW-F and CrtW-R as primers and the crtW gene sequence as a template, the crtW fragment was amplified. The primer sequences are shown in Table 1.

[0064] Using CrtZ-F and CrtZ-R as primers and the crtZ gene sequence as a template, the crtZ fragment was amplified. The primer sequences are shown in Table 1.

[0065] The amplified crtI, crtE, crtYB, tHMGR, crtW, and crtZ fragments were recovered and purified by agarose gel electrophoresis.

[0066] GoldenGate assembly was performed using Bsa1 enzyme and T4 ligase from Shanghai Beyotime Biotechnology Co., Ltd. The circular recombinant vector was transformed into *E. coli* DH5α competent cells. Positive recombinant plasmids BB1-23-CrtI, BB1-23-CrtE, BB1-23-CrtYB, BB1-23-tHMGR, BB1-23-CrtW, and BB1-23-CrtZ were obtained through kanamycin sulfate resistance plate screening and colony PCR and sequencing verification.

[0067] 2. The recombinant plasmid BB2-AB-pGPM1-CrtI-ScCYC1tt was obtained by inserting plasmid BB1-23-CrtI, plasmid BB1-12-pGPM1, and plasmid BB1-34-ScCYC1tt into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase. The recombinant plasmid BB2-BC-pPDC1-CrtE-RPP1Btt was obtained by inserting plasmid BB1-23-CrtI, plasmid BB1-12-pGPM1, and plasmid BB1-34-ScCYC1tt into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase. BB1-23-CrtE, along with plasmids BB1-12-pPDC1 and BB1-34-RPP1Btt, was inserted into plasmid BB2-BC using the Goldengate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-BC-pPDC1-CrtE-RPP1Btt. The recombinant plasmid BB2-CD-pMDH3-CrtYB-RPS2tt was created by combining plasmid BB1-23-CrtYB with plasmids BB1-12-pMDH3 and BB1-34-RPP1Btt. -RPS2tt was inserted into plasmid BB2-CD using the GoldenGate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-CD-pMDH3-CrtYB-RPS2tt; the recombinant plasmid BB2-DE-pTEF1-CrtW-IDP1tt was obtained by inserting plasmid BB1-23-CrtW, plasmid BB1-12-pTEF1, and plasmid BB1-34-IDP1tt into plasmids using the GoldenGate method with Bpi1 enzyme and T4 ligase. In BB2-EF, plasmid BB2-DE-pTEF1-CrtW-IDP1tt was obtained; the recombinant plasmid BB2-EF-pGAP-CrtZ-RPS25Att was obtained by inserting plasmid BB1-23-CrtZ, plasmid BB1-12-pGAP, and plasmid BB1-34-RPS25Att into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase.

[0068] 3. The construction process of recombinant plasmid BB3-AF-intB-IEYBtWZ is as follows:

[0069] The recombinant plasmid BB3-intB-IEYBWZ was constructed by inserting plasmids BB2-AB-pGPM1-CrtI-ScCYC1tt, BB2-BC-pPDC1-CrtE-RPP1Btt, BB2-CD-pMDH3-CrtYB-RPS2tt, BB2-DE-pTEF1-CrtW-IDP1tt, and BB2-EF-pGAP-CrtZ-RPS25Att into plasmid BB3-AF-intB using the GoldenGate method with Bsa1 enzyme and T4 ligase, thus obtaining plasmid BB3-AF-intB-IEYBWZ.

[0070] The construction process of recombinant plasmids BB3-14-intC1-tHMGE, BB3-AC-intD-CrtW-PEX15-CrtZ-PEX15, BB3-AC-intD-CrtW-PEX15-PEX15-CrtZ, BB3-AC-intD-PEX15-CrtW-CrtZ-PEX15, and BB3-AC-intD-PEX15-CrtW-PEX15-CrtZ is consistent with that of BB3-AF-intB-IEYBtWZ.

