A lactococcus strain, a bacterial inoculant comprising the same and applications thereof

Abstract

The present application belongs to the technical field of microorganisms, and particularly relates to a pediococcus strain, a bacterial agent containing the same and application thereof. Pediococcus The present application provides a pediococcus strain, which is a new member of the genus Pediococcus and is named Pediococcus R27 with a preservation number of CGMCC No. 38806. The Pediococcus R27 can tolerate 20-45 DEG C and can tolerate an ethanol concentration of more than 4%. In the anaerobic fermentation stage, the Pediococcus R27 can improve the alcohol content of the product of soy sauce and the yield of liquor, promote the generation of a variety of amino acid dipeptide or tripeptide metabolites, and improve the quality of the Maotai-flavor liquor.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a Pediococcus strain, a bacterial agent containing the strain, and their applications. Background Technology

[0002] Maotai-flavor liquor is one of the four basic types of liquor in China, and is known for its unique style of "prominent Maotai aroma, elegant and delicate taste, mellow body, and long-lasting fragrance in an empty glass".

[0003] The brewing process of Maotai-flavor baijiu is characterized by "four highs, two longs, one large and one many," with high-temperature stacking fermentation being its core process. Under high-temperature stacking and fermentation conditions, the colonization of bacterial strains is weak and their metabolism is unstable, leading to incomplete fermentation and problems such as low alcohol yield and insufficient flavor precursors. Furthermore, traditional brewing processes rely heavily on experience and lack precise control over the microbial community; during long-term fermentation, the ethanol concentration in the mash continuously accumulates, which not only inhibits the metabolic activity of beneficial bacteria but also results in insufficient synthesis of flavor precursors such as small molecule peptides and amino acids. Ultimately, the base liquor often exhibits quality defects such as a rough, spicy, and pungent taste, a thin body, and a lack of complexity.

[0004] Therefore, selecting microbial strains with high-temperature fermentation characteristics and tolerance to certain ethanol concentrations is of great practical significance for adapting to the high-temperature fermentation process of Maotai-flavor liquor and improving the quality of Maotai-flavor liquor. Summary of the Invention

[0005] Therefore, the technical problem to be solved by the present invention is to provide a new species of Pediococcus that can tolerate ethanol concentrations of more than 4% and high temperatures of 45°C. Under the premise of being adapted to the high-temperature fermentation process of Maotai-flavor liquor, it can reconstruct the fermentation microecology, stimulate the release of flavor precursor substances, and improve the quality of Maotai-flavor liquor.

[0006] To address the aforementioned technical problems, the present invention provides the following technical solution: In a first aspect, this application provides a Pediococcus strain, the strain having the accession number CGMCC No. 38806.

[0007] Secondly, this application provides a Pediococcus inoculum agent containing the Pediococcus strain described in the first aspect or containing fermentation broth obtained from its fermentation.

[0008] In some embodiments of this application, the microbial agent further includes a carrier, preferably selected from one or more of wheat bran, rice husk powder, wheat middlings, corn cob powder, and corn gluten powder.

[0009] Thirdly, this application provides a method for preparing the above-mentioned Pediococcus inoculum agent, which includes anaerobic fermentation of the Pediococcus strain described in the first aspect 1 to obtain the inoculum agent.

[0010] In some embodiments of this application, the preparation method includes the following steps: (1) Seed culture: The Pediococcus strain was inoculated into a seed culture medium and cultured to obtain a seed solution; (2) Fermentation tank culture: The seed liquid described in step (1) is inoculated into the fermentation tank culture medium for culture to obtain the microbial agent.

[0011] In some embodiments of this application, the seed culture medium comprises the following components by volume: peptone 9-11 g / L, beef extract 9-11 g / L, yeast extract 4-6 g / L, glucose 19-21 g / L, Tween 80 0.5-1.5 mL / L, dipotassium hydrogen phosphate 1-3 g / L, sodium acetate 4-6 g / L, triammonium citrate 1-3 g / L, magnesium sulfate 0.1-0.3 g / L, and manganese sulfate 0.01-0.1 g / L.

[0012] In some embodiments of this application, the fermentation temperature in the fermenter is 35-40°C, and the fermentation time is preferably 5-7 days.

[0013] In some embodiments of this application, the method further includes the step of mixing the fermenter culture medium with a carrier to obtain a solid microbial agent; preferably, the mass ratio of the fermenter culture medium to the carrier is 1:2-4.

[0014] Fourthly, the application of the strains described in the first aspect, the microbial agents described in the second aspect, or the microbial agents prepared by the preparation method described in the third aspect in the brewing of baijiu (Chinese liquor).

