Recombinant bacteria with high yield of d-chiro-inositol and application thereof

CN122587964APending Publication Date: 2026-08-18JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610662150.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-14
Publication Date
2026-08-18

AI Technical Summary

Technical Problem

[0007]为此,本发明所要解决的技术问题在于克服现有技术中缺乏一种能够实现高密度发酵且高效从头合成DCI的大肠杆菌细胞工厂构建策略的问题

Benefits of technology

[0032] This invention utilizes *E. coli* with a well-defined genetic background as a chassis. By constructing a high precursor supply platform, introducing a suitable heterologous synthetic pathway, and establishing a carbon metabolism network at the system's regulatory center, it overcomes existing bottlenecks, achieving efficient de novo synthesis of diclofenac (DCI) and improving DCI conversion rate. The recombinant *E. coli* strain provided by this invention enables efficient de novo DCI synthesis and meets the requirements for high-density production, thus laying the foundation for further metabolic engineering of *E. coli* to improve DCI synthesis. The recombinant *E. coli* construction method provided by this invention is simple, easy to use, and shows promising prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122587964A_ABST
    Figure CN122587964A_ABST
Patent Text Reader

Abstract

The application relates to an Escherichia coli with high D-chiro-inositol yield and application thereof, and belongs to the technical field of biotechnology. The application firstly introduces an efficient heterologous biosynthesis pathway to endow the Escherichia coli with the ability of de novo synthesis of DCI; secondly, a high-yield precursor chassis cell is constructed by knocking out a pgi gene to block a competitive branch; on this basis, the zwf gene expression is down-regulated to balance cell growth and precursor supply, and the glf and glk genes are overexpressed to reconfigure a glucose transport and phosphorylation system, so that by constructing a high-precursor supply platform, introducing an adaptive heterologous synthesis pathway and systemically regulating a central carbon metabolic network, the existing bottleneck is overcome, efficient de novo synthesis of DCI is realized, and the conversion rate of D-chiro-inositol is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a recombinant bacterium that produces high levels of D-chiral inositol and its applications. Background Technology

[0002] D-chiro-inositol (DCI) is one of the nine stereoisomers of inositol and possesses important pharmacological activities and biological functions. Studies have shown that DCI is an effective insulin sensitizer, playing a key role in insulin signaling and significantly improving insulin resistance and lowering blood glucose levels. Clinically, DCI is widely used as adjunctive therapy for type 2 diabetes. Importantly, DCI, when combined with its precursor myo-inositol (MI) in a specific ratio (e.g., 40:1), has shown significant efficacy in treating polycystic ovary syndrome (PCOS), improving ovulation function and hormone metabolism levels in patients.

[0003] With the surge in the number of people with diabetes and metabolic syndrome worldwide, the market demand for high-purity, low-cost diethyl precipitate (DCI) continues to rise. Traditional DCI production mainly relies on extraction from natural plants (such as buckwheat and soybeans) or chemical synthesis. However, plant extraction methods are limited by factors such as extremely low DCI content in raw materials, strong seasonality, and complex extraction and purification processes, resulting in high production costs. Chemical synthesis methods suffer from numerous reaction steps, poor stereoselectivity, and severe environmental pollution, making it difficult to meet the requirements of green manufacturing. Therefore, utilizing metabolic engineering and synthetic biology techniques to construct microbial cell factories to achieve green and efficient biosynthesis of DCI has become a research hotspot in the current field of biomanufacturing.

[0004] Currently, the technical routes for producing DCI using microorganisms are mainly divided into two categories: whole-cell biotransformation and de novo biosynthesis. Whole-cell biotransformation typically uses inositol (MI) as a substrate, converting it into DCI using engineered strains expressing inositol dehydrogenase (such as IolG from Bacillus subtilis). Although this method has a high conversion rate, it is extremely dependent on the expensive precursor MI as a raw material, thus limiting the economic viability of the final product.