[0071] Table 1 Primer List

[0072] crtI-F GCATGCATGCATGGTCTCCCATGACTGCTTTGGCCTA crtI-R GGTCTCGAAGCTTACTGACCCTCCCAACC crtE-F GGTCTCCCATGGGCAAAGAGAAGGA crtE-R GGTCTCAAAGCGAATTCTTAGAAGG crtYB-F GGTCTCCCATGGACTACGCCAACAT crtYB-R GGTCTCGAAGCTTACAGTGGGATGT tHMGR-F GGTCTCCCATGGACCAATTGGTGAA tHMGR-R GGTCTCGAAGCTTAGGATTTAATGC CrtW-F GGTCTCCCATGCATGTGGCCTCAGCTC CrtW-R GGTCTCGAAGCTCATGCAAGAGCGGGCACCAA CrtZ-F GGTCTCCCATGCTGTCCAAGCTGCAGAG CrtZ-R GGTCTCGAAGCTCACCGTTTCGACCAGTCCAGC

[0073] Example 2 Construction of recombinant bacteria

[0074] 1. Construction of recombinant strain Yl-A

[0075] The plasmid BB3-AF-intB-IEYBWZ containing the CrtI-CrtE-CrtYB-CrtW-CrtZ gene expression cassette was introduced into Yersinia lipolytica po1f. The CrtI-CrtE-CrtYB-CrtW-CrtZ expression cassette was integrated into the intB site of the genome, resulting in the recombinant strain Yl-C.

[0076] The specific method is as follows:

[0077] ① Competent cells were prepared by overnight culture of the original Yersinia lipolytica in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).

[0078] ② Linearized BB3-A6-intB-IEYBtWZ was introduced into competent cells of Yeast lipolyticis using the Zymogen Frozen EZYeast Transformation Kit II from Zymo Research Corporation for homologous recombination.

[0079] ③ Using the SD-Leu screening medium, single colonies grew in 3-4 days. Positive clones identified correctly by PCR were named recombinant bacteria Yl-A. The SD-Leu screening medium contained: glucose 20 g / L, Tris ethanesulfonic acid 2.26 g / L, ammonium sulfate 3 g / L, trace elements 1 ml / L, 100× salt solution 10 ml / L, agar powder 25 g / L, and 10 mg / L Leu.

[0080] 2. Construction of recombinant bacteria Yl-CT

[0081] The linearized plasmid BB3-14-intC1-tHMGR was introduced into Yersinia lipolyticis Yl-C to obtain the recombinant strain Yl-CT. The specific construction method is the same as that of Yl-C.

[0082] 3. Construction of recombinant bacteria Yl-CTP1, Yl-CTP2, Yl-CTP3, and Yl-CTP4

[0083] The linearized plasmids BB3-AC-intD-CrtW-PEX15-CrtZ-PEX15, BB3-AC-intD-CrtW-PEX15-PEX15-CrtZ, BB3-AC-intD-PEX15-CrtW-CrtZ-PEX15, and BB3-AC-intD-PEX15-CrtW-PEX15-CrtZ were introduced into Yersinia lipolyticis Yl-CT to obtain recombinant bacteria Yl-CTP1, Yl-CTP2, Yl-CTP3, and Yl-CTP4. The specific construction process was the same as that for Yl-C.

[0084] Example 3: Application of recombinant bacteria in astaxanthin production

[0085] The engineered bacteria were cultured using the recombinant bacteria Yl-C, Yl-CT, Yl-CTP1, Yl-CTP2, Yl-CTP3, and Yl-CTP4 from Example 2 to produce astaxanthin.

[0086] The specific method is as follows: Take the strain from the seed preservation tube, inoculate it into the YPD test tube with a 1% inoculation amount, and culture it at 30℃ for 24 hours to obtain the seed liquid;

[0087] The seed culture was inoculated at a rate of 1% into 50 mL of fermentation medium (40 g / L glucose, 10 g / L yeast extract, and 20 g / L tryptone). The culture was incubated at 25℃ and 220 rpm with shaking for 5 days. 4 mL of 40 g / L glucose was added every 24 h. After 120 h of fermentation, the astaxanthin yields of the recombinant strains Yl-C, Yl-CT, Yl-CTP1, Yl-CTP2, Yl-CTP3, and Yl-CTP4 were 96.74 mg / L, 117.90 mg / L, 155.85 mg / L, 126.96 mg / L, 132.70 mg / L, and 111.82 mg / L, respectively. Figure 4 This indicates that constructing the astaxanthin synthesis pathway into Yersinia lipolyticis can achieve de novo astaxanthin synthesis; multicopying the rate-limiting step of the MVA pathway enhances downstream conversion flux; and applying peroxisome surface display technology to the immobilization of key enzymes in astaxanthin synthesis can significantly increase astaxanthin yield.