[0015] Fifthly, this application provides a method for preparing baijiu (Chinese liquor) using the strain described in the first aspect, the microbial agent described in the second aspect, or the preparation method described in the third aspect, comprising inoculating the strain or the microbial agent into a baijiu fermentation system.

[0016] Beneficial effects: This application provides a new species of Pediococcus (Rongkui Pediococcus) that is both heat-resistant and can tolerate a certain concentration of ethanol. Pediococcus rongkuiensis (R27). After high-temperature stacking fermentation, adding this new strain of cocci during the anaerobic fermentation stage can increase the alcohol content and yield of sauce-flavored liquor, promote the generation of various amino acid dipeptides or tripeptide metabolites, and improve the quality of sauce-flavored liquor.

[0017] Strain Preservation Information The *Pediococcus rongikans* provided in this application ( Pediococcus rongkuiensisR27 was deposited on May 21, 2026, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38806. The depository address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, China; Postcode: 100101; Telephone: 010-64807596. Attached Figure Description

[0018] Figure 1 This is a colony morphology diagram of Pediococcus rongikans R27. Figure 2 Electron micrograph of Pediococcus rongikans R27; Figure 3 Gram staining results for Pediococcus rongikans R27; Figure 4 Phylogenetic tree of Pediococcus rongikans R27; Figure 5 The growth curve of Pediococcus rongikula R27; Figure 6 The growth status of Pediococcus rongikans R27 at different temperatures; Figure 7 The growth status of *Pediococcus rongikans* R27 at different pH values; Figure 8 The growth status of *Pediococcus rongikans* R27 under different NaCl concentrations; Figure 9 The growth status of Pediococcus rongikus R27 under different ethanol concentrations; Figure 10 Heatmap of differential metabolites between Pediococcus rongikans R27 and the control group. Detailed Implementation

[0019] The present invention will now be described in detail with reference to embodiments. The principles and features of the present invention are described below with reference to embodiments. It should be noted that, unless otherwise specified, the embodiments and features described in these embodiments can be combined with each other. The embodiments given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0021] The term "passage" refers to continuous culture, that is, after a single inoculation and culture to the logarithmic phase, it is immediately inoculated again to continue the culture.

[0022] The mainstream alcohol content of Maotai-flavor baijiu is 53°. As the ethanol concentration of Maotai-flavor baijiu increases, the product is prone to problems such as difficulty in balancing flavors and a rough, spicy taste. At the same time, the high-temperature fermentation process of Maotai-flavor baijiu limits the activity of conventional microbial flora, resulting in weak colonization of strains, unstable metabolism, insufficient production of flavor precursors, and poor batch stability. This places more stringent requirements on the microbial flora used.

[0023] Firstly, this application provides a new species of Pediococcus, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38806. It is mainly used in the brewing of Maotai-flavor liquor, which can increase the alcohol content and yield of Maotai-flavor liquor, promote the generation of various amino acid dipeptides or tripeptides, and thus solve common industry problems such as the difficulty in balancing flavor, rough and spicy taste, and poor adaptability to high-temperature processes in high-proof Maotai-flavor liquor.

[0024] First, a bacterial strain was isolated and purified from the mud samples of the century-old cellars of Guizhou Rongkui Winery. The strain was identified as Pediococcus simonii through bacterial identification. Pediococcus A new member of the genus *Pediococcus rongikans* has been named. Pediococcus rongkuiensis R27. Biological characteristic tests of this strain showed that it can tolerate temperatures from 20-45℃ and can withstand ethanol concentrations exceeding 4%.

[0025] It should be noted that after long-term fermentation of baijiu, the ethanol concentration of the mash in the fermentation pit will gradually increase from 0% to about 4%. The strain R27 can tolerate an ethanol concentration of more than 4%, indicating that the strain R27 can survive and play a metabolic role throughout the entire brewing cycle. It can colonize and proliferate during the high-temperature stacking and high-temperature fermentation stages, and continuously participate in flavor synthesis, which is highly consistent with the characteristics of long-term fermentation of soy sauce aroma.

[0026] In this application, the ethanol tolerance concentration refers to the volume fraction (%v / v) of ethanol that allows microorganisms to maintain growth or fermentation in an ethanol-containing culture medium during fermentation.

[0027] In some embodiments, the 16S rRNA of Pediococcus rongikula R27 contains the sequence shown in SEQ ID NO: 3.

[0028] Secondly, in some specific embodiments of this application, this application provides a Pediococcus inoculum agent containing Pediococcus rongikus R27 strain or containing fermentation broth obtained from its fermentation.

[0029] In some embodiments, the *Pediococcus* strain is anaerobically cultured to obtain the microbial agent. The microbial agent can be a liquid or solid formulation, and is introduced into the fermentation system during the fermentation process. When used in conjunction with traditional soy sauce-flavored liquor production techniques, it does not alter the original process, achieving both high-quality improvement and stable production of soy sauce-flavored liquor.

