A subcasein lactobacillus hcis-s01 capable of resisting aging, reducing nitrite content, resisting oxidation, resisting bacteria and reducing lipid and application thereof

Abstract

The application discloses a high-efficiency anti-aging and nitrite content reducing and anti-oxidation, anti-bacteria and lipid-reducing Paracaseicilus casei HCIS-S01 and application thereof. The Paracaseicilus casei HCIS-S01 strain provided by the application is separated from Guizhou traditional fermented peppers, the strain can significantly prolong the average life of Caenorhabditis elegans by 52.57%, and improve the movement ability of the Caenorhabditis elegans, and delay the aging and prolong the life of the Caenorhabditis elegans through multiple pathways such as JNK, insulin IIS, sphingolipid, AMPK and autophagy. Meanwhile, the strain has good gastrointestinal tolerance, the degradation rate of nitrite is over 90%, and the strain can reduce the nitrite content in fermented food; the strain is proved to have good anti-oxidation, anti-bacteria and lipid-reducing effects in in-vivo and in-vitro experiments. In conclusion, the strain can be used for developing more products with anti-aging, anti-oxidation, lipid-reducing, anti-bacteria and nitrite content control effects.

Description

Technical Field

[0001] This invention relates to the field of microbiology and biomedicine, specifically to a highly effective anti-aging and life-extending, nitrite-reducing, antioxidant, antibacterial, and lipid-lowering Lactobacillus paracasei HCIS-S01 and its applications. Background Technology

[0002] Numerous studies have confirmed that probiotics possess physiological activities that delay aging and extend healthy lifespan. However, the anti-aging activity and molecular regulatory mechanisms of probiotics exhibit strict strain-specificity: for example, *Lactobacillus plantarum* JBC5 extends lifespan by activating the p38 MAPK signaling pathway, but *Lactobacillus plantarum* WCFS1 has no lifespan-extending effect; *Lactobacillus plantarum* GTB1 delays nematode aging through the SKN-1 / ATFS-1 pathway, but this strain showed no lifespan-extending effect after heat inactivation; heat-inactivated *Lactobacillus plantarum* 133 can extend lifespan by activating the PMK-1-dependent innate immune pathway, but inactivated *Lactobacillus plantarum* PA20 did not show a lifespan-extending effect. Therefore, not all probiotics possess lifespan-extending functions, and most of the currently reported anti-aging strains involve only a single signaling pathway, or their mechanisms of action are still unclear. Thus, further research into highly effective anti-aging and lifespan-extending probiotics is of great practical significance.

[0003] Nitrites are a common harmful byproduct in food processing, especially in the production of pickled and fermented products. Long-term intake poses a carcinogenic risk and is one of the key factors restricting the safety of fermented foods and consumer trust. Currently, utilizing microorganisms to degrade nitrites has become an important strategy to improve the safety of fermented foods. However, the ability of microorganisms to degrade nitrites also shows significant strain specificity. For example, *Pediococcus lactis* TR19 can achieve a degradation rate of over 99%, while *Pediococcus lactis* WZA-PA68 has no degradation effect.

[0004] *Lactobacillus paracasei* is widely found in fermented dairy products and fermented vegetables, is listed in my country's list of microbial strains that can be used in food, and has been proven to have a wide range of health benefits. However, existing literature reports limited effects of *Lactobacillus paracasei* strains such as JS-3, L2, and MJ4 in extending the lifespan of nematodes. For example, the representative strain JS-3, which has been systematically studied, only showed a lifespan extension effect of 28.02%, which, although better than the anti-aging positive control NMN (15.34%), still did not exceed the 30% upper limit. Furthermore, most patent publications on the anti-aging effects of *Lactobacillus paracasei* mainly focus on skin aging, lacking reports on its application to healthy lifespan. On the other hand, existing strains generally suffer from functional limitations; for example, strain JS-3 has only demonstrated anti-aging, antioxidant, and gut microbiota regulation functions, without verification of nitrite degradation, antibacterial, or lipid-lowering functions. In addition, currently, publicly reported *Lactobacillus paracasei* resources possessing both anti-aging and lifespan-extending capabilities as well as nitrite degradation abilities are extremely scarce and have not been reported. Compared to strains with only a single function, strains with multiple functions have a huge advantage. They can achieve synergistic probiotic effects on multiple targets, comprehensively regulate the body's physiological state, simplify product formulation, reduce production and review costs, shorten product launch cycles, and enhance product market competitiveness and added value.

[0005] Therefore, discovering and developing more probiotic strains that integrate highly effective anti-aging and life-extending effects, nitrite reduction, antioxidant, antibacterial, and lipid-lowering effects has broad and practical application value. Therefore, this invention application is proposed. Summary of the Invention

[0006] The technical problem to be solved by this invention is to overcome the shortcomings of existing probiotics that integrate anti-aging, anti-oxidation, antibacterial, lipid-lowering, and nitrite-lowering effects. This invention provides a highly efficient anti-aging and life-prolonging probiotic that can also lower nitrite levels, as well as have antioxidant, antibacterial, and lipid-lowering effects, and its applications.

[0007] The first objective of this invention is to provide a strain of Lactobacillus paracasei ( Lacticaseibacillus paracasei ) HCIS-S01 strain.

[0008] A second objective of this invention is to provide the application of a strain of Lactobacillus paracasei HCIS-S01.

[0009] A third objective of this invention is to provide a method for reducing nitrite content.

[0010] The fourth objective of this invention is to provide a method for inhibiting DPPH free radicals and / or ABTS free radicals, and for anti-aging, anti-oxidation, antibacterial, and lipid-lowering purposes, for non-disease diagnosis and treatment.

[0011] The fifth objective of this invention is to provide a method for anti-aging, life extension, and promoting animal growth and development.

[0012] The above-mentioned objective of this invention is achieved through the following technical solution: This invention provides a strain of Lactobacillus paracasei ( Lacticaseibacillus paracasei The HCIS-S01 strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 24, 2026, with accession number GDMCC No: 67985.

