Bacillus velezensis with high yield of aroma active substances and application thereof in preparation of flavor tempeh

Abstract

The application belongs to the technical field of microorganisms, and specifically discloses a bacillus velezensis with high yield of aroma active substances and application of the bacillus velezensis in preparation of flavor douchi. Bacillus velezensis R1. The above-mentioned bacillus velezensis R1 is applied to preparation of flavor douchi, realizes a low-salt (3% salt content) fermentation preparation process of flavor douchi, has the characteristics of a short fermentation period, good color of a fermentation product, rich sulfur flavor substances and pyrazine flavor substances, and especially high aroma contribution of 3-ethyl-2,5-dimethylpyrazine; the douchi fermented through variable-temperature fermentation has rich aroma, no halitosis, attractive color, and moderate salt content.

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation technology, specifically relating to a Bacillus bellis that produces high levels of aroma active substances and its application in the preparation of flavored fermented black beans. Background Technology

[0002] Doubanjiang (fermented black soybeans), along with soy sauce, fermented bean curd, and soybean paste, is considered one of my country's four major traditional fermented soybean products. Based on the different fermenting microorganisms, Chinese doubanjiang can be divided into Aspergillus-based, Mucor-based, and bacterial-based doubanjiang. Mucor-based doubanjiang (Aspergillus and Mucor types) is the most widely distributed in my country, while bacterial-based doubanjiang is mainly distributed in the Yunnan-Guizhou region. Traditional Aspergillus-based doubanjiang fermentation involves koji making and post-fermentation. Koji making is relatively short and is often completed using industrially produced Aspergillus strains; post-fermentation is often longer, relying on natural fermentation in the environment. During post-fermentation, bacterial abundance is much higher than that of molds and other fungi, and bacteria play a crucial role in the final flavor of the product.

[0003] Current fermented soybean products mainly rely on halophilic aromatic yeasts or halophilic tetracocci and other lactic acid bacteria to increase volatile substances such as amino acid nitrogen, acids, aldehydes, and esters. However, in the preparation of various fermented soybean products, Bacillus species are the dominant bacteria in the post-fermentation process due to their strong salt tolerance and temperature adaptability. Existing theoretical studies have shown that Bacillus subtilis can ferment and produce acetoin and pyrazine flavor compounds, but it usually produces substances such as tetramethylpyrazine with relatively high odor thresholds, resulting in fermented products with high levels of flavor compounds but insufficient flavor. Summary of the Invention

[0004] To address the aforementioned technical problems, the first technical objective of this invention is to provide a *Bacillus belyesensis* strain that produces high levels of aroma active compounds. This *Bacillus belyesensis* strain is deposited at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China; the deposit date is May 20, 2026, and the accession number is CCTCC NO: M20261022. Its classification name is *Bacillus belyesensis* R1. Bacillus velezensis R1.

[0005] The second technical objective of this invention is to provide the application of the above-mentioned Bacillus vesiculus R1 in the preparation of flavored fermented black beans, so as to realize the low-salt (3% salt content) fermentation preparation process of flavored fermented black beans, which has the characteristics of short fermentation cycle, good color of fermented product, rich in sulfur-containing flavor substances, pyrazine flavor substances, especially 3-ethyl-2,5-dimethylpyrazine which contributes a high aroma.

[0006] The above-mentioned technical objectives are achieved through the following technical solutions: The application of Bacillus belyss R1 in the preparation of flavored fermented black beans includes the following steps: 1. Soybean pretreatment: Take soaked soybeans, adjust the salt concentration to 3%, sterilize at 121℃ for 20 min, and cool to obtain sterile soybeans for later use.

[0007] 2. Activation of Bacillus belyssus R1: First activation: Inoculate the R1 strain of Bacillus belye, stored at -80℃, with glycerol tubes (1% by volume) into the R1 optimized liquid medium and incubate in a constant temperature shaking incubator (36±1℃, 150 r / min) for 12-18 h until the bacterial density OD reaches 100%. 600 The value is not less than 1.0; Secondary activation: Take the first-activated bacterial solution and inoculate it at a volume ratio of 1% into a new R1 optimized liquid medium. Place it in a constant temperature shaking incubator (36±1℃, 150 r / min) and continue to incubate for 18-24 h to obtain activated Bacillus belyssus R1 bacterial solution. At this time, the bacterial solution density OD 600 The value is not less than 1.0.

[0008] The optimized liquid culture medium for R1 consisted of: glucose 30-50 g / L, soybean peptone 10-20 g / L, NaCl 0-15 g / L, and yeast extract 5 g / L, with pH adjusted to 7. The preferred composition was: glucose 31.58 g / L, soybean peptone 17.33 g / L, NaCl 5.00 g / L, and yeast extract 5.00 g / L, with pH 7.

[0009] 3. Inoculation and Fermentation: Inoculate 100 parts of sterile soybeans obtained in step 1 with 2% of the Bacillus berberis R1 bacterial solution obtained in step 2, and then add 6-10 parts of sterile water; then carry out variable temperature fermentation. The variable temperature fermentation conditions are: ferment at 37℃ for 2-4 days, then raise the temperature to 42℃ for 2-4 days, and then ferment at 45℃ for 20-28 days; preferably: ferment at 37℃ for 3 days, then raise the temperature to 42℃ for 3 days, and then ferment at 45℃ for 24 days.

[0010] 4. Secondary fermentation: Take the soybeans obtained in step 3 after temperature-controlled fermentation and ferment them again for 1-3 days at a temperature of 4-15℃ to obtain flavored fermented soybeans.