[0030] In some embodiments, the preparation method of liquid microbial agents includes: preparing a fermentation tank culture medium using brewing raw materials and by-products, and preparing the liquid microbial agent by using stepwise expansion culture (seed culture) + anaerobic culture in ceramic jars (fermentation tank culture).

[0031] First, a special liquid culture medium (seed culture medium) was prepared, dispensed, and then autoclaved at 121°C and cooled to room temperature. The original strain was then subjected to stepwise anaerobic amplification culture, sequentially culturing in anaerobic test tubes, screw-top bottles, and anaerobic glass bottles to obtain a qualified seed culture.

[0032] The seed culture medium includes 9-11 g / L peptone, 9-11 g / L beef extract, 4-6 g / L yeast extract, 19-21 g / L glucose, 0.5-1.5 mL / L Tween 80, 1-3 g / L dipotassium hydrogen phosphate, 4-6 g / L sodium acetate, 1-3 g / L triammonium citrate, 0.1-0.3 g / L magnesium sulfate, and 0.01-0.1 g / L manganese sulfate.

[0033] Next, the expanded culture medium (fermentation tank culture medium) in ceramic jars is prepared: the Daqu (fermentation starter), fermented mash, and yellow water are pretreated separately, wherein the pretreatment includes one or more of the following: extraction, filtration, or boiling. The three types of pretreatment solutions are mixed in proportion, glucose and trace elements are added, and water is added to make up the volume, adjusting the pH to 6.5-7.0. The prepared fermentation tank culture medium is transferred to sterilized 100L ceramic jars, cooled to 35-40℃, and inoculated with seed liquid at a rate of 10% under aseptic conditions. After sealing, it is placed in a constant temperature environment of 35℃ for static incubation for 5-7 days to finally obtain the finished liquid inoculum.

[0034] In some embodiments, the volume ratio of Daqu extract, mash extract, and yellow water extract in the fermentation tank culture medium is 4-6:1-3:0.5-1.5. Preferably, the sum of the volumes of Daqu extract, mash extract, and yellow water extract is 85-95% based on the volume of the fermentation culture medium.

[0035] In some embodiments, the concentration of glucose in the fermenter culture medium is 4-6 g / L, based on the volume of the fermentation medium. Preferably, the trace element is selected from one or more of zinc, manganese, boron, cobalt, calcium, nickel, platinum, iron, or sodium.

[0036] This process utilizes brewing byproducts as a culture medium, has strong strain compatibility, low cost, and the microbial agent can be directly used for the fermentation of Maotai-flavor liquor mash.

[0037] In some embodiments, the solid microbial agent preparation method includes: selecting wheat bran, drying, pulverizing, sieving, sterilizing, and cooling to avoid contamination by other microorganisms. Then, the liquid microbial agent is mixed with a carrier in a specific ratio, generally controlled at 1:2-1:4, and thoroughly stirred until the material is uniformly moistened and does not clump, ensuring uniform adhesion of the microorganisms. After mixing, the mixture is air-dried in a cool, ventilated place or dried at a low temperature, strictly controlled below 35°C to prevent high-temperature inactivation of live bacteria. The material is dried until the moisture content is 10%-15%, which maintains the activity of the microorganisms and facilitates storage and transportation. Finally, the finished product is pulverized and sieved. Protective agents can be added as needed to improve storage resistance. After repackaging and sealing, it is stored in a cool, dark place. The microbial agent can be directly used in the fermentation of Maotai-flavor liquor mash.

[0038] In some embodiments, the microbial agent further includes a carrier, preferably selected from one or more of wheat bran, rice husk powder, wheat middlings, corn cob powder, and corn gluten powder.

[0039] Thirdly, this application provides the application of the above-mentioned strains or agents in the brewing of baijiu (Chinese liquor).

[0040] Fourthly, this application provides a method for preparing baijiu (Chinese liquor) using the above-mentioned strain or inoculant, wherein the method includes inoculating the above-mentioned strain or inoculant into a baijiu fermentation system.

[0041] In some embodiments of this application, the method includes the following steps: (1) Mix the sorghum with hot water at 85-95℃; (2) Mix the rice husks with the soaked and drained sorghum, put them into a distillation still and steam them, then add hot water at 85-95℃; (3) Cool the sorghum and rice husks, then add Daqu (a type of starter culture) to them and put them into an anaerobic fermentation container; (4) Inoculate strain R27 into an anaerobic fermentation vessel for fermentation; (5) Transfer the fermented mash to a still for distillation to obtain baijiu (Chinese liquor).