[0013] This invention isolated and identified *Lactobacillus paracasei* strain HCIS-S01 from traditional fermented chili peppers in Guizhou. The 16S rDNA sequence of strain HCIS-S01 is shown in SEQ ID NO.1, with a full length of approximately 1472 bp. Physiological and biochemical analysis revealed that it is a Gram-positive bacterium, morphologically round, smooth, moist, and raised, and milky white or cream-colored. Experimental results showed that strain HCIS-S01 exhibited strong gastrointestinal tolerance and significantly prolonged the lifespan of nematodes through multiple pathways, including targeting the JNK pathway, insulin IIS pathway, sphingolipid pathway, AMPK pathway, and autophagy. It also enhanced nematode motility, increased mitochondrial membrane potential, and reduced apoptosis, demonstrating excellent anti-aging and life-extending potential. Furthermore, this strain significantly reduced nitrite content in both NaNO2 culture medium and pickled chili pepper systems, improving food safety levels. Furthermore, the HCIS-S01 strain exhibits a high free radical scavenging rate, enhances the activity of antioxidant enzymes in the body, reduces ROS accumulation, and demonstrates excellent antioxidant capacity, helping to reduce oxidative damage. It also possesses good antibacterial and lipid-lowering effects. The *Lactobacillus paracasei* HCIS-S01 strain provided by this invention possesses excellent anti-aging and life-extending effects, nitrite-lowering efficacy, and also has antioxidant, antibacterial, and lipid-lowering functions, providing a core and highly valuable patent resource for the development of multi-functional probiotic preparations.

[0014] Therefore, the present invention provides the application of the above-mentioned HCIS-S01 strain or its bacterial suspension and fermentation supernatant in the preparation of products that simultaneously possess anti-aging, antioxidant, antibacterial, lipid-lowering and nitrite-reducing effects.

[0015] Furthermore, the antioxidant properties refer to its significant inhibition of DPPH and / or ABTS free radicals in vitro, and its ability to enhance the activity of antioxidant enzymes and reduce ROS accumulation in nematodes; the antibacterial properties refer to its ability to inhibit the proliferation of Escherichia coli and Staphylococcus aureus in vitro, and to reduce the toxic effects caused by Staphylococcus aureus and Pseudomonas aeruginosa infection in nematodes; the lipid-lowering properties refer to its ability to reduce fat accumulation in nematodes; and the nitrite-reducing properties refer to its ability to reduce the nitrite content in NaNO2 culture medium and pickled pepper system.

[0016] Preferably, the HCIS-S01 strain is used against Escherichia coli, Staphylococcus aureus, and Pseudomonas aeruginosa.

[0017] This invention provides the application of the above-mentioned HCIS-S01 strain or its bacterial suspension and fermentation supernatant in the preparation of products for anti-aging and longevity extension and promotion of animal growth and development.

[0018] Furthermore, the product extends animal lifespan, improves animal mobility, and reduces mitochondrial damage and apoptosis in animals by targeting the JNK pathway, insulin IIS pathway, sphingolipid pathway, AMPK pathway, and / or autophagy pathway, thereby slowing down aging.

[0019] Preferably, the product is a pharmaceutical, feed, or additive thereof.

[0020] This invention provides the application of the above-mentioned HCIS-S01 strain or its bacterial suspension and fermentation supernatant in the preparation of free radical inhibitors.

[0021] Preferably, the free radical inhibitor is used to inhibit DPPH free radicals and / or ABTS free radicals in vitro.

[0022] The aging research model animal used in this invention is *C. elegans* (Caenorhabditis elegans). Caenorhabditis elegans This model is a classic invertebrate and lifespan research model organism, possessing outstanding advantages such as short lifespan, simple structure, strong reproductive capacity, simple living environment, large-scale synchronization, and clear genetic background. Furthermore, many of its genes are highly conserved / homogeneous with mammals (including humans) in evolutionary terms, facilitating in-depth analysis of aging mechanisms at the behavioral, molecular, and genetic levels. Currently, many key theories in the field of aging have been confirmed or validated for the first time in nematodes. Based on these characteristics, nematodes can be used to systematically evaluate core aging phenotypes such as lifespan, motility, stress resistance, and intestinal homeostasis at the individual level, and have been internationally recognized as a classic model for elucidating the molecular mechanisms of aging and screening anti-aging active substances. More importantly, the *Lactobacillus paracasei* HCIS-S01 strain or its bacterial suspension and fermentation supernatant provided by this invention exhibit significant anti-aging and life-extending effects in the nematode model, providing strong preclinical evidence for the preparation of more anti-aging and life-extending products.

[0023] This invention provides a microbial agent product containing Lactobacillus paracasei HCIS-S01 strain or its bacterial suspension and fermentation supernatant.

[0024] This invention provides a method for reducing nitrite content, which involves treating samples with HCIS-S01 strain or its bacterial culture and fermentation supernatant.

[0025] This invention also provides a method for inhibiting DPPH free radicals and / or ABTS free radicals, anti-aging, anti-oxidation, antibacterial, and lipid-lowering purposes for non-disease diagnosis and treatment, using the above-mentioned HCIS-S01 strain or its bacterial suspension or fermentation supernatant for treatment.

[0026] Preferably, the bacterial concentration of the HCIS-S01 strain is not less than 1.4 × 10⁻⁶. 8 CFU / mL.

[0027] More preferably, the bacterial concentration of the HCIS-S01 strain is 7.8 × 10⁻⁶. 8 CFU / mL.

[0028] The present invention also provides a method for anti-aging and life extension and promoting animal growth and development, which involves processing the above-mentioned product.

[0029] Preferably, the animal is a nematode.