[0011] The beneficial effects of this invention are: 1) Soybeans are a high-oil, high-protein food ingredient. During prolonged high-temperature fermentation, the fatty acids in soybeans become rancid, producing small-molecule aldehydes and ketones, resulting in a beany and rancid taste, severely degrading the flavor. Traditional fermented soybean paste and fermented black bean sauce preparation processes require high-temperature processing, generating a large amount of flavor compounds through the Maillard reaction mechanism to mask undesirable flavors. This process is energy-intensive, and a significant amount of flavor compounds are lost due to high-temperature escaping. The *Bacillus belyssus* R1 provided in this invention, when fermented under relatively mild conditions, produces fermented black beans with high aroma activity values, effectively masking off-flavors and significantly improving the product's flavor, while consuming less energy. Furthermore, the inventors discovered that *Bacillus belyssus* R1 can metabolize to produce a vibrant orange-red color, significantly improving the product's color. Through further exploration of fermentation conditions, the inventors discovered that fermented soybeans made from Bacillus vesicles R1 provided by this invention, after temperature-controlled fermentation, have a very rich aroma, no rancid taste, an appealing color, moderate salt content, higher palatability, and are lower in sodium, making them more beneficial to health.

[0012] 2) In this invention, Bacillus vesiculosus R1 strain is inoculated into sterile soybeans for fermentation. The protein decomposition ability of this strain is utilized to decompose soybean protein and further ferment it into small molecule amino acids, thereby improving the utilization rate of raw materials, enhancing the flavor, and further improving the product quality.

[0013] 3) The results of the determination of flavor substances and aroma activity values ​​show that the present invention can significantly increase the content of flavor substances that contribute high aroma, such as dimethyl trisulfide, 2,3,5-trimethylpyrazine, and 3-ethyl-2,5-dimethylpyrazine, and endow the product with extremely high aroma activity values. Compared with the comparative example, the total aroma activity value is increased by an order of magnitude.

[0014] 4) The production cycle of this invention is only about 30 days. The production cycle is short, the fermentation conditions are mild, the energy consumption is low, the cost is low, the product has a good appearance, and the product has a good flavor. Attached Figure Description

[0015] Figure 1 The hydrolysis zone of Bacillus vesiculosus R1 strain in Example 2 on a casein plate; Figure 2 The image shows the state of cells after ultrasonic disruption in Example 3, where the solvents from left to right are anhydrous ethanol, 80% anhydrous ethanol, 50% anhydrous ethanol, ultrapure water, 0.1 mol / L hydrochloric acid, and 0.1 mol / L sodium hydroxide. Figure 3 The color state of the cell supernatant in Example 3 is shown below. The solvents from left to right are anhydrous ethanol, 80% ethanol, 50% ethanol, ultrapure water, 0.1 mol / L hydrochloric acid, and 0.1 mol / L sodium hydroxide. Figure 4This is the state of the aqueous extract of Bacillus belyss R1 strain after extraction with chloroform in Example 3, wherein the upper layer is the aqueous phase and the lower layer is a chloroform organic solution; Figure 5 This is the UV absorption spectrum scan of the pigment aqueous solution of strain R1 in Example 3; Figure 6 This diagram illustrates the effect of glucose as a single factor on the growth status of Bacillus belyssus culture in Example 4. Row A represents day 1, row B represents day 2, and row C represents day 3. The glucose content in each row, from left to right, is 0 g / L, 20 g / L, 30 g / L, 40 g / L, and 50 g / L. Specifically, A1-A5 represent glucose contents of 0 g / L, 20 g / L, 30 g / L, 40 g / L, and 50 g / L on day 1; B1-B5 represent glucose contents of 0 g / L, 20 g / L, 30 g / L, 40 g / L, and 50 g / L on day 2; and C1-C5 represent glucose contents of 0 g / L, 20 g / L, 30 g / L, 40 g / L, and 50 g / L on day 3. Figure 7 The effect of different pH values ​​on bacterial growth in Example 5 is shown, where from left to right, pH values ​​are 4, 5, 6, 7, and 8; the first row shows the culture medium after 0 days of culture, and the second row shows the culture medium after 3 days of culture. Figure 8 The growth status of Bacillus belye R1 in Example 5 on R1 optimized plates and conventional LB plates is shown, with the left plate being the R1 optimized plate and the right plate being the conventional LB medium. Figure 9 The images show the appearance of the fermented black beans prepared in each experimental group in Example 6. A1-A4 represent the fermentation status of experimental groups 1, 2, 3, and 4 on day 10, respectively; B1-B4 represent the fermentation status of experimental groups 1, 2, 3, and 4 on day 40, respectively. Figure 10 This is the GC-MS total ion chromatogram of volatile components in group C1 (0% NaCl) in Example 6; Figure 11 This is the GC-MS total ion chromatogram of volatile components in group C2 (3% NaCl) in Example 6; Figure 12 This is the GC-MS total ion chromatogram of volatile components in group C5 (with 3% NaCl added later) in Example 6; Figure 13 The image shows the GC-MS total ion chromatogram of volatile components in group E2 (3% NaCl, no bacterial inoculation) in Example 6. Detailed Implementation

[0016] The applicant will now provide a clear and complete description of the technical solutions in the embodiments of the present invention with reference to the accompanying drawings, and will give a detailed description of the present invention. These embodiments are only for illustrating the present invention and are not intended to limit the scope of protection claimed by the present invention.