[0042] In some implementations, the weight of the hot water in step (1) accounts for 45-55% of the weight of the sorghum.

[0043] In some embodiments, step (1) of the mixing process also includes a turning and mixing step, and the mixing and piling time is preferably 8-12 hours. This allows the sorghum to fully absorb water.

[0044] In some embodiments, the weight of the rice husks in step (2) is 0.5-2% of the weight of the sorghum. Preferably, the rice husks are further distilled and dried before being mixed with the sorghum; more preferably, the cooking time is 2-3 hours; and even more preferably, the amount of hot water added is 10-15% of the weight of the sorghum.

[0045] In some implementations, in step (3), the amount of Daqu added is 0.8-1.2 times the weight of sorghum.

[0046] In some embodiments, the inoculum amount of strain R27 in step (4) is 0.1-5%. The fermentation temperature is preferably 20-40°C.

[0047] All raw materials and reagents used in this invention were purchased from mainstream manufacturers on the market. Those without specified manufacturers or concentrations are all analytical grade raw materials or reagents that are routinely available. There are no particular restrictions as long as they achieve the intended effect. The instruments and equipment used in this embodiment were all purchased from major manufacturers on the market. There are no particular limitations as long as they achieve the intended effect. Where specific techniques or conditions are not specified in this embodiment, they shall be performed in accordance with the techniques or conditions described in the literature in this field or according to the product instructions.

[0048] The preparation of the culture medium involved in the embodiments of the present invention is as follows: MRS solid medium: peptone 10.0 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 20.0 g / L, Tween 80 1 mL / L, dipotassium hydrogen phosphate 2.0 g / L, sodium acetate 5.0 g / L, triammonium citrate 2.0 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L, and agar 15.0 g / L, with water as the solvent.

[0049] MRS liquid culture medium: peptone 10.0 g / L, beef extract 10.0 g / L, yeast extract 5.0 g / L, glucose 20.0 g / L, Tween 80 1 mL / L, dipotassium hydrogen phosphate 2.0 g / L, sodium acetate 5.0 g / L, triammonium citrate 2.0 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L, water as solvent.

[0050] RCM liquid medium: peptone 6 g / L, beef extract 6 g / L, yeast extract 3 g / L, glucose 5 g / L, soluble starch 1 g / L, sodium acetate 3 g / L, sodium chloride 5 g / L, L-cysteine ​​hydrochloride 0.5 g / L, water as solvent.

[0051] Example 1 Isolation and Identification of Strains 1.1 Isolation and purification of strains The separation method was as follows: A sample of cellar mud from a century-old cellar at Guizhou Rongkui Winery was dissolved in sterile water and mixed thoroughly to obtain a bacterial suspension. A combination of dilution plating and streak plating was used. 1g of cellar mud sample was dissolved in 9mL of sterile water and shaken thoroughly on a shaker to prepare a bacterial suspension. 1mL of the bacterial suspension was then transferred to 9mL of sterile water and diluted sequentially in 10-fold increments to a final concentration of 10. -2 10-3 10 -4 10 -5 10 -6 10 -7 Times, from 10 -5 10 -6 10 -7 Spread 200 μL of the diluted bacterial suspension onto an MRS agar plate and incubate anaerobicly at 37°C for 24 h. Pile a single colony from the diluted suspension onto an MRS agar plate for purification 2-3 times to obtain a pure bacterial culture. Preserve the culture with glycerol and store at -80°C.

[0052] The selected strains were Gram-stained and observed under a microscope.

[0053] like Figure 1 As shown, after incubation at a constant temperature on MRS solid medium, strain R27 forms regular circular colonies with distinctly serrated edges, a viscous and elastic texture, a pale yellow color, and a dry, slightly convex surface. Under a microscope, as shown... Figure 2 and Figure 3 As shown, R27 cells are mostly round or nearly round, with a diameter of about 0.5–1.0 mm. They are uniform in size and mainly exist singly or in pairs, with occasional short chains. They stain purple with Gram stain, have no flagella, and are morphologically stable. Figure 3 The presence of four overlapping bacteria is characteristic of the genus *Pediococcus*. Pediococcus The typical feature of bacterial electron micrographs is that they split along two vertical planes, forming characteristic tetrads (square shape).

[0054] 1.2 Strain Identification Based on the highly conserved nature of bacterial genes and their landmark role in phylogenetic analysis, this gene was selected as a molecular marker for taxonomic identification. Specifically: The preserved bacterial strain was inoculated into MRS liquid medium and cultured overnight. Bacterial cells were collected by centrifugation, and the genome was extracted using a DNA extraction kit. Using the extracted genomic DNA as a template, PCR amplification was performed with primers 27F and 1492R. Primer information is shown in Table 1, the PCR amplification reaction system is shown in Table 2, and the amplification program is shown in Table 3. The PCR products were sent for sequencing, and the sequence listing of this strain is shown in SEQ NO. 3. After sequencing using the Sanger dideoxy chain termination method, the obtained sequences were uploaded to the NCBI database for multiple sequence alignment analysis.