[0030] The present invention has the following beneficial effects: This invention provides a *Lactobacillus paracasei* strain HCIS-S01 with multiple active functional effects. Studies show that this strain can extend the lifespan of nematodes through multiple pathways, including the JNK pathway, insulin IIS pathway, sphingolipid pathway, AMPK pathway, and autophagy, without affecting reproductive capacity. It also improves nematode motility, reduces cell apoptosis and mitochondrial damage, thereby slowing down aging. Simultaneously, the HCIS-S01 strain has good nitrite degradation capacity, reducing nitrite content in pickled pepper systems. Furthermore, it enhances the body's antioxidant capacity, mitigates oxidative damage, and also has lipid-lowering and antibacterial effects. *Lactobacillus paracasei* HCIS-S01 can be used to prepare or develop more anti-aging, lifespan-extending, nitrite-lowering, antioxidant, antibacterial, and lipid-lowering products, providing a wider range of highly efficient and comprehensive microbial strain resources. Attached Figure Description

[0031] Figure 1 Phylogenetic tree of Lactobacillus paracasei HCIS-S01.

[0032] Figure 2 To determine the anti-aging ability of *Lactobacillus paracasei* HCIS-S01 in nematodes (A: nematode lifespan determination; B: effect of different concentrations of HCIS-S01 on nematode lifespan; C: effect of HCIS-S01 bacterial suspension and fermentation supernatant on nematode lifespan; D: determination of the number of times the nematode body bends; E: determination of the number of times the nematode head swings; F: determination of the nematode pharyngeal pump frequency; G: determination of the number of nematode eggs laid; H: quantitative map of AO staining affecting nematode cell apoptosis; I: quantitative map of JC-1 staining affecting nematode mitochondrial membrane potential).

[0033] Figure 3 The mechanism of anti-aging and life-prolonging action of Lactobacillus paracasei HCIS-S01 (A: autophagy flux; B: mutant strain CB1370 after strain intervention) daf-2 (mu86) lifespan; C: mutant strain VC8 after strain intervention. jnk-1 (gk7) Lifespan; D: Mutant strain RB1487 after strain intervention. asm-3 (ok1744) Lifespan; E: Mutant strain RB754 after strain intervention. aak-2 (ok524) lifespan).

[0034] Figure 4 The ability of Lactobacillus paracasei HCIS-S01 to reduce nitrite was determined (A: nitrite degradation rate in culture medium; B: nitrite content in pickled pepper system).

[0035] Figure 5 The in vitro and in vivo antioxidant capacity of Lactobacillus paracasei HCIS-S01 was determined (A: DPPH and ABTS free radical scavenging rate; B: ROS content; C: CAT activity; D: SOD content; E: GSH activity; OP50 was the OP50 of Escherichia coli fed to the animal; HCIS-S01 was the live Lactobacillus paracasei HCIS-S01 fed to the animal; Vc positive control).

[0036] Figure 6 The effects of Lactobacillus paracasei HCIS-S01 on in vitro antimicrobial activity and its resistance to pathogenic bacteria in nematodes (A: inhibitory effect of the strain on pathogenic bacteria; B: mean lifespan of nematodes infected with Staphylococcus aureus; C: mean lifespan of nematodes infected with Pseudomonas aeruginosa).

[0037] Figure 7 Oil Red O staining quantitative fluorescence image of the effect of Lactobacillus paracasei HCIS-S01 on lipid accumulation in nematodes.

[0038] Figure 8 The survival rate of Lactobacillus paracasei HCIS-S01 under simulated gastrointestinal conditions. Detailed Implementation

[0039] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0040] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0041] The sample and reagent sources and culture medium formulations used in the examples are as follows: NGM medium: 3 g sodium chloride, 2.50 g tryptone, 17 g agar powder, 25 mL potassium phosphate buffer (1 mol / L), 1 mL CaCl2 solution (1 mol / L), 1 mL MgSO4 solution (1 mol / L), add distilled water to a final volume of 1000 mL, autoclave at 121 °C for 20 min. After the temperature drops to approximately 60 °C, aseptically add 1 mL cholesterol solution (5 mg / mL, dissolved in 95% ethanol), shake well, and pour into plates.

[0042] LB liquid medium: 5 g yeast extract, 10 g tryptone, 10 g NaCl, add distilled water to a final volume of 1000 mL, autoclave at 121 °C for 20 min.

[0043] MRS liquid culture medium: 5 g casein peptone, 10 g beef extract, 5 g yeast extract, 2 g diammonium citrate, 20 g glucose, 5 g sodium acetate, 2 g potassium dihydrogen phosphate, 0.58 g magnesium sulfate, 0.25 g manganese sulfate, then add 1 mL Tween-80 and distilled water to a final volume of 1000 mL.

[0044] Isopropanol Oil Red O dye solution: Weigh 0.05 g of Oil Red O solid dye, add isopropanol to a final volume of 10 mL, mix well and dissolve. Prepare and use immediately.

[0045] JC-1 staining working solution: Dissolve 1 mg of JC-1 solid in 1 mL of DMSO to prepare a JC-1 staining solution with a concentration of 1 mg / mL, and store at -20 ℃.

[0046] Caenorhabditis elegans and Escherichia coli OP50 were purchased from the Caenorhabditis Genetics Center (CGC).

[0047] The kits for measuring reactive oxygen species (ROS) content, superoxide dismutase (SOD) activity, glutathione (GSH) content, and catalase (CAT) activity were obtained from Shanghai Beyotime Biotechnology Co., Ltd.

[0048] Example 1: Isolation and Identification of Strains 1. Isolation of strains The samples were derived from traditional fermented chili peppers from Guizhou. The fermented chili pepper homogenate solution was diluted with sterile physiological saline and serially diluted. The diluted solutions were plated on MRS solid medium and incubated at 37 °C. The plate colonies were isolated and purified, and then cultured in MRS liquid medium for preliminary screening. A strain was obtained and named HCIS-S01.

[0049] 2. Traditional biological identification Colony morphology of strain HCIS-S01 was identified, showing that the colonies were round, smooth, moist, and raised, with a milky white or creamy color. Gram staining revealed purple colonies, and the cells were single-celled and spherical, indicating that this strain is Gram-positive.