[0017] The materials, reagents, and main components used in the following examples are: MRS plates: Peptone 10.0 g / L, beef extract 8.0 g / L, yeast extract 4.0 g / L, glucose 20.0 g / L, dipotassium hydrogen phosphate 2.0 g / L, diammonium hydrogen citrate 2.0 g / L, sodium acetate 5.0 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.04 g / L, agar 14.0 g / L, Tween 80 1.0 g / L, pH 6.5±0.2 (25℃). Dissolve the agar in 1000 mL of distilled water by heating, and autoclave at 121℃ for 15 minutes to obtain sterile MRS agar. Immediately pour 15 mL-20 mL of sterile MRS agar cooled to 46℃-50℃ into disposable sterile petri dishes. After the agar solidifies, the MRS plates are obtained. LB plates: Tryptone 10.0 g / L, yeast extract 5.0 g / L, sodium chloride 10.0 g / L, agar 15.0 g / L, pH 7.0±0.2 (25℃), heat to dissolve in 1000 mL of distilled water, autoclave at 121℃ for 15 minutes to obtain sterile LB solid medium. Immediately pour 15 mL-20 mL of sterile LB solid medium cooled to 46℃-50℃ into disposable sterile petri dishes to prepare LB plates with uniform thickness. R1 optimized liquid culture medium: glucose 30g / L-50g / L, soybean peptone 10.00g / L-20.00g / L, NaCl 0.00g / L-15.00g / L, yeast extract 5.00g / L, adjusted pH=7; preferred medium: glucose 31.58 g / L, soybean peptone 17.33 g / L, sodium chloride 5 g / L, yeast extract 5.00 g / L, pH=7.0 (25℃); dissolve in 1000 mL distilled water by heating, dispense into Erlenmeyer flasks, autoclave at 121℃ for 15 minutes, and set aside. R1 optimized plates: Glucose 31.58 g / L, soybean peptone 17.33 g / L, sodium chloride 5 g / L, yeast extract 5.00 g / L, agar 15.0 g / L, pH=7, autoclaved at 121℃ for 15 minutes to obtain sterile R1 optimized solid medium. Immediately pour 15mL-20mL of the sterile R1 optimized solid medium cooled to 46℃-50℃ into disposable sterile petri dishes to prepare R1 optimized plates with uniform thickness. Casein plates: 10.0 g / L casein, 3.0 g / L beef extract, 5.0 g / L sodium chloride, 2.0 g / L disodium hydrogen phosphate, 15.0 g / L agar, 0.05 g / L bromothymol blue, pH 7.4±0.1 (25℃) were dissolved in 1000 mL of distilled water by heating. The mixture was then autoclaved at 121℃ for 15 minutes to obtain sterile casein solid culture medium. 15 mL-20 mL of the sterile casein solid culture medium, cooled to 46℃-50℃, was promptly poured into disposable sterile petri dishes to prepare casein plates of uniform thickness.

[0018] Example 1: Isolation, purification, identification and preservation of strain R1 Strain Isolation and Purification: Weigh 25.00 g of fermented black soybeans from Hubei Province into a sterile homogenization bag containing 225 mL of sterile physiological saline, and homogenize the sample using a tapping homogenizer. Transfer 1 mL of the homogenized sample solution to 9 mL of sterile physiological saline to prepare a 10-fold serial dilution. Add 100 μL of the homogenized sample solution and sample dilutions to NaCl-free MRS plates, spreading them evenly with a spreader until complete absorption. Repeat the above steps, spreading each gradient of samples onto MRS plates containing 5 g / L, 10 g / L, 15 g / L, and 20 g / L NaCl. Invert the plates and incubate at 37 ℃. Observe the colony growth on the plates after 24 h. Select representative colonies and perform multiple isolation and purification steps using a three-zone streak pattern.

[0019] Strain identification: Bacterial DNA nucleic acid was extracted from the bacterial culture using a bacterial DNA extraction kit. PCR amplification of the extracted bacterial genomic DNA was performed using universal bacterial primers: 27F: AGAGTTTGATCCTGGCTCAG, 1492R: GGTTACCTTGTTACGACTT. The PCR amplification products were specifically identified by agarose gel electrophoresis. Good PCR products with bands matching the theoretical target size were recovered using an AxyPrep DNA gel recovery kit and sequenced using a Sanger sequencing system (ABI 3730xL DNA Analyzer). The obtained strain DNA sequence was compared with the NCBI database. The identification results showed that strain R1 was similar to... Bacillus velezensis The strain CBMB205 (as shown in Table 1) showed a homology of 99.93%. Generally, sequence homology of 97% or higher is considered to indicate the same bacterial species. This method is currently recognized as a rapid and accurate molecular biology technique for identifying unknown bacterial species. Therefore, the isolated and purified R1 strain was identified as Bacillus belyssus.

[0020] Table 1. 16S rDNA identification results of strain R1

[0021] Cryopreservation of strains: Single colonies of the isolated and purified R1 strain were picked and cultured on R1 optimized plates. The strain cryopreservation solution (R1 optimized liquid medium: 50% glycerol water = 1:1) was prepared, and 1 mL of the cryopreservation solution was dispensed into sterile cryovials. After the bacterial growth was scraped into the cryovials and evenly dispersed, the strains were stored in an ultra-low temperature freezer at -80°C.

[0022] Meanwhile, *Bacillus belyesensis* R1 was deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China; the deposit date was May 20, 2026, and the accession number was CCTCC NO: M 20261022. Its classification name is *Bacillus belyesensis* R1. Bacillus velezensis R1.

[0023] Example 2: Analysis of the protein metabolism capacity of Bacillus belyss R1 strain The *Bacillus belyssioides* R1 strain obtained in Example 1 was stab-inoculated onto a casein plate to identify whether the strain possessed protein-degrading ability. The specific experimental steps were as follows: 10 μL of bacterial suspension was drawn using a sterile pipette tip, and a well was punched in the casein plate. The bacterial suspension was injected into the well, and after standing, the plate was placed in an incubator and incubated at 37°C for 24 h. The casein plate was then removed, and the presence or absence of hydrolysis zones was observed. The presence of hydrolysis zones indicated that the strain could decompose and metabolize proteins. Figure 1 As shown, the hydrolysis zone of Bacillus belysus R1 strain is clearly visible on the culture medium, indicating that the strain can utilize proteins. In the subsequent preparation of fermented soybeans, the abundant protein in soybeans can be decomposed by this strain to produce amino acid-like flavor substances.