[0005] To reduce costs, researchers began exploring "de novo biosynthesis" using inexpensive glucose as a single carbon source. This route requires introducing a complete synthetic pathway into microorganisms (such as Escherichia coli, Bacillus subtilis, or Saccharomyces cerevisiae): first, glucose is converted to glucose-6-phosphate (G6P) via glycolysis, then the precursor MI is generated via inositol-1-phosphate synthase (ino1) and inositol monophosphatase (suhB / IMP), and finally, MI is converted to DCI via heterologously expressed inositol isomerase / oxidoreductase.

[0006] In *E. coli*, remodeling of the central carbon metabolism network is often necessary to improve de novo synthesis efficiency. For example, knocking out the phosphoglucose isomerase gene (pgi) can block G6P from entering the glycolysis pathway, theoretically maximizing the carbon flux directed towards product synthesis. Furthermore, introducing exogenous highly active enzyme elements (such as plant-derived oxidoreductases) is also a key approach to constructing DCI synthetic pathways. Despite the enormous application potential of microbial de novo DCI synthesis, existing technologies still suffer from significant drawbacks and bottlenecks in practical applications: the conflict between precursor supply and cell growth; severe competitive pathway diversion; and limited substrate uptake efficiency, ultimately limiting DCI conversion rates. Summary of the Invention

[0007] Therefore, the technical problem to be solved by the present invention is to overcome the lack of an E. coli cell factory construction strategy in the prior art that can achieve high-density fermentation and efficient de novo synthesis of DCI.

[0008] To address the aforementioned technical problems, this invention provides a recombinant strain that produces high levels of D-chiral inositol and its applications. In existing technologies, the de novo synthesis of D-chiral inositol (DCI) by microorganisms mainly relies on hosts such as Corynebacterium glutamicum, Bacillus subtilis, and Saccharomyces cerevisiae. However, these expression systems are often limited by slow growth rates or complex metabolic backgrounds, resulting in low production efficiency and long fermentation cycles. Therefore, this invention uses *Escherichia coli*, with its well-defined genetic background, as a chassis. By constructing a high precursor supply platform, introducing a suitable heterologous biosynthetic pathway, and establishing a carbon metabolism network at the system's regulatory center, this invention overcomes existing bottlenecks and achieves highly efficient de novo synthesis of DCI. Specifically, this invention first endows *E. coli* with the ability to synthesize DCI de novo by introducing an efficient heterologous biosynthetic pathway; secondly, by knocking out the pgi gene to block competitive pathways, a high-producible precursor chassis cell is constructed; based on this, the expression of the zwf gene is downregulated to balance cell growth and precursor supply, and the glf and glk genes are overexpressed in conjunction to reconstruct the glucose transport and phosphorylation system, ultimately achieving a significant breakthrough in DCI conversion rate and highly efficient de novo synthesis.

[0009] The first objective of this invention is to provide a recombinant bacterium that produces high levels of D-chiral inositol. This recombinant bacterium is based on *Escherichia coli* strain, with the following modifications: knockout of the phosphoglucose isomerase coding gene (pgi) and the araBAD coding region of the arabinose operon; reduction of glucose-6-phosphate 1-dehydrogenase (zwf); overexpression of glucose transporter (glf), inositol-1-phosphate synthase (ino1), inositol monophosphatase (suhB), D-monomenthol dehydrogenase (MtOEPa), and D-pinelol dehydrogenase (MtOEPb); and replacement of the glucose-specific PTS enzyme IIBC component gene (ptsG) with the glucokinase coding gene (glk).

[0010] Among them, D-manganol dehydrogenase is enhanced by the RBS sequence shown in SEQ ID NO.1, and D-pineol dehydrogenase is enhanced by the RBS sequence shown in SEQ ID NO.2.

[0011] Furthermore, the SEQ ID NO.1: aaaggaggtgataaaa.

[0012] Furthermore, SEQ ID NO.2:

[0013] GTAATCACAACCTTTGTTTAAGTTTAAGAAGGAGGTATACC.

[0014] Furthermore, the expression of the glucose-6-phosphate 1-dehydrogenase is regulated by the RBS sequence shown in SEQ ID NO.3.

[0015] Furthermore, the SEQ ID NO.3 is: CAATTGGGAgTAAACC.

[0016] Furthermore, the glucose transporter is expressed via RBS as shown in SEQ ID NO.4, and the glucokinase is expressed via RBS as shown in SEQ ID NO.5.