[0050] 3. Molecular biological identification Total DNA was extracted from the bacterial strain using a DNA extraction kit. The 16S rDNA gene was amplified by PCR using universal primers 27f (AGAGTTTGATCCTGGCTCAG) and 1492r (TACGGCTACCTTGTTACGACTT). The PCR program was as follows: 98 °C pre-denaturation for 2 min, 98 °C denaturation for 10 s, 55 °C annealing for 10 s, 72 °C extension for 25 s, and 72 °C final extension for 2 min, for 30 cycles. The PCR amplification system consisted of: 1 μL 27F, 1 μL 1492R, 2 μL DNA template, and 22 μL Taq polymerase. The PCR products were analyzed by 1% agarose gel electrophoresis, purified by gel extraction, and then sequenced.

[0051] Sequencing results showed that the 16S rDNA sequence of strain HCIS-S01 is shown in SEQ ID NO.1. Subsequently, the approximately 1472 bp 16S rDNA gene sequence was compared with gene sequences already registered in GenBank, and phylogenetic tree analysis was performed. The results are as follows: Figure 1 As shown, strain HCIS-S01 was found to be related to Lactobacillus paracasei (…). Lacticaseibacillus paracasei R094 was the most similar, with a similarity of 99%. Based on the above morphological characteristics and 16S rDNA gene sequence results, the isolated bacteria should be taxonomically classified under the genus *Lactobacillus*. Lacticaseibacillus Lactobacillus paracasei ( Lacticaseibacillus paracasei The strain was named *Lactobacillus paracasei* (…). Lacticaseibacillus paracasei The accession number is HCIS-S01, and it was deposited at the Guangdong Provincial Center for Microbial Culture Collection (GDMCC) on March 24, 2026. The deposition number is GDMCC No: 67985. The depository is Guangdong Provincial Center for Microbial Culture Collection, and the depository address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangdong Province.

[0052]

[0053] Example 2: Determination of the anti-aging and life-extending ability of Lactobacillus paracasei HCIS-S01 against Caenorhabditis elegans 1. Activation of microbial strains Take 100 μL of Lactobacillus paracasei HCIS-S01 frozen at -80 ℃, inoculate it into 5 mL of MRS liquid medium, and place it in a 37 ℃ biochemical incubator for static culture for 12–16 h to activate the strain.

[0054] 2. Culture and passage of Caenorhabditis elegans Escherichia coli OP50 (OD50) was plated on NGM medium. 600 =1.0) was used as food for nematodes. Then, wild-type Caenorhabditis elegans N2 was picked and placed on the surface of NGM medium and cultured in a 20 ℃ biochemical incubator. During the culture period, the nematodes were transferred to fresh NGM plates coated with E. coli OP50 every 2 days. If a single nematode was passaged, the picking needle was flammed with an alcohol lamp, cooled, and then picked up and transferred to a new NGM medium. If a large number of nematodes were passaged, the nematodes in the medium were washed off with M9 buffer, allowed to stand and settle, the supernatant was discarded, and the nematodes were transferred to a new NGM medium.

[0055] 3. Synchronization of Caenorhabditis elegans The L4 stage nematodes (day 3) were collected into centrifuge tubes. 1 mL of M9 buffer was added to wash away excess E. coli OP50. The tubes were centrifuged and washed 3 times to remove the supernatant. Then, 1 mL of lysis buffer was added and the tubes were shaken thoroughly for 1 min to remove the supernatant. After removing the supernatant, the tubes were centrifuged again with M9 buffer (3000 r / min, 1 min) and washed 3 times to remove excess supernatant. The eggs were retained and transferred to a new NGM plate. The tubes were incubated in a 20 ℃ biochemical incubator. L1 larvae were synchronized after 16 h.

[0056] 4. Lifespan determination of Caenorhabditis elegans Lactobacillus paracasei HCIS-S01 and Escherichia coli OP50 were cultured separately in liquid medium to the logarithmic growth phase. They were then centrifuged at 8000 r / min for 10 min at 4 ℃, the supernatant was removed, and the precipitate was washed 3–4 times with sterile water. After obtaining pure bacterial cells, sterile water was added and the mixture was stirred until a concentration of OD200 was reached. 600=1.0, then 100 μL of bacterial suspension was spread onto NGM plates, with an NGM plate containing only Escherichia coli OP50 serving as a control. 100 L0-stage wild-type *C. elegans* N2 nematodes synchronized in the above steps were picked and spread onto NGM plates containing both *Lactobacillus paracasei* HCIS-S01 and *Escherichia coli* OP50, as well as the control plate, and incubated at 20 ℃. During the oviposition period of *C. elegans* (days 3-6), all surviving nematodes were transferred to freshly spread NGM plates every 24 hours to prevent newly hatched nematodes from affecting the experimental results. After oviposition, surviving nematodes were transferred to corresponding fresh food NGM plates every 2 days. The experiment continued until all nematodes died, and a nematode lifespan curve was plotted.

[0057] The results are as follows Figure 2 As shown in Figure A, compared with the group fed with Escherichia coli OP50, the lifespan of nematodes in the Lactobacillus paracasei HCIS-S01 group was significantly extended, with an average lifespan extended by 52.57%, and both the median and maximum lifespans extended by 7 days.

[0058] 5. Determination of the effects of different concentrations of HCIS-S01 and its supernatant on the lifespan of nematodes Caenorhabditis elegans was cultured using strain HCIS-S01, following the same method as in Example 2. Activated HCIS-S01 cells were cultured in MRS until the logarithmic growth phase, centrifuged at 4 °C and 8000 r / min for 10 min, and the supernatant was collected. The supernatant was then filtered through a 0.22 μm filter to obtain cell-free supernatant for the corresponding strain. The collected bacterial cells were washed three times with sterile water, resuspended, and adjusted to concentrations of OD using M9 buffer. 600 =0.25 (1.40 × 10 8 CFU / mL), 0.50 (2.60×10 8 CFU / mL), 1.00 (7.80×10 8 CFU / mL) and 1.50 (3.60×10 9 (CFU / mL) was used to obtain a bacterial suspension. The lifespan of the nematodes was then determined using the method described above.