[0024] Example 3: Preliminary analysis of pigment components produced by Bacillus belyss R1 strain metabolism Existing research revealed numerous fungi that produce red pigments, such as Monascus purpureus producing red pigment, and algae and yeast producing oxidized ketocarotenoids—astaxanthin. Red pigment belongs to the polyketide class and exhibits good solubility in hydrated ethanol. Astaxanthin, a terpene unsaturated compound, is fat-soluble and insoluble in water, but soluble in organic solvents such as acetone and chloroform. In this invention, Bacillus belye is a spore-producing bacterium. Relatively speaking, pigment-producing Bacillus is very rare. To investigate the solubility of the red pigment produced by strain R1, the solvent for pigment extraction, and subsequent component analysis and structural identification of the pigment, a pigment solubility test was conducted.

[0025] The *Bacillus belyssioides* R1 strain obtained in Example 1 was washed twice with sterile physiological saline to remove impurities. The cells were then lysed using ultrasound in an ice bath (frequency: 2 s on, 2 s off, 8 min) with water, 50% ethanol solution, 80% ethanol solution, anhydrous ethanol, 0.1 mol / L hydrochloric acid solution, and 0.1 mol / L sodium hydroxide solution, respectively. The state of the cells after ultrasonic disruption was observed, and the results are as follows: Figure 2 As shown, the cell lysis turbidity with only ultrapure water as solvent was orange-red, the anhydrous ethanol cell lysis turbidity was colorless, the 80% ethanol cell lysis turbidity was light yellow, the 50% ethanol cell lysis turbidity was light orange, and the cell lysis turbidity with 0.1 mol / L hydrochloric acid (pH=1) acidic solution and 0.1 mol / L sodium hydroxide (pH=13) alkaline solution was dull in color. It is preliminarily speculated that neutral pH pure water can be used as a stable solvent for pigment extraction from the R1 strain. The cell lysis broth was centrifuged (8000 rpm, 10 min), and the color intensity of the supernatant after centrifugation was observed. The results are as follows. Figure 3 As shown, the aqueous extract obtained using neutral pH ultrapure water as a solvent is a clear orange-red color. This experiment demonstrates that the pigment of Bacillus belye R1 strain has good solubility in water and maintains a stable orange-red color.

[0026] Further extraction experiments were conducted on the aqueous extract of the above-mentioned Bacillus belyssus R1 strain using chloroform as an organic reagent to analyze whether the pigment was a lipid-soluble pigment. It was found that the pigment in the aqueous extract of strain R1 was almost insoluble in chloroform as an organic reagent (…). Figure 4 This indicates that the pigment produced by the *Bacillus belyssus* R1 strain is a water-soluble pigment, rather than the fat-soluble pigment typically produced by *Bacillus* in the prior art. Furthermore, red yeast rice pigment has good solubility in anhydrous ethanol, while astaxanthin, carotenoids, and other red pigments are fat-soluble. Based on the above experimental results, it is clear that the pigment produced by *Bacillus belyssus* in this invention is not the aforementioned red yeast rice pigment, astaxanthin, carotenoids, etc. Prodigiosin, also a natural red pigment synthesized by microorganisms, has a nitrogen-containing tripyrrole ring structure and exhibits good solubility in ethanol, which differs from the solubility properties of the pigment produced by the R1 strain in this invention.

[0027] In recent years, a new red pigment, purcheminic acid, has also been discovered. Purcheminic acid is a cyclic dipeptide mainly synthesized by microorganisms such as Bacillus or yeast, and is soluble in water. The characteristic UV absorption wavelengths of purcheminic acid aqueous solution are 243 nm, 282 nm, and 410 nm. To confirm the pigment component of Bacillus belyss R1 in this invention, the pigment aqueous solution of Bacillus belyss R1 strain was scanned using a Spectra Max i3x multi-mode microplate reader with UV absorption spectroscopy in the wavelength range of 230–800 nm. The results showed that the R1 strain pigment aqueous solution only showed obvious absorption peaks near 240 nm, 260 nm, and 270 nm, with no absorption peak at 410 nm (see...). Figure 5 Thus, it can be seen that, unlike the red pigment procernic acid that may be produced by Bacillus in the prior art, the red pigment produced by the Bacillus vesiculosus R1 strain provided in this invention is not procernic acid.

[0028] Furthermore, the aqueous extract of *Bacillus belye* strain R1 was precipitated with 3% trichloroacetic acid (TCA) to obtain the supernatant of the R1 strain after TCA precipitation. Simultaneously, the protein and total sugar contents in the aqueous extract of *Bacillus belye* strain R1 (without TCA precipitation) and the protein and total sugar contents in the supernatant of the R1 strain after TCA precipitation were determined using the Coomassie Brilliant Blue method and the phenol-sulfuric acid method, respectively. The results are shown in Table 2. TCA precipitation is a common method for protein removal in the extraction of natural components. After TCA precipitation, the protein and total sugar contents in the supernatant decreased sharply. Therefore, it is preliminarily speculated that the pigments produced by the metabolism of *Bacillus belye* strain R1 may be large glycoprotein substances composed of proteins and sugars.

[0029] Table 2. Protein and total sugar content in the aqueous extract and supernatant of strain R1

[0030] Note: "-" indicates not detected.

[0031] Example 4: Improvement and optimization of liquid culture medium for Bacillus belyss R1 strain

[0032] The culture method of Bacillus belyss R1 strain obtained in Example 1 was optimized, and the effects of nitrogen source source and content (soybean peptone and tryptone), glucose concentration, sodium chloride concentration, pH value and other factors on the growth of the strain were compared.