[0088] Example 4: Application of Tween-80 and sodium citrate in the production of astaxanthin

[0089] The engineered strain Yl-CTP1 was cultured in a medium supplemented with 1%-30% (v / v) Tween-80, using glucose as the carbon source. After 5 days of cultivation, the astaxanthin yields were 150.08 mg / L, 153.59 mg / L, 169.24 mg / L, 165.72 mg / L, and 156.28 mg / L, respectively. Figure 5 Adding 1%-30% (v / v) Tween-80 and 0.1 g / L-10 g / L sodium citrate to the culture medium, using glucose as the carbon source, and culturing for 5 days, the astaxanthin yields were 170.97 mg / L, 174.02 mg / L, 182.40 mg / L, 170.38 mg / L, and 169.72 mg / L, respectively. Figure 6 This indicates that the addition of surfactants is beneficial for improving cell membrane structure and expanding the storage space of astaxanthin; as an acetyl-CoA derivative, the addition of sodium citrate can increase the precursor flux of astaxanthin synthesis, thereby increasing astaxanthin production.

[0090] Example 5: High-density fermentation production of astaxanthin using recombinant strain Yl-CTP1.

[0091] ① Seed culture:

[0092] a. Primary seed culture: Take 1% of the recombinant strain Yl-CTP1 bacterial culture from the cryopreservation tube and inoculate it into YPD test tubes. Incubate at 30°C and 200 rpm for 24 hours to obtain the primary seed culture. The YPD medium contains 2% peptone, 1% yeast extract and 2% glucose.

[0093] b. Secondary seed culture: Take the primary seed culture and inoculate it into a new seed culture medium at an inoculation rate of 10%, and culture it at a constant temperature under the same conditions as a to obtain the seed culture for fermentation culture.

[0094] ② Batch feeding fermentation

[0095] The seed culture obtained from seed culture was inoculated into a 5 L fermenter containing fermentation medium (40 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 10% (v / v) Tween-80, 1 g / L sodium citrate). Recombinant strain Yl-CTP1 underwent fed-batch fermentation in the 5 L fermenter at 30℃, 500 rpm, and dissolved oxygen maintained at 40%. The initial glucose concentration in the fermenter was 40 g / L. When the glucose was nearly depleted, glucose was added continuously to maintain the glucose concentration below 5 g / L. Samples were taken every 12 h to determine cell dry weight, and astaxanthin was extracted from the fermentation broth to determine its content. After 7 days of fermentation, the cell OD... 600 The concentration reached 245.36 mg / L, and the astaxanthin yield reached 2712.36 mg / L, with a content of 28.69 mg / g. Figure 7 ).

[0096] This invention is the first to employ peroxisome surface display technology in *Yarrowia lipolyticis*, immobilizing astaxanthin synthases CrtW and CrtZ on the surface of peroxisomes. This improves enzyme stability and promotes the conversion of intermediate metabolites. Simultaneously, this invention improves the fermentation strategy by exogenously adding Tween-80 and sodium citrate, further increasing astaxanthin yield through this fermentation strategy.