[0059] The results are as follows Figure 2 As shown in Figure B, with OD 600 Compared to 0.25, OD 600 After intervention in groups 0.50 and 1.00, the average lifespan of nematodes was significantly extended by 16.91% and 36.56%, respectively. p< 0.05), while OD 600 The 1.50 group showed a lifespan extension of only 2.65%. The effect of strain HCIS-S01 on nematode lifespan exhibited a dose-response relationship.

[0060] Depend on Figure 2 As shown in Figure C, compared with the OP50 control group, the average lifespan of nematodes was significantly extended by 46.89% and 37.84% respectively after intervention in the HCIS-S01 live bacterial suspension group and the fermentation supernatant group. p< 0.05).

[0061] 6. Measurement of the motility of Caenorhabditis elegans Caenorhabditis elegans was cultured using strain HCIS-S01, following the same culture method as in Example 2. A control group was fed only with Escherichia coli OP50. Pharyngeal pump frequency was measured: On days 3, 10, and 14 of culture, five nematodes were randomly selected and placed on fresh NGM plates. After 30 seconds of free movement, one nematode was tracked under a stereomicroscope, and the number of pharyngeal movements was counted within 1 minute. Head movement frequency was measured: On days 3, 10, and 14 of culture, ten nematodes were randomly selected and placed on fresh NGM plates. After 30 seconds of free movement, the number of head movements within 1 minute was observed under a stereomicroscope. A single head movement was defined as the nematode's head moving from one side to the other. Body bending frequency determination: On days 3, 10 and 14 of culture, 10 nematodes were randomly selected and placed on fresh NGM plates. After the nematodes moved freely for 30 seconds, the body bending and swaying frequency of the nematodes within 20 seconds was observed using a stereomicroscope. One body bending refers to the body bending from one direction to another and then returning to the original direction.

[0062] The results are as follows Figure 2 Chinese D-map - Figure 2 As shown in Figure F, compared with the Escherichia coli OP50 group, the Lactobacillus paracasei HCIS-S01 group had 14.10 body flexions per 20 seconds on the 10th day, an increase of 41.00%. p< 0.05), the head-shaking frequency of nematodes increased by 56.77% on day 10 ( p <0.05, the pharyngeal pump frequency increased by 37.89% ( p <0.05), indicating that HCIS-S01 can enhance the motility of nematodes.

[0063] 7. Determination of oviposition rate of Caenorhabditis elegans The number of eggs laid by nematodes can be used as a basis for evaluating their reproductive capacity and is also a standard for assessing their nutrition and physical condition. The anti-aging drugs or strains selected should not impair the organism's reproductive capacity, as studies have found a close correlation between reproductive capacity and aging. Therefore, we verified the effect of *Lactobacillus paracasei* on the reproductive capacity of nematodes. Following the method described in Example 2, *C. elegans* was cultured to the L4 stage using the test strain. Ten or more nematodes were randomly selected and transferred to NGM plates coated with *Lactobacillus paracasei* HCIS-S01 and *Escherichia coli* OP50, respectively. During the nematode oviposition period, adult oviposition was transferred to a new plate every day, while the old plates were kept in a 20°C biochemical incubator until the eggs hatched. The total number of larvae hatched from the fresh plates was counted until oviposition ended.

[0064] The results are as follows Figure 2 As shown in Figure G, there was no significant difference in the total number of eggs laid by nematodes compared with the group fed with E. coli OP50, proving that strain HCIS-S01 does not change the reproductive capacity of nematodes.

[0065] In summary, feeding Lactobacillus paracasei HCIS-S01 does not affect the reproductive capacity of nematodes and can significantly enhance their motility and prolong their healthy lifespan, thus demonstrating good anti-aging and life-extending potential.

[0066] 8. Effects of Lactobacillus paracasei HCIS-S01 on apoptosis and mitochondrial function in nematode cells. (1) Effect of Lactobacillus paracasei HCIS-S01 on apoptosis in nematode cells: Nematodes were cultured for 3-10 days according to the above method, with 10 nematodes in each group. The apoptosis level in the nematode cells was determined by acridine orange staining (AO). Nematodes were picked into centrifuge tubes containing 50 μL M9 buffer, and 100 μL of prepared acridine orange solution (50 μL of OP50 was added to the staining solution to aid staining) was added. The tubes were incubated at 20 ℃ for 3 h. After staining, the nematodes were centrifuged and washed 3 times with M9 buffer. The washed nematodes were then returned to the corresponding bacterial culture for 1 h to remove excess dye. The nematodes were then anesthetized with levamisole and placed in still position. Fluorescence microscopy (excitation fluorescence is blue fluorescence) was used to photograph the nematodes, and the fluorescence images were quantitatively calculated using ImageJ software.

[0067] Statistical results of apoptosis staining (AO staining) are as follows: Figure 2 As shown in Figure H, compared with the OP50 group fed with E. coli on days 3 and 10, the fluorescence intensity of nematodes in the HCIS-S01 group decreased by 25.74% and 42.13%, respectively. p< 0.05 ） This result indicates that the HCIS-S01 strain can significantly inhibit the process of apoptosis in nematodes.

[0068] (2) Effects of *Lactobacillus paracasei* HCIS-S01 on mitochondria in nematodes: Nematodes were cultured according to the above method. On the 10th day of culture, 10 nematodes were randomly selected. The nematodes and the prepared JC-1 staining solution (DMSO was used to dissolve JC-1 to a concentration of 1 mg / mL, and 2 μL of JC-1 at a concentration of 1 mg / mL was added to 1 mL of M9 buffer) were placed in a 1.50 mL centrifuge tube and incubated in the dark for 2 h. Afterward, excess dye was removed with M9 buffer, and finally, the nematodes were treated with levamisole solution until they became immobile. The red fluorescence (emission wavelength approximately 590 nm) and green fluorescence (emission wavelength 529 nm) were observed using an inverted fluorescence microscope, and photographs were taken. The fluorescence images were quantitatively calculated using ImageJ software.