[0017] Furthermore, SEQ ID NO.4: ACCTAGGGAGGATTTTAT.

[0018] Furthermore, SEQ ID NO.5:

[0019] CTTAAGATTAACTCACACAAGGAGGTATGTG.

[0020] Further, the NCBI number of the phosphogluconoisomerase is 948535, the NCBI number of araB in the coding region of the araBAD araose operon is 946017, the NCBI number of araA is 947511, the NCBI number of araD is 945294, the NCBI number of the glucose-6-phosphate 1-dehydrogenase is 946370, the NCBI number of the glucose transporter is 79904430, the NCBI number of the inositol-1-phosphate synthase is 853288, the NCBI number of the inositol monophosphatase is 947025, the gene sequence encoding the D-monosodium dehydrogenase MtOEPa is shown in SEQ ID NO.6, the gene sequence encoding the D-pinel dehydrogenase MtOEPb is shown in SEQ ID NO.7, the NCBI number of the glucokinase is 946858, and the NCBI number of the glucose-specific PTS enzyme IIBC component gene is 945652.

[0021] Furthermore, SEQ ID NO.6:

[0022] ATGTCAAAAACTGTATGTGTTACAGGAGCTTCAGGTGCAATCGGTAGCTGGGTTGTGCGTCTGTTGCTGGAGCGCGGCTATACCGTTCATGCGACCATCCAAGATCTGGAGGATGAAAACGAGACGAAACACCTCGAAGCCATGGAAGGTGCGAAAACTCGCTTGAAGTTTTTCGAAATGGATCTGCTGAATAGCGACTCGATTGCGGCGGCGGTGAAGGGTTGTGCTGGCGTGATTCACCTGGCGTGTCCGAATATAATTGGTGAAGTTAAGGACCCGGAAAAACAGATCTTGGAACCCGCCATCCAGGGAACCGTGAACGTGCTTAAGGTTGCTAAAGAGGCCGGCGTGGAGCGTGTAGTTGCGACGAGCAGCATCTCCGCAATTATCCCGAGCCCGTCCTGGCCGGCTGATAAAATTAAAGCTGAGGACTGCTGGACCGACTTGGAGTACTGCAAAGAGAAGAAACTGTACTACCCGATTGCGAAAACCCTGGCGGAAAAGGCGGGCTGGGAATTTGCAAAGGAGACTGGTTTCGATGTTGTCATGATCAACCCGGGCACCGCACTGGGTCCGCTGATTCCACCGCGTATTAACTCTTCTATGGCCGTGCTGGCGGGCGTTTTGAAGGGCGATAAGGAAACCTATGAAGACTTCTTCATGGGTATGGCACACTTTAAGGACATCGCGTTAGCTCACATCCTGGGCTTCGAGCAAAAAAAAGCGTCCGGTCGTCATCTTTGCGTCGAGGCAATCCGTCATTATAGCGACTTTGTTAATCTGGTGGCGGAGCTGTACCCTGAATACAACGTCGCCAAGATCCCGACGGATACCCAGCCGGGTCTACTGCGTGCGAAAAACGCTAGCAAAAAACTGATCGAATTGGGTCTGGAGTTCACCCCGGCGGAGGAAATTATTAAGGACGCTGTTGAGTGCCTGAAGAGCCGCGGCCTGGTGTAA。

[0023] Furthermore, SEQ ID NO.7:

[0024] ATGGCTGGAAATAAAATACCCGAAGTACTATTGAATAGCGGTCATAAAATGCCGGTTATTGGTATGGGTACGAGCGTTGACAACCGCCCTAGCAATGATGTTCTGGCGTCGATTTTCGTGGACGCGATTAAGGTGGGTTATCGTCACTTTGACAGCGCATCCGTGTACGGCACCGAGGAGGCAATTGGCATGGCGGTGGCTAAGGCCTTGGAGCAGGGTCTGATCAAGAGCCGTGATGAACTGTTTATCACCAGCAAACCGTGGAACACCGATGCGGATTATGATCTGATCGTTCCGGCGCTGAAAACCACACTGAAGAAACTGGGCACTGAATATGTTGATCTGTACCTGATTCATTGGCCAGTTCGTCTGCGCCACGATCTAGAGAACCCGGTCATCTTCACCAAAGAGGACTTGCTGCCGTTTGACATCGAAGGTACGTGGAAAGCGATGGAAGAGTGCTATAAACTTGGCCTGGCGAAGTCTATTGGAATTTGCAACTACGGTACGAAGAAGCTTACCAAGTTGTTGGAAACCGCAACCATTACTCCGGCTGTGAATCAAGTCGAGATGAATCCGAGCTGGCAGCAGGGCAAGCTGAGAGAATTCTGCAAAGAGAAGGGCATCCACGTGAGCGCGTGGTCCGCGCTGGGTGCCTACAAAGTGACCTGGGGTAGTGGCGCAGTTGTCGAAAACCAGATCCTCCAAGATATCGCCGCAGCTAAAGGAAAAACGACCGCGCAAGTAGCGCTCCGCTGGGTTTACCAAATCGGCTCTAGCGCTATGGCCAAGTCCTTTAACAAGGAACGTATGACCCAAAACCTGGAGATCTTCGACTTCGAACTGTCGGAAGACGACTTGGAGAAGATCAAACAGATTCCGCAGCGTCGTCAGTACCTGGGCGACATGTGGCTGTCCGAGAACGGCTCTTGTAAAACCCTGGAAGAGTTATGGGATGGTGACGTGTAA。

[0025] Furthermore, the *E. coli* includes *E. coli* BL21 (DE3).

[0026] A second objective of this invention is to provide a microbial agent containing the aforementioned recombinant bacteria.

[0027] A third objective of this invention is to provide the application of the above-mentioned recombinant bacteria or the above-mentioned microbial agents in the preparation of D-chiral inositol.

[0028] A fourth objective of the present invention is to provide a method for improving the conversion rate of D-chiral inositol, wherein the method involves inoculating the above-mentioned recombinant bacteria or the above-mentioned microbial agent into a fermentation medium for fermentation culture.

[0029] Furthermore, arabinose and IPTG are added during the fermentation process to induce expression.

[0030] Furthermore, the inoculum size for the fermentation culture is 1%-10%.

[0031] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:

[0032] This invention utilizes *E. coli* with a well-defined genetic background as a chassis. By constructing a high precursor supply platform, introducing a suitable heterologous synthetic pathway, and establishing a carbon metabolism network at the system's regulatory center, it overcomes existing bottlenecks, achieving efficient de novo synthesis of diclofenac (DCI) and improving DCI conversion rate. The recombinant *E. coli* strain provided by this invention enables efficient de novo DCI synthesis and meets the requirements for high-density production, thus laying the foundation for further metabolic engineering of *E. coli* to improve DCI synthesis. The recombinant *E. coli* construction method provided by this invention is simple, easy to use, and shows promising prospects. Attached Figure Description

[0033] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0034] Figure 1 This is a schematic diagram of de novo DCI synthesis;

[0035] Figure 2 This is a schematic diagram of plasmid construction;

[0036] Figure 3 It is a plasmid map;

[0037] Figure 4 It is the shake-flask fermentation curve of the engineered strain;

[0038] Figure 5 This is a graph representing the optimized shake-flask fermentation results;

[0039] Figure 6This is a graph showing the reduction of chiral inositol production in zwf;

[0040] Figure 7 This is a diagram showing the synergistic regulation of chiral inositol production by glf and glk;

[0041] Figure 8 This is the result curve within the 5-L bioreactor of the present invention. Detailed Implementation

[0042] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0043] DNA polymerase was purchased from Takara, restriction endonucleases and T4 ligases were purchased from NEB, plasmid extraction kits were purchased from Sangon Biotech (Shanghai) Co., Ltd., and PCR product nucleic acid purification kits were purchased from ThermoScientific.

[0044] Cells were cultured in LB medium and fermented in TB medium. LB medium contained: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl. TB medium contained: 12 g / L tryptone, 24 g / L yeast extract, 5 g / L glycerol, 16.42 g / L dipotassium hydrogen phosphate trihydrate, and 2.31 g / L potassium dihydrogen phosphate. The