[0055] Table 1 Primer Information 27F SEQ NO.1: AGAGTTTGATCCTGGCTCAG 1492R SEQ NO.2:TACGGCTACCTTGTTACGACTT Table 2 PCR amplification reaction system PCR premix 15 sample 1 27F 1 1492R 1 ddH2O 12 total 30 Table 3 PCR amplification program Pre-variation 96 5min transsexual 96 20s annealing 62 20s extend 72 30 Complete extension 72 10min SEQ NO.3: According to the international prokaryotic classification standard (Stackebrandt et al., 2002), when the 16S rRNA gene sequence similarity between the target strain and the type strain is ≥98.65%, they are considered to be the same species; if it is below this threshold, they are considered to be a new taxonomic unit.

[0056] The full-length 16S rRNA gene sequence of strain R27 was submitted to the EzBioCloud and GenBank databases for comparison, and 15 highly similar reference strains were selected. A phylogenetic tree was constructed using the Tamura-Nei model and the Neighbor-Joining method, with the bootstrap replicates set to 1000. The results showed (e.g.) Figure 4 As shown in the figure, R27 clusters in the genus Pediococcus and is most closely related to Pediococcus pentosaceus DSM 20336T (96.61%) and Pediococcus stilesii LMG23082T (95.84%). All of them are below the threshold for determining the same species, indicating that R27 is a new species of the genus Pediococcus.

[0057] Mycelium preparation method: The strain preserved above was inoculated into MRS liquid medium and anaerobically cultured at 37℃ for 24 h to obtain primary seed culture. 5% of the primary seed culture was inoculated into MRS medium and cultured at 37℃ and 180 rpm for 7 days. After centrifugation at 4℃ and 6000 rpm for 10 min, the mycelium was obtained by freeze-drying.

[0058] The specific methods for chemical classification characteristic analysis are as follows: Whole-cell hydrolysate sugar and amino acid composition analysis: 50 mg of lyophilized bacterial cells were weighed and added to 100 μL of 0.5 mol / L HCl and 100 μL of 6 mol / L HCl, respectively, and hydrolyzed at 121 °C. Thin-layer chromatography was performed on microcrystalline cellulose plates using developing systems of ethyl acetate:pyridine:glacial acetic acid:water (8:5:1:1.5, volume ratio) and methanol:pyridine:glacial acetic acid:water (5:0.5:0.125:2.5, volume ratio).

[0059] Phospholipid composition analysis: 100 mg of lyophilized bacterial cells were ground and then added to 15 mL of methanol. After boiling in a water bath for 10 min, the mixture was cooled and then 10 mL of chloroform and an appropriate amount of 2% sodium chloride solution were added until the layers separated. The organic phase was concentrated at 37 °C and dissolved in a chloroform:methanol = 2:1 solution. The solution was then subjected to two-phase thin-layer chromatography analysis on a GF254 silica gel plate (developing system: chloroform:methanol:water = 65:25:4; chloroform:acetic acid:methanol:water = 80:15:12:4, volume ratio).

[0060] Chemical composition analysis of methylnaphthoquinone: 100 mg of lyophilized bacterial cells were weighed, ground, and then 40 mL of chloroform:methanol = 2:1 solution was added. The mixture was shaken at 180 r / min overnight. The supernatant was evaporated to dryness under negative pressure at 40℃, dissolved in 0.5 mL of acetone, and developed on a GF254 silica gel plate with hexane:diethyl ether = 85:15 (volume ratio). Under 254 nm UV light, a dark brown band with a relative migration rate (Rf) of 0.8 was scraped off. After adding 0.5 mL of acetone, the mixture was filtered through a 0.22 μm microporous membrane and analyzed by LC-MS / MS.

[0061] In addition, a fully automated bacterial identification system was used to determine the polar lipid components.

[0062] Chemical taxonomic analysis revealed that the main polar lipids of R27 were diphosphatidylglycerol (DPG), phosphate lipids (PL), and an unknown glycolipid. No respiratory quinone components were detected, suggesting that the strain obtains energy for its life activities through substrate-level phosphorylation rather than the electron transport chain during fermentation, and therefore does not involve respiratory quinones.