[0069] The results of the effect of Caenorhabditis elegans on mitochondrial membrane potential in vivo are as follows: Figure 2 As shown in Figure I, the degree of decrease in mitochondrial membrane potential can be quantitatively calculated from fluorescence images. Compared with the mitochondrial membrane potential of the E. coli OP50 group on days 3 and 10, the red-green fluorescence ratio of the HCIS-S01 group increased by 35.45% and 35.88%, respectively. p <0.05).

[0070] Example 3 Signal Pathway Measurement 1. Effects of Lactobacillus paracasei HCIS-S01 on autophagy in nematodes: The mutant strain DA2123 was fed with Escherichia coli OP50 and Lactobacillus paracasei HCIS-S01, respectively. lgg-1p::GFP::lgg-1+rol-6 (su1006)(adls2122) (purchased from the Caenorhabditis Genetics Center CGC), green fluorescence (emission wavelength 529 nm) was observed using an inverted fluorescence microscope, photographed and recorded, and quantitative calculations were performed on the fluorescence photographs using ImageJ software.

[0071] lgg-1::GFP The fluorescence statistics of mutant nematodes are as follows: Figure 3 As shown in Figure A, compared with the fluorescence intensity of the Escherichia coli OP50 group on days 3 and 10, the fluorescence intensity of the HCIS-S01 group increased by 26.68% and 15.10%, respectively, indicating that Lactobacillus paracasei HCIS-S01 activated autophagy.

[0072] 2. Determination of signaling pathways for delaying aging: Nematodes were cultured according to the method in Example 2, and the mutant strain CB1370 was selected. daf-2 (mu86), VC8 jnk-1 (gk7), RB754 aak-2 (ok524), RB1487 asm-3(ok1744) (purchased from the Nematode Center CGC) The lifespan of the probiotics was determined according to the method in Example 2 to study the main pathways by which probiotics delay aging.

[0073] The results are as follows Figure 3 Chinese B-map - Figure 3 Figure E shows that, compared with the E. coli OP50 group, after intervention with nematodes, the HCIS-S01 strain... daf-2, jnk-1 , asm-3 , aak-2 The lifespan of the mutant strain did not change significantly. p >0.05). This result indicates that the effect of HCIS-S01 strain in prolonging the lifespan of nematodes is highly dependent on core signaling pathways such as insulin IIS, JNK, sphingolipids, and AMPK.

[0074] Example 4: Determination of the nitrite-lowering ability of Lactobacillus paracasei HCIS-S01 1. Determination of nitrite degradation rate Lactobacillus paracasei HCIS-S01 was inoculated into MRS liquid culture medium and cultured at 37 °C for 18 h. Then, 10% of the culture was inoculated into 10 mL of MRS medium containing 125 mg / L NaNO2 and cultured at 37 °C for 48 h. The culture was centrifuged at 8000 r / min for 5 min, and the supernatant was collected. 2 mL of p-aminobenzenesulfonic acid solution was added, and the mixture was allowed to stand in the dark for 5 min. Then, 1 mL of naphthylethylenediamine hydrochloride solution was added, and the mixture was allowed to stand in the dark for 15 min. Strains with lighter-colored solutions were selected for further screening.

[0075] After activation, the strain was inoculated at a rate of 5% into MRS medium containing 125 mg / L NaNO2 and cultured at 37 ℃ for 48 h. Every 12 h, a suitable amount of culture medium was taken to determine the nitrite content. A blank control containing NaNO2 was used to calculate the nitrite degradation rate of strain HCIS-S01. A standard curve was plotted using the naphthylethylenediamine hydrochloride method.

[0076] The formula for calculating the nitrite degradation rate is as follows: ; The results are as follows Figure 4 Figure A shows that strain HCIS-S01 has a good degradation effect on nitrite, with a degradation rate of 90±0.09%.

[0077] 2. Determination of the ability of Lactobacillus paracasei HCIS-S01 to degrade nitrite in pickled pepper system (1) Fermentation method: After cleaning and drying the fermentation tank, weigh out 250 g of edible salt and 40 g of sugar cubes and dissolve them in 5 L of sterilized water. After cleaning and drying the required materials, add them to the cooled fermentation liquid, including 15 green peppers, 20 g of Sichuan peppercorns, and 5 g of dried star anise, so that the fermentation liquid completely submerges the green peppers, and inoculate with 2 mL of 3.60×10 8 Lactobacillus paracasei HCIS-S01 at a concentration of CFU / mL was fermented at room temperature for seven days.

[0078] (2) Determination of nitrite content in pickled peppers: The nitrite content in fermented foods was determined according to the standard spectrophotometer method. Fermentation liquid and solid samples were taken separately. The solid sample was ground with sterile water at a mass ratio of 1:1, filtered through cotton cloth, and then impurities were removed by passing it through a 0.45 μm filter membrane. 1 mL of the sample solution was added to 200 μL of phosphate buffer, 100 μL of zinc sulfate solution, 100 μL of p-aminobenzenesulfonic acid solution, and 100 μL of naphthylethylenediamine hydrochloride solution. After reacting in the dark for 15 min, the absorbance was measured at 518 nm.

[0079] The results are as follows Figure 4 As shown in Figure B, in the pickled pepper system, compared with natural fermentation, the nitrite content in the fermentation broth and the pickled pepper system was reduced by 64.19% and 76.65% respectively after treatment with strain HCIS-S01. This indicates that strain HCIS-S01 can significantly reduce the nitrite content in the fermentation system and improve the hygiene and safety of fermented food.