[0033] Nitrogen source comparison experiment: Formula 1: 5 g / L yeast extract + 10 g / L sodium chloride + 10 g / L soybean peptone; Formula 2: 5 g / L yeast extract + 10 g / L sodium chloride + 10 g / L trypone. Dissolve each in 1000 mL of distilled water by heating, dispense into Erlenmeyer flasks, and autoclave at 121℃ for 15 minutes.

[0034] Based on Formula 1, single-factor experiments were conducted using carbon source (glucose, concentration groups: 0 g / L, 20 g / L, 30 g / L, 40 g / L, 50 g / L), nitrogen source (soy peptone, concentration groups: 5 g / L, 10 g / L, 15 g / L, 20 g / L), and inorganic salt (sodium chloride, concentration groups: 0 g / L, 5 g / L, 15 g / L, 30 g / L, 60 g / L). Finally, the Box-Behnken response surface methodology was used, with glucose concentration (X) as the determining factor. A ), soybean peptone concentration (X) B ), sodium chloride concentration (X) C ) as the core variable x, with OD 600 The value is the dependent variable y. A quadratic polynomial regression model is constructed to optimize the culture medium formula for strain R1.

[0035] The experimental procedure was as follows: The reactivated bacterial culture was transferred at a 1% inoculum to the above-mentioned liquid culture medium, which had been autoclaved at 121℃ for 20 min and then cooled. The medium was then incubated at 37℃ and 150 r / min for 24-72 h. OD was measured using a Spectra Max i3x multi-functional microplate reader. 600 The aim was to quantitatively assess bacterial growth, observe and photograph the morphology of bacterial sediment and the formation of orange-red pigments, and clarify the influence of various factors on bacterial growth and metabolism.

[0036] During the optimization of the liquid culture medium formulation, it was found that formulation 1 showed a statistically significant advantage over formulation 2 at all time points (Table 3). When the soybean peptone concentration in formulation 1 was 15 g / L, strain R1 exhibited a high OD value for three consecutive days under the culture conditions. 600 The values ​​indicate that at this concentration, strain R1 exhibits better growth (Table 4); when formulation 1 contains no glucose or the glucose concentration is too low, strain R1 can grow, but produces less red pigment. However, when the glucose concentration is between 30 g / L and 50 g / L, strain R1 can grow well and produce more orange-red precipitate. Figure 6 Meanwhile, the appropriate salt content in Formula 1 can regulate the growth rate of the strain to a certain extent and increase the microbial density in the later stage of cultivation (Table 5). The salt tolerance of the R1 strain is beneficial for its use as a flavored fermented soybean starter and adapts to the characteristics of fermented soybeans mixed with salt.

[0037] Table 3 OD of Bacillus belye bacterial suspension after culturing Formula 1 and Formula 2 600 Effects (after dilution three times)

[0038] Note: Uppercase letters indicate highly significant differences. P <0.01), lowercase letters indicate significant differences ( P <0.05).

[0039] Table 4. Single-factor effect of soybean peptone on OD of Bacillus belysin culture 600 Effects (after dilution three times)

[0040] Note: Uppercase letters indicate highly significant differences. P <0.01), lowercase letters indicate significant differences ( P <0.05).

[0041] Table 5. The effect of sodium chloride on the OD of Bacillus belyceta var. salina culture. 600 Effects (after dilution three times)

[0042] Note: Uppercase letters indicate highly significant differences. P <0.01), lowercase letters indicate significant differences ( P <0.05).

[0043] The quadratic regression model is y = 0.6100 + 0.0264X. A -0.0873X C - 0.0503X B ×X C -0.0663(X A ) 2 -0.0535(X B ) 2 -0.0396(X C ) 2 , reaching a highly significant level ( P =0.0009), and the coefficient of determination R²=0.950 indicates that the model has a good fit. The basic components and contents of the optimized liquid culture medium are glucose 31.58 g / L, soybean peptone 17.33 g / L, sodium chloride 5 g / L, and yeast extract powder 5 g / L.

[0044] Example 5: pH exploration of liquid culture medium for Bacillus belyss R1 strain Using the optimized liquid culture medium obtained in Example 4 (31.58 g / L glucose, 17.33 g / L soybean peptone, 5 g / L sodium chloride, and 5 g / L yeast extract), five comparative experiments were conducted to explore the optimal pH range by adjusting the pH to 4, 5, 6, 7, and 8 using 0.1 mol / L hydrochloric acid solution or 0.1 mol / L sodium hydroxide solution.

[0045] Table 6. OD of bacterial culture after dilution three times at different pH values 600 (Day 3)

[0046] like Figure 7 As shown, *Bacillus belyssioides* R1 was cultured for three days in optimized liquid media at different pH values. The results are as follows: Regarding bacterial growth, the strain showed better growth in the optimized liquid media at pH 7 after three days of culture. Regarding pigment secretion, the optimized liquid media at pH 7 and 8 showed the best color development, while the optimized liquid media at pH 4 showed almost no significant change. Considering both bacterial growth and pigment secretion, the optimized liquid media at pH 7 will be used in subsequent experiments to ensure optimal bacterial growth and maximize pigment production, thus imparting excellent color to the fermented black bean product.

[0047] The optimized liquid culture medium (31.58 g / L glucose, 17.33 g / L soybean peptone, 5.00 g / L sodium chloride, and 5.00 g / L yeast extract) was added to 15.00 g / L agar, sterilized, and poured onto a disposable aseptic plate to prepare an optimized R1 plate. This plate was then compared with a conventional LB plate (10.0 g / L trypone, 5.0 g / L yeast extract, 10.0 g / L sodium chloride, and 15.0 g / L agar) for Bacillus belyssus R1 culture. The colony growth status was then compared. Figure 8 As shown, the results revealed that *Bacillus belye* R1 strain was milky yellow on conventional LB medium with almost no pigment production, but on the optimized R1 plate, the colonies exhibited a vibrant orange-red color. Therefore, the optimized R1 plate can be used for the expansion culture and cold storage of *Bacillus belye* R1 strain.