[0097] This invention constructs a complete astaxanthin synthesis pathway in *Yarrowia lipolytica*, enabling the de novo synthesis of astaxanthin from glucose. Subsequently, due to the rate-limiting step in the MVA pathway during astaxanthin synthesis, a truncated HMG-CoA reductase derived from *Saccharomyces cerevisiae* is expressed to direct the synthesis flux towards astaxanthin. Furthermore, peroxisome surface display technology is used to anchor key enzymes for astaxanthin synthesis onto the surface of peroxisomes, immobilizing the enzymes and enhancing their activity. Finally, scale-up cultivation is conducted in a 5 L fermenter, and the production capacity of the strain is comprehensively evaluated by measuring the OD500 of the recombinant strain in the fermenter. 600The monitoring of astaxanthin production is expected to further increase astaxanthin yield in larger fermentation tanks, laying the foundation for subsequent industrialization.

Claims

1. A recombinant Yersinia lipolyticis strain that produces astaxanthin, characterized in that, The recombinant Yersinia lipolyticis strain is based on the expression of gerany-gerany diphosphate synthase CrtE, phytoene synthase / lycopene cyclase CrtYB, and phytoene desaturase CrtI from Pharbitis rubescens, 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR from Saccharomyces cerevisiae, and β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ from Haematococcus pluvialis. Furthermore, β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ are linked to the peroxisome anchoring protein PEX15, anchoring them to the internal surface or surface of the peroxisome.

2. The recombinant Yersinia lipolyticis strain for producing astaxanthin according to claim 1, characterized in that, The nucleotide sequences of the geraniol geraniol diphosphate synthase CrtE, phytoene synthase / lycopene cyclase CrtYB, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR, β-carotene ketolase CrtW, and β-carotene hydroxylase CrtZ are shown in SEQ ID NO: 1-6, respectively, and the nucleotide sequence of the peroxisome anchored protein PEX15 is shown in SEQ ID No:

7.

3. The recombinant Yersinia lipolyticis strain for producing astaxanthin according to claim 1, characterized in that, The β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ are linked to the peroxisome anchoring protein PEX15 in any one of the following ways: CrtW-Linker-PEX15, CrtZ-Linker-PEX15; CrtW-Linker-PEX15, PEX15-Linker-CrtZ; PEX15-Linker-CrtW, CrtZ-Linker-PEX15; PEX15-Linker-CrtW, PEX15-Linker-CrtZ.

4. The recombinant Yersinia lipolyticis strain for producing astaxanthin according to claim 1, characterized in that, The host bacterium is Yersinia lipophila po1f.

5. The method for constructing a recombinant lipophilic yeast strain for producing astaxanthin according to claim 1, characterized in that, Includes the following steps: S1. Using BB3-AF-intB as the vector plasmid, construct recombinant plasmids CrtI, CrtE, CrtYB, CrtW and CrtZ, and integrate the recombinant plasmids into the intB site of the po1f genome to obtain the Yersinia lipolytica Yl-C for cytoplasmic engineering production of astaxanthin. S2. Using BB3-14-intC1 as the vector plasmid, construct the recombinant plasmid tHMGR, and integrate the recombinant plasmid into the intC1 site of the Yl-C genome to obtain the Yl-CT with the added MVA rate-limiting step. S3. Using BB3-AC-intD as the vector plasmid, construct recombinant plasmids linked to the peroxisome anchoring protein PEX15 for β-carotene ketolase CrtW and β-carotene hydroxylase CrtZ. Integrate the recombinant plasmids into the intD site of the Yl-CT genome to obtain the Yeremia lipolyticis strain displayed on the surface of the peroxisome.

6. The application of the recombinant Yersinia lipolyticis strain for astaxanthin production as described in claim 1 in the synthesis of astaxanthin.

7. The application according to claim 6, characterized in that, include: (1) The recombinant Yersinia lipolyticis strain constructed above was cultured on a nutrient medium to obtain the fermentation product; (2) The fermentation product was extracted with dimethyl sulfoxide and ethanol to obtain astaxanthin.

8. The application according to claim 7, characterized in that, The nutrient medium contains 1%-30% (v / v) Tween-80.

9. The application according to claim 7, characterized in that, Sodium citrate of 0.1 g / L to 10 g / L is added to the nutrient culture medium.

10. The application according to claim 7, characterized in that, The nutrient medium consisted of 40 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 10% (v / v) Tween-80, and 1 g / L sodium citrate.

Images