[0063] Fatty acid composition analysis showed that the main fatty acids (>5%) of strain R27 were C16:0, C18:1 ω9c, Summary Feature 7, and Summary Feature 8, while the total characteristic fatty acids included Summary Feature 3, Summary Feature 7, and Summary Feature 8. Its C16:0 and C18:1 ω9c are consistent with the characteristics of the Pediococcus genus; and it contains components not found in the type strain, such as C11:0 2-OH, C14:1 ω5c, and iso-C17:0 3-OH, indicating a significant difference in fatty acid composition, which can serve as a chemotaxonomic basis for the identification of new bacteria.

[0064] Therefore, phylogenetic analysis based on the 16S rRNA gene sequence showed that strain R27 clustered with bacteria of the genus *Pediococcus*, and was most closely related to *Pediococcus pentosaceus* DSM 20336T (96.61%) and *Pediococcus stilesii* LMG 23082T (95.04%). The 16S rRNA gene similarity with the closest type group strain was below the 98.65% species classification criterion. Combining chemical taxonomic evidence and polymorphic taxonomic features such as electron micrographs, strain R27 was determined to be a new member of the genus *Pediococcus*.

[0065] The strain was named *Pediococcus rongkuiensis* R27 and deposited. *Pediococcus rongkuiensis* R27 was deposited on May 21, 2026, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 38806.

[0066] Example 2: Analysis of the growth characteristics of the strain 2.1 Growth Curve The preserved strain R27 was inoculated into MRS liquid medium and anaerobically cultured at 37°C for 24 h to obtain primary seed culture. 1 mL of the primary seed culture was inoculated into MRS liquid medium and anaerobically cultured at 37°C. Samples were taken every 12 h, and the OD600 value was measured using a spectrophotometer. A growth curve was plotted. Figure 5 As shown.

[0067] Depend on Figure 5 It can be seen that strain R27 enters the logarithmic phase after 48 h and reaches its maximum biomass at 144 h.

[0068] 2.2 Temperature Tolerance Growth Capacity Determination Seed culture of strain R27, which has been continuously passaged for three generations, was inoculated into MRS liquid medium at a 1% inoculum. The culture was then anaerobically cultured for 7 days at temperatures of 5℃, 10℃, 15℃, 20℃, 25℃, 30℃, 35℃, 37℃, 40℃, and 45℃. The OD600 value was measured using a spectrophotometer. Each group was divided into three biological replicates. The results are shown below. Figure 6 As shown.

[0069] 2.3 pH adaptability Seed culture of strain R27, which has been continuously passaged for three generations, was inoculated into MRS liquid medium at a 1% inoculum. The culture was then anaerobic at 35°C for 7 days under pH conditions of 4, 4.5, 5, 5.5, 6, 6.5, 7, 8, 8.5, 9, and 10. The OD600 value was measured using a spectrophotometer. Each group was divided into three biological replicates. The results are shown below. Figure 7 As shown.

[0070] 2.4 NaCl concentration adaptability Seed culture of strain R27, which has been continuously passaged for three generations, was inoculated into the culture medium at a 1% inoculum. The culture was then anaerobic at 35°C for 7 days at NaCl concentrations of 0, 0.5%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, or 6.0%. The OD600 value was measured using a spectrophotometer. Each group was divided into three biological replicates. The results are as follows: Figure 8 As shown.

[0071] Depend on Figures 6 to 8It can be seen that the growth range of strain R27 is 20~45℃, pH 4.5~10.0, 0~5% NaCl, and the optimal conditions are 35℃, pH 7.0, and 0.5% NaCl.

[0072] 2.5 Determination of Ethanol Tolerance Growth Ability Seed culture of strain R27, which has been continuously passaged for three generations, was inoculated into ethanol stress medium at a 1% inoculum. The ethanol stress medium was anaerobic medium supplemented with ethanol at volume fractions of 2%, 3%, 5%, 7%, 8%, 9%, or 10%, with ethanol-free anaerobic medium serving as a control. The culture was anaerobic at 35°C for 7 days, and the OD600 value was measured using a spectrophotometer. Each group was divided into three biological replicates. Results are shown below. Figure 9 As shown.

[0073] Depend on Figure 9 It is known that strain R27 can tolerate ethanol concentrations of over 4%. It should be noted that after long-term fermentation of baijiu, the ethanol concentration of the mash in the fermentation pit gradually increases from 0% to around 4%. The fact that R27 can tolerate ethanol concentrations above 4% indicates that R27 survives and plays a metabolic role throughout the entire brewing cycle. It can colonize and proliferate during high-temperature accumulation and fermentation stages, continuously participating in flavor synthesis, which is highly compatible with the characteristics of long-term fermentation of soy sauce-flavored baijiu.

[0074] Example 3 Preparation of Pediococcus inoculum 1. Preparation method of liquid bacterial agent: 1.1 Activation of microbial strains Use an inoculation loop to pick up one loopful of strain R27 and inoculate it into MRS solid medium, then incubate at 37°C for 24 hours.