[0048] Based on the experimental results of Examples 2-5, it can be seen that the Bacillus belye R1 of the present invention can grow to a high bacterial density on the second to third day, and can produce a bright orange-red pigment on the third day.

[0049] Therefore, the inventors chose variable temperature fermentation in subsequent fermentation experiments: First, 37℃ is the optimal temperature for the growth of general bacteria, which is different from the room temperature fermentation (20-25℃) commonly used in existing technologies. If the temperature is too low during the reproduction period, it will not be conducive to the rapid proliferation of R1 after inoculation.

[0050] After three days of growth and proliferation at the optimal temperature of 37℃, while enhancing the product's pigmentation, the metabolic activity of the strain decomposes large molecules, especially proteins, in the soybean raw material into smaller molecules such as amino acids. Subsequently, the temperature was gradually raised to 42℃ and finally to 45℃. Through experimental exploration, the inventors discovered that under the adjusted high-temperature conditions, sugars and amino acids in soybeans undergo Maillard reactions, further promoting the product's brown appearance and generating a large number of flavor substances, thus improving the overall quality of the product.

[0051] Example 6: Determination of color and flavor compounds in fermented soybeans with different salinity using Bacillus belye R1 strain.

[0052] Experimental group 1: 1) Soybean pretreatment: Soak soybeans for 8 hours, take 100 portions of soaked soybeans, adjust the salt concentration to 0%, sterilize at 121℃ for 20 minutes and cool for later use.

[0053] 2) Preparation of R1 strain seed culture: Primary activation: Glycerol tubes of Bacillus belye R1 strain stored at -80℃ (approximately 1% by volume) were inoculated into the R1 optimized liquid culture medium obtained in Example 5 (31.58 g / L glucose, 17.33 g / L soybean peptone, 5.00 g / L NaCl, 5.00 g / L yeast extract, pH=7), and continuously cultured in a constant temperature shaking incubator (37℃, 150 r / min) for 18 h. At this time, the bacterial density OD 600 The value reached approximately 1.0. Secondary activation: 1% (v / v) of the first-activated bacterial solution was inoculated into fresh R1 optimized liquid medium and placed in a constant temperature shaking incubator (37℃, 150 r / min) for 18 h to obtain the seed culture of *Bacillus belyssiensis* R1 strain. At this point, the bacterial solution density OD... 600 The value reaches around 1.0.

[0054] 3) Inoculation and fermentation: Inoculate at a volume ratio of 2% (the number of viable cells is approximately 10). 9 Inoculate the seed culture of Bacillus vesiculosus R1 strain (CFU / mL) and then add 6 parts of sterile water to 100 parts of sterile soybeans obtained in step 1). Place in a temperature-controlled incubator for variable-temperature fermentation. The variable-temperature fermentation conditions are: 37℃ for 3 days, then increase the temperature to 42℃ for 3 days, and then ferment at 45℃ for 24 days.

[0055] 4) Post-fermentation: Take the soybeans after the fermentation in step 3) and ferment them for 3 days at a temperature of 10 ℃ to obtain flavored fermented soybeans, named group C1.

[0056] Experimental Group 2: Except for adjusting the salt concentration to 3% in step 1), the other steps are the same as Experimental Group 1, and the flavored fermented black beans are named Group C2.

[0057] Experimental group 3: 1) Soybean pretreatment: Soak soybeans for 8 hours, take 100 portions of soaked soybeans, sterilize at 121℃ for 20 minutes and cool for later use.

[0058] Step 2) Same as experimental group 1; 3) Inoculation and fermentation: Inoculate the seed culture of Bacillus vesiculus R1 strain at a 2% inoculation rate, and then add 6 parts of sterile water to 100 parts of sterile soybean obtained in step 1). After inoculation, ferment at variable temperature. The variable temperature fermentation conditions are: ferment at 37℃ for 3 days, adjust the salt concentration to 3% under sterile conditions, raise the temperature to 42℃ for 3 days, and then ferment at 45℃ for 24 days.

[0059] Step 4) Same as Experiment 1, the flavored fermented black beans are named C5 group.

[0060] Experimental Group 4: Comparative Example 1) Soybean pretreatment: Soak soybeans for 8 hours, take 100 portions of soaked soybeans, adjust the salt concentration to 3%, sterilize at 121℃ for 20 minutes and cool for later use.

[0061] 2) Without inoculating with the bacterial strain, add 8 parts of sterile water to 100 parts of sterile soybeans obtained in step 1) and carry out variable temperature fermentation directly. The variable temperature fermentation conditions are: ferment at 37℃ for 3 days, then raise the temperature to 42℃ for 3 days, and then ferment at 45℃ for 24 days.

[0062] 3) Take the soybeans after fermentation in step 2) and ferment them for 3 days at a temperature of 10 ℃ to obtain flavored fermented soybeans, named E2 group.

[0063] Observe the fermented black bean products prepared in experimental groups 1-4, and take photos for comparison. The results are as follows: Figure 9 As shown. Compared with group E2 (comparative example, fermented without Bacillus belysin R1), the color of fermented soybeans after 10 days of fermentation remained the pale yellow of soybeans themselves, without turning red or brown. However, the fermented soybeans inoculated with Bacillus belysin R1 showed a distinct orange-red color in experimental groups 1, 2, and 3. This indicates that under the 3% salt fermentation conditions (experimental groups 2 and 3), Bacillus belysin R1 can still metabolize and produce pigments during the fermentation process of fermented soybeans, thus playing a role in improving color.