[0080] Example 5: Determination of the antioxidant properties of Lactobacillus paracasei HCIS-S01 strain 1. In vitro antioxidant capacity assay (1) DPPH free radical scavenging rate: The activated HCIS-S01 strain was inoculated into MRS medium and cultured at 37 ℃ for 24 h. The supernatant was collected by centrifugation at 4 ℃ and 10000 r / min for 10 min. DPPH reagent was prepared. 20 mg of DPPH powder was weighed and dissolved in 250 mL of anhydrous ethanol (prepared fresh and used immediately, according to the required amount). Anhydrous ethanol and sample solution (supernatant) were added to a 96-well plate for reaction. After adding the supernatant, DPPH and anhydrous ethanol were added separately. The plate was shaken for 10 seconds in an ELISA reader and reacted in the dark for 30 min. The absorbance was measured at 517 nm and calculated. At the same time, vitamin C was used as a positive control group.

[0081] The formula for calculating DPPH free radical scavenging rate is as follows: ; In the formula: A i : Supernatant + DPPH; A rA0: Supernatant + Anhydrous Ethanol; A0: DPPH + Anhydrous Ethanol.

[0082] The results are as follows Figure 5 As shown in Figure A, the HCIS-S01 strain achieved a DPPH free radical scavenging rate of 90.71%, which is similar to the scavenging rate of the positive control Vc.

[0083] (2) ABTS radical scavenging rate: 5 mL of 7 mmol / L ABTS solution was mixed with 88 µL of 140 mmol / L potassium persulfate solution. The mixture was then allowed to stand at room temperature in the dark for 12 h to prepare the ABTS working solution. Before use, the solution was diluted with distilled water to a absorbance of 0.70 ± 0.02 at 734 nm and stored in the dark. The fermentation supernatant was used as the sample solution. The solution was added to the blank tube, control tube, and sample tube. After thorough mixing, the solution was allowed to stand at room temperature in the dark for 15 min. The absorbance was measured at 734 nm and the ABTS radical scavenging rate was calculated. All samples were tested three times.

[0084] The formula for calculating the ABTS free radical scavenging rate is as follows: ; The results are as follows Figure 5 As shown in Figure A, the HCIS-S01 strain had a 63.99% ABTS free radical scavenging rate, which was slightly lower than the positive control, but it still showed good antioxidant activity.

[0085] 2. Determination of antioxidant activity in Caenorhabditis elegans (1) *C. elegans* was cultured using *Lactobacillus paracasei* HCIS-S01 strain. *Escherichia coli* OP50 was used as a control group. After culturing for 3 days in the L4 stage, the nematodes were collected, washed three times with M9 buffer, and allowed to settle naturally. The nematodes were then homogenized on ice, centrifuged at 4000 r / min at 4 ℃, and the supernatant was collected as the protein homogenate. The levels of reactive oxygen species (ROS), catalase (CAT) activity, superoxide dismutase (SOD) activity, and glutathione (GSH) content were determined according to the kit instructions.

[0086] (2) Determination of reactive oxygen species (ROS) level: 50 μL of protein homogenate and 50 μL of freshly prepared 100 mmol / L H2-DCF-DA solution were added to a 96-well black plate (final concentration of 50 mmol / L) and treated for 3 h. The content of reactive oxygen species in vivo was measured by a fluorescence microplate reader at an excitation wavelength of 485 nm and an emission wavelength of 535 nm.

[0087] (3) Catalase (CAT) activity assay: Prepare catalase detection buffer, 250 mM hydrogen peroxide solution and catalase reaction termination solution according to the kit instructions. Add samples to the control group and the sample group. After incubation at 25 °C for at least 15 min, measure the absorbance at 520 nm.

[0088] (4) Superoxide dismutase (SOD) activity assay: Prepare SOD detection buffer, WST-8 / enzyme working solution and reaction start solution. Prepare sample group and blank group according to the sample addition amount of the kit. After incubation at 37 ℃ for 30 min, measure absorbance at 450 nm.

[0089] (5) Glutathione (GSH) content determination: After preparing GSH stock solution, DTNB stock solution and NADPH stock solution according to the kit, add the control group and sample group, and immediately measure the absorbance at 412 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0090] The results are as follows Figure 5 Chinese B-map - Figure 5 As shown in Figure E, compared with the control group of Escherichia coli OP50, the ROS level in nematodes fed with Lactobacillus paracasei HCIS-S01 decreased by 37.61%. p <0.05); CAT activity increased by 49.38% ( p <0.05%, SOD activity increased by 22.71% ( p <0.05%, GSH content increased by 12.98% ( p <0.05), the above results indicate that Lactobacillus paracasei HCIS-S01 can reduce ROS accumulation in nematodes by increasing SOD levels, CAT enzyme activity and GSH content, thereby enhancing the antioxidant capacity of nematodes and slowing down oxidative damage.

[0091] Example 6: Determination of the antibacterial activity of Lactobacillus paracasei HCIS-S01 1. In vitro antibacterial properties of Lactobacillus paracasei HCIS-S01 The antibacterial activity of cell-free fermentation supernatant of probiotics was determined using the Oxford cup method. *Escherichia coli* ATCC25922 and *Staphylococcus aureus* ATCC6538 (purchased from American Type Culture Collection (ATCC)) were inoculated into LB liquid medium and cultured at 37 °C with shaking until the logarithmic growth phase. The medium was then diluted appropriately with physiological saline to an OD concentration. 600After reaching a concentration of 0.8, a suitable amount of bacterial culture was mixed with LB medium cooled to approximately 50 °C and quickly poured into agar plates containing sterile Oxford cups. Once the medium had fully solidified, the Oxford cups were gently removed. 200 μL of cell-free probiotic fermentation supernatant filtered through a 0.22 μm membrane was added to each well. After pre-diffusion at 4 °C for 4 h, the plates were incubated at 37 °C for 24 h. The diameter of the inhibition zone was measured and recorded using calipers, with three replicates per group.

[0092] In vitro antibacterial results as follows Figure 6 As shown in Figure A, the inhibition zone of strain HCIS-S01 against Escherichia coli was 14.23 mm, and the inhibition zone against Staphylococcus aureus was 18.07 mm, indicating that strain HCIS-S01 has good antibacterial activity.