[0075] 1.2 Seed liquid preparation One loopful of activated strain R27 was inoculated into 100 mL of MRS liquid medium and cultured anaerobically in a test tube at 35 °C for 24 h to obtain primary seed culture.

[0076] The primary seed culture was inoculated into MRS liquid medium at a 1% inoculation rate and cultured in a screw-top bottle at 35°C for 24 hours to obtain the secondary seed culture.

[0077] The secondary seed culture was inoculated into MRS liquid medium at a 1% inoculation rate and cultured in anaerobic glass bottles at 35°C for 24 hours to obtain the tertiary seed culture.

[0078] 1.3 Fermentation tank cultivation (1) Raw material pretreatment Daqu pretreatment: Crush the Daqu and add it to warm water at 45-50℃ at a ratio of 1:5 (kg / L). Keep warm and stir for 3 hours. Take the supernatant or filter it with gauze to obtain the Daqu extract for later use.

[0079] Pretreatment of mash: Take fresh mash that has not been distilled, add water at a ratio of 1:4 (kg / L), stir thoroughly, let stand for 2 hours, take the supernatant or filter with gauze to obtain mash extract for later use.

[0080] Yellow water pretreatment solution: Let the yellow water stand to remove large particulate impurities, boil for 10-15 minutes, cool and take the supernatant to obtain the pretreated yellow water supernatant, for later use.

[0081] (2) Culture medium preparation ratio 600 mL of Daqu extract, 200 mL of fermented mash extract, 100 mL of pretreated yellow water supernatant, 5 g of glucose, 10 mL of trace element mixture, and distilled water to a final volume of 1 L. Adjust the pH to 6.5-7.0 with alkali solution. The trace element mixture contains: 0.1 g / L zinc sulfate heptahydrate, 0.03 g / L manganese chloride tetrahydrate, 0.3 g / L boric acid, 0.2 g / L cobalt chloride hexahydrate, 0.01 g / L calcium chloride dihydrate, 0.02 g / L nickel chloride hexahydrate, 0.03 g / L sodium chloroplatinate, and 1.5 g / L ferrous chloride tetrahydrate.

[0082] (3) Cultivation in ceramic jars Pre-treatment of ceramic jars: Select 100L ceramic jars, repeatedly wash and sterilize them with clean water and steam, and then drain them upside down.

[0083] Prepare 70L of production culture medium in a large pot according to the method in "(2) Culture Medium Preparation Ratio". After boiling, transfer it to a ceramic jar and cool it to 35-40℃. Quickly pour the anaerobic bottle seed liquid (tertiary seed liquid) into the ceramic jar under the protection of an alcohol flame. The inoculation amount is generally 10%. Seal the jar with sterilized kraft paper and then press the lid tightly with a sealing ring. Place the ceramic jar in a constant temperature fermentation chamber and let it stand at 35℃ for 5 days to obtain liquid inoculum for later use.

[0084] 2. Preparation of solid inoculants Wheat bran is selected, dried, crushed, sieved, and then sterilized and cooled to avoid contamination by other microorganisms. Liquid inoculant is then mixed with the wheat bran in a 1:2 liquid-to-solid ratio, and thoroughly stirred until the material is uniformly moistened and does not clump, ensuring even adhesion of the bacteria. After mixing, the mixture is air-dried in a cool, ventilated location or dried at a low temperature, strictly controlled below 35℃ to prevent high-temperature inactivation of live bacteria. The material is dried until its moisture content is 10%. Finally, the finished product is crushed and sieved.

[0085] Example 4 The strain R27 screened in Example 1 was inoculated into a small-scale solid-state fermentation system for baijiu at an inoculation rate of 1%. Specific steps included: Soaking the sorghum: Weigh 75kg of sorghum and add 90℃ hot water (51% of the sorghum weight) while stirring and piling it up to soak for 10 hours to allow the sorghum to fully absorb the water.

[0086] Steaming the grain: Weigh 0.75 kg of distilled and dried rice husks, mix them evenly with the soaked and drained sorghum, put them into a distillation still and steam for 2.5 hours, then add 12% of the weight of the sorghum in 85℃ hot water evenly.

[0087] Cooling and mixing the starter culture: Cool the sorghum and rice husks to 32°C, add 75kg of starter culture, mix well, divide into 6 equal portions, and put them into 6 anaerobic fermentation containers.