[0064] On the 40th day after fermentation, in addition to the color-improving effect of strain R1, the Maillard reaction also played a role in the color formation of fermented black beans during the long-term high-temperature fermentation process. For example... Figure 9As shown in b4, the soybeans in the comparative example changed from an initial light yellow to a dull dark brown. This is due to the Maillard reaction of sugars and amino acids in the soybeans, ultimately producing melanoidins. In contrast, the fermented soybeans (b1-b3) inoculated with Bacillus belye R1 showed a reddish-brown color, a result of the combined effects of pigment metabolism and the Maillard reaction of the R1 strain. Further comparison revealed white membrane spots on the surface of fermented soybeans prepared in groups 1 and 3, while group 2 did not exhibit this phenomenon. Adding salt is a common method of preservation in food processing; salt-intolerant microorganisms cannot grow and proliferate under saline conditions. Analysis shows that no salt was added during the entire fermentation process in group 1, and no salt was added during the first three days of fermentation in group 3. Therefore, the initial 37℃ incubation and salt-free fermentation stage in soybean fermentation may be the key period for the formation of this white membrane. This is because, during the preparation of fermented black soybeans, although most microorganisms are sterilized after high-temperature steaming, a small number of thermoresistant microorganisms or spores may still remain. These microorganisms can revive and proliferate under suitable conditions, such as salt-free fermentation at 37°C during fermentation, negatively impacting the product's color and appearance in the later stages of fermentation. In contrast, experimental group 2 involved salt fermentation from the initial stage. Furthermore, the *Bacillus belye* strain used in this invention can tolerate salt concentrations of 4.5% or even 6% (see Table 5 in Example 4), fully capable of withstanding the 3% salt content fermentation conditions in this example. It rapidly proliferated to become the dominant microbial community, competing with any remaining microorganisms, limiting or inhibiting their growth and proliferation. Ultimately, this resulted in a reddish-brown color and a glossy appearance, forming an appealing glossy sauce color without any white film or spots. Therefore, the *Bacillus belye* strain R1 of this invention can be used to improve the color of fermented black soybeans and achieves the best results under the process conditions of Experimental Example 2.

[0065] Volatile aroma compounds in the fermented black soybean samples obtained from experimental groups 1-4 were extracted and separated using HS-SPME technology. Qualitative and quantitative analysis of the volatile components of the fermented black soybeans was performed using GC-MS technology. The odor activity value (OAV) is the ratio of the measured mass concentration of a compound to its aroma threshold concentration, representing the compound's contribution to the aroma. Based on the quantitative results of the volatile components in the fermented black soybean samples, and combined with the aroma threshold values ​​of flavor compounds in water as found in the current "Compilation of Aroma Thresholds for Compounds," the odor activity values ​​of the volatile components in the fermented black soybean samples can be calculated. Furthermore, GC-O technology can be used to confirm the aroma components of the fermented black soybeans and record the flavor intensity.

[0066] Weigh approximately 3 g of fermented black soybean sample, add 2 μL of quinoline (0.1055 mg / mL) to a headspace vial, seal the vial with a hollow magnetic metal cap containing a blue PTEE silicone septum, and then perform HS-SPME using an autosampler.

[0067] HS-SPME operating conditions: The sample is equilibrated at 45 °C for 5 min, and then adsorbed using a solid-phase microextraction fiber head (PDMS / DVB / CAR) for 30 min. Then, the sample is desorbed at the inlet in splitless mode at 250 °C for 45 min.

[0068] Gas chromatography conditions: The first column was a DB-WAX (100% polyethylene glycol, 30m × 0.25 mm, 0.25 µm), and the second column was a DB-17 (1m × 0.18 mm, 0.18 µm); Injector temperature: 250℃; Injection volume: 1 µL; Split mode: splitless; Temperature program: 40℃ held for 2 min, then increased to 250℃ at 5℃ / min and held for 3 min, for a total of 50 min; Constant flow mode, flow rate: 1.0 mL / min, carrier gas: helium (99.999%).

[0069] The formula for calculating RI, one of the qualitative indicators in gas chromatography, is as follows: (1) In the formula: RI —The retention index of the analyte; RTx —The retention time of the target compound; RTz —The retention time of the nearest n-alkane to the target compound before it elutes; RTz +1 —The retention time of the nearest n-alkane after the target compound elutes; RIz —The retention index of n-alkanes, which is 100 times their carbon number.

[0070] The aroma components were quantitatively analyzed using the internal standard method. 2 μL of the internal standard quinoline was added to 3g of fermented soybean sample for quantitative analysis. The volatile substance content identified in this experiment was not an absolute concentration, but a relative content compared to the internal standard, constituting a semi-quantitative analysis. The calculation formula is as follows: .

[0071] Mass spectrometry conditions: ion source: EI 70 eV; ion source temperature: 230℃; quadrupole temperature: 150℃; transfer line temperature: 280℃; scanning mode: full scan; mass range: 45-450 m / z; acquisition frequency: 5 Hz.

[0072] Peak identification and matching were performed on the data from the one-dimensional chromatogram using Agilent Mass Hunter Qualitative Analysis Navigator B.08.00. Compounds with a matching degree below 70 were screened out, halogen-containing compounds that did not contribute flavor, and silicon-containing compounds eluted from the column were excluded. Validation was performed using the retention index method (comparing experimentally obtained RI values ​​with those from the NIST mass spectral library and literature, with a deviation within 40) and precise mass number. The obtained gas chromatogram is shown below. Figures 10-13 As shown in Table 7, the composition and content of the main differentially expressed volatile substances are shown in Table 8, and the calculation results of the aroma activity value are shown in Table 8.