[0093] 2. In vivo antibacterial properties of Lactobacillus paracasei HCIS-S01 Nematodes were cultured according to the method in Example 2. Caenorhabditis elegans worms cultured to the L4 stage were selected and placed in a solution containing OD400. 600 Staphylococcus aureus ATCC6538 and Pseudomonas aeruginosa ATCC 15692 (purchased from ATCC) NGM plates were prepared at a concentration of 0.1 μL. Each petri dish contained 20 nematodes, and each treatment group had 3 plates. The plates were incubated at 20 °C in a biochemical incubator. Every day, the plates were transferred to fresh plates coated with Staphylococcus aureus and Pseudomonas aeruginosa until all the tested nematodes died, and nematode lifespan curves were plotted.

[0094] The results are as follows Figure 6 China B map - Figure 6 As shown in Figure C, compared with the average and maximum lifespan of *Escherichia coli* OP50 group nematodes infected with *Staphylococcus aureus*, the average lifespan of nematodes in the HCIS-S01 group was extended by 29.48%, and the maximum lifespan was extended by 2 days. p <0.05); Compared with the mean and maximum lifespan of the Escherichia coli OP50 group nematodes infected with Pseudomonas aeruginosa, the mean lifespan of nematodes after HCIS-S01 intervention was extended by 23.65%, and the maximum lifespan was extended by 6 days. p The value <0.05 indicates that HCIS-S01 has the potential to reduce the toxic effects of harmful bacteria such as Staphylococcus aureus and Pseudomonas aeruginosa.

[0095] Example 7 Evaluation of the lipid-lowering ability of Lactobacillus paracasei HCIS-S01 strain Lactobacillus paracasei HCIS-S01 and Escherichia coli OP50 were cultured to the logarithmic growth phase in liquid medium, following the same cultivation method as in Example 2. The culture was centrifuged at 8000 r / min for 10 min at 4°C, the supernatant was removed, and the precipitate was washed 3–4 times with sterile water. After obtaining pure bacterial cells 2, sterile water was added and the mixture was stirred until a concentration of OD200 was achieved. 600 =1.0, then 100 μL of bacterial suspension was spread onto NGM plates, with NGM plates containing only E. coli OP50 as a control. Ten L4 stage wild-type Caenorhabditis elegans N2 worms were selected and grown to the stage of L4 at 20 ℃ according to the above steps, washed three times with M9 buffer, anesthetized with 25 mM levamisole hydrochloride, added 200 μL of 4% paraformaldehyde solution and allowed to stand for 15-20 min, then the solution was removed and the worms were freeze-thawed three times with liquid nitrogen, then stained with 60% isopropanol red oil O, and after 4-5 h, excess dye was washed off with M9 buffer, observed with an optical microscope, and the lipid red optical density was analyzed with ImageJ software.

[0096] The results are as follows Figure 7 As shown, compared with the OP50 group fed with Escherichia coli on days 3 and 10, the HCIS-S01 group fed with Lactobacillus paracasei showed a significant reduction in fat red light density of nematodes on days 3 and 10, respectively, indicating that the HCIS-S01 strain can significantly reduce fat accumulation in nematodes and has a good lipid-lowering ability.

[0097] Example 8. Gastrointestinal tolerance of Lactobacillus paracasei HCIS-S01 strain Simulated saliva preparation: 6.20 g / L NaCl, 2.20 g / L KCl, 0.22 g / L CaCl2, 1.20 g / L NaHCO3, lysozyme 100 mg / L, pH=6.90; Simulated gastric juice preparation: 6.20 g / L NaCl, 2.20 g / L KCl, 0.22 g / L CaCl2, 1.20 g / L NaHCO3, 3 g / L pepsin, pH=2.50; Simulated pancreatic juice preparation: 1.28 g / L NaCl, 0.23 g / L KCl, 6.40 g / L NaHCO3, 0.50% bile extract, 0.10% pancreatic enzyme, pH = 7.20.

[0098] Lactobacillus paracasei HCIS-S01 was inoculated into MRS medium and cultured at 37 ℃ for 24 h. 1.50 mL of the bacterial culture was reacted with 1.50 mL of simulated saliva for 5 min, 3 mL of the reaction solution was reacted with 5 mL of simulated gastric juice for 1 h, and then 1 mL of gastric juice was reacted with 4 mL of simulated pancreatic juice for 1 h and 2 h. The absorbance was measured at 600 nm. The experiment was repeated three times. The survival rate was calculated using the following formula: ; In the formula: t0: absorbance value before reaction; t1: absorbance after reaction.

[0099] The results are as follows Figure 8 As shown, the survival rate of strain HCIS-S01 was 76.00% under simulated gastric fluid environment; and 46.33% after 2 hours under simulated intestinal fluid pancreatic enzyme treatment. Intestinal simulation is a prerequisite for the strain to successfully reach the intestine, regulate intestinal homeostasis, and exert antioxidant and anti-aging effects. The results indicate that strain HCIS-S01 has good gastrointestinal tolerance and can better exert its anti-aging and life-prolonging effects.

[0100] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A strain of Lactobacillus paracasei ( Lacticaseibacillus paracasei HCIS-S01 strain, characterized in that, This strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 24, 2026, with accession number GDMCC No: 67985.

2. The application of the HCIS-S01 strain or its bacterial suspension as described in claim 1 in the preparation of products that simultaneously possess anti-aging, antioxidant, antibacterial, lipid-lowering, and nitrite-reducing effects.

3. The use of the HCIS-S01 strain or its suspension as described in claim 1 in the preparation of anti-aging products.

4. The application according to claim 3, characterized in that, The product extends animal lifespan, improves animal mobility, and reduces mitochondrial damage and apoptosis by targeting the JNK pathway, insulin IIS pathway, sphingolipid pathway, AMPK pathway, and / or autophagy pathway, thereby slowing down aging.

5. A microbial agent product, characterized in that, Contains the HCIS-S01 strain or its suspension as described in claim 1.

6. A method for reducing nitrite content, characterized in that, The sample was treated with the HCIS-S01 strain or its bacterial suspension as described in claim 1.

Images