[0088] Inoculation: 1% of the liquid culture medium of strain R27, cultured to the logarithmic growth phase, was inoculated into an anaerobic fermentation vessel. The mixture was thoroughly mixed, and fermentation was initiated at 30°C under sealed conditions for 30 days. After 5 days of sealed fermentation, the temperature in the anaerobic fermentation vessel was raised to 45°C and maintained for 3 days, then allowed to naturally decrease. Three parallel experimental groups were set up, designated as the strain R27 experimental group. A blank control group (CK) was also set up, replacing the strain R27 culture medium with an equal volume of sterile blank RCM liquid medium, with all other conditions remaining the same. Three replicates were also set up.

[0089] Distillation: The fermented mash is transferred to a still, connected to an external condenser for distillation, and the liquor is then sealed and stored.

[0090] Experimental Example 1 The alcohol content of the samples was determined according to GB / T 10781.4-2024 "Quality Requirements for Baijiu Part 4: Sauce-flavored Baijiu", and the results are shown in Table 4. Table 4 Alcohol content

[0091] As shown in Table 4, the alcohol content of the experimental group of strain R27 was higher than that of the control group, which indicates that the addition of the new strain is beneficial to the production of ethanol, that is, it increases the yield of baijiu.

[0092] Experiment Example 2 Differential metabolite analysis of fermented mash metabolomics Untargeted metabolomics analysis was performed on the baijiu prepared in Example 4 using UHPLC-QTOF-MS coupled with GC-TOF-MS. After sample pretreatment, the samples were analyzed using the instruments. Differential metabolites were screened by combining data preprocessing, multivariate statistical analysis, and database annotation. The results are as follows: Figure 10 As shown.

[0093] Depend on Figure 10It was found that the introduction of strain R27 significantly upregulated 26 differentially expressed metabolites. Among these, the expression levels of leucine-proline-leucine tripeptide (Leu-Pro-Leu), isoleucine-proline-glutamine tripeptide (Ile-Pro-Gln), valine-proline-valine tripeptide (Val-Pro-Val), lysyl-lysine dipeptide (Lysyl-Lysine), olpadronic acid, and 5-aminoimidazolium ribonucleotide showed the most significant increase in the R27 group, indicating that the addition of strain R27 promotes the generation of various amino acid dipeptides or tripeptides. These various amino acid dipeptides or tripeptides are not only the core source of the soy sauce aroma, roasted aroma, aged aroma, and full-bodied flavor, but also substrates for many other flavor components, such as providing substrates for the Maillard reaction, thus laying the material foundation for the soy sauce aroma flavor.

[0094] Table 5 Sequence List

[0095]

[0096] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

[0097] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0098] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A strain of Pediococcus, characterized in that, The strain has the preservation number CGMCC No. 38806.

2. A Pediococcus inoculum agent, characterized in that, It contains the Pediococcus strain of claim 1 or a fermentation broth obtained from its fermentation.

3. The microbial agent according to claim 2, characterized in that, The microbial agent also includes a carrier, preferably selected from one or more of wheat bran, rice husk powder, wheat middlings, corn cob powder and corn gluten powder.

4. The method for preparing the microbial agent according to claim 2 or 3, characterized in that, It includes preparing the bacterial agent by anaerobic fermentation of the Pediococcus strain of claim 1.

5. The preparation method according to claim 4, characterized in that, Includes the following steps: (1) Seed culture: The Pediococcus strain was inoculated into a seed culture medium and cultured to obtain a seed solution; (2) Fermentation tank culture: The seed liquid described in step (1) is inoculated into the fermentation tank culture medium for culture to obtain the microbial agent.

6. The preparation method according to claim 5, characterized in that, The seed culture medium comprises the following components by volume: peptone 9-11 g / L, beef extract 9-11 g / L, yeast extract 4-6 g / L, glucose 19-21 g / L, Tween 80 0.5-1.5 mL / L, dipotassium hydrogen phosphate 1-3 g / L, sodium acetate 4-6 g / L, triammonium citrate 1-3 g / L, magnesium sulfate 0.1-0.3 g / L, and manganese sulfate 0.01-0.1 g / L.

7. The preparation method according to claim 5 or 6, characterized in that, The fermentation temperature in the fermenter is 35-40℃, and the optimal fermentation time is 5-7 days.

8. The preparation method according to any one of claims 5-7, characterized in that, The method further includes the step of mixing the fermenter culture medium with a carrier to obtain a solid microbial agent; preferably, the mass ratio of the fermenter culture medium to the carrier is 1:2-4.

9. The application of the strain of claim 1, the microbial agent of claim 2 or 3, or the microbial agent prepared by any one of the preparation methods of claims 4-8 in the brewing of baijiu (Chinese liquor).

10. A method for preparing baijiu (Chinese liquor) using the strain of claim 1, the microbial agent of claim 2 or 3, or the microbial agent prepared by any one of claims 4-8, characterized in that, The method includes inoculating the strain or the bacterial preparation into the liquor fermentation system.

Images