[0073] Smell conditions: transmission line temperature 250℃; smelling port temperature 150℃; humidifier flow rate 80mL / min. Flavor intensity level 1 indicates virtually no odor detected; flavor intensity level 2 indicates a detectable odor; flavor intensity level 3 indicates a detectable and distinguishable odor; flavor intensity level 4 indicates a strong odor. Flavor intensity records are shown in Table 8.

[0074] Experimental data show that salt concentration, especially with salt fermentation (Group C2), has a significant effect on the use of Bacillus belyi R1 in flavored fermented soybean fermentation. Specifically, Group C2 (Experimental Group 2) has a peak with a large area at a retention time of 14.90 min. By comparing mass spectrometry data and relative retention time, it was identified as dimethyl trisulfide. This substance has an extremely low threshold, and its aroma activity value is calculated to be over 700, which is significantly higher than that of Experimental Group 1, Experimental Group 3, and Experimental Group 4 (comparative example). The flavor intensity data confirmed by smell also confirms the flavor contribution of this substance. Meanwhile, in group C2 (experimental group 2), a substance absent in groups C1 (experimental group 1), C5 (experimental group 3), and E2 (experimental group 4, comparative example) was observed at a retention time of 16.16 min. This substance was identified as 3-ethyl-2,5-dimethylpyrazine, with a threshold of 0.008 mg / kg, significantly lower than other pyrazine flavor compounds in fermented black beans. Its aroma activity value was calculated to be 437.791, and its olfactory intensity was 4, indicating a significant contribution to the flavor of group C2 (experimental group 2). In contrast, tetramethylpyrazine was detected in all four groups of fermented black beans at relatively high levels, ranging from 6 to 12 mg / kg. However, due to its high threshold, its aroma activity value was low, and its flavor intensity value was 0 during olfactory testing, indicating no olfactory contribution. In addition, group C2 (experimental group 2) also had a higher content of 2,3,5-trimethylpyrazine, with an aroma activity value exceeding 800, contributing more to the flavor compared to the other groups of fermented black beans. In summary, group C2 (experimental group 2) fermented black beans, rich in highly active flavor compounds such as dimethyl trisulfide, 3-ethyl-2,5-dimethylpyrazine, and 2,3,5-trimethylpyrazine, possess superior flavor characteristics. Compared to group C1 (experimental group 1), this demonstrates the enhancing effect of salt on food flavor during processing; compared to group C5 (experimental group 3), it further demonstrates the superiority of this salt-mixing production process; and compared to group E2 (experimental group 4, comparative example), it demonstrates the significant improvement in the flavor of fermented black beans by Bacillus belye R1 strain as a starter culture.

[0075] Table 7. Composition and content of major differentially expressed volatile substances

[0076] Note: ND indicates that the compound was not detected.

[0077] Table 8. Odor threshold, aroma activity value, and flavor intensity of major differentially expressed volatile substances

[0078] Note: ND indicates that the compound was not detected.

[0079] Those skilled in the art will readily understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A Bacillus vesiculosus that produces high levels of aroma-active compounds (B. vesiculosus) Bacillus velezensis Its application in the preparation of flavored fermented black beans is characterized by, The *Bacillus belyssus* described herein is deposited at the China Center for Type Culture Collection (CCTCC) on May 20, 2026, with accession number CCTCC NO: M 20261022, and is classified as *Bacillus belyssus* R1. Bacillus velezensis R1; The application includes the following steps: 1) Soybean pretreatment: Take soaked soybeans, adjust the salt concentration to 3%, sterilize at 121℃ for 20 min, and cool to obtain sterile soybeans for later use; 2) Activation of Bacillus belyssus: Primary activation: Inoculate Bacillus belyssus R1 strain stored at -80℃ into R1 optimized liquid medium at a volume ratio of 1%, and incubate continuously in a constant temperature shaking incubator until the bacterial density OD reaches 1%. 600 The value is not less than 1.0; Secondary activation: Take the bacterial suspension obtained from the first activation and inoculate it at a volume ratio of 1% into a new R1 optimized liquid medium. Place it in a constant temperature shaking incubator and continue culturing until the bacterial suspension density OD reaches 1. 600 A value of not less than 1.0 indicates that activated Bacillus belyss R1 bacterial culture has been obtained; 3) Inoculation and fermentation: Inoculate 100 portions of sterile soybeans obtained in step 1 with 2% of the Bacillus berberis R1 bacterial solution obtained in step 2), and add 6-10 portions of sterile water; then carry out variable temperature fermentation at 37℃-45℃. 4) Secondary fermentation: Take the soybeans obtained in step 3) after temperature-controlled fermentation and ferment them again for 1-3 days at a temperature of 4-15℃ to obtain flavored fermented soybeans. In step 2), the composition of the optimized liquid culture medium R1 is as follows: glucose 30g / L-50g / L, soybean peptone 10.00g / L-20.00g / L, NaCl 0.00g / L-15.00g / L, yeast extract powder 5.00g / L, and pH adjusted to 7. The temperature-controlled fermentation conditions in step 3) are: fermentation at 37℃ for 2-4 days, followed by fermentation at 42℃ for 2-4 days, and then fermentation at 45℃ for 20-28 days.

2. The application according to claim 1, characterized in that, In step 2), the composition of the optimized liquid culture medium R1 is: glucose 31.58 g / L, soybean peptone 17.33 g / L, NaCl 5.00 g / L, yeast extract powder 5.00 g / L, pH=7.

3. The application according to claim 1 or 2, characterized in that, In step 2), the constant temperature incubator is set to 36±1℃ and 150 r / min.

4. The application according to claim 1 or 2, characterized in that, In step 2), the culture time for the first activation is 12-18 hours; the culture time for the second activation is 18-24 hours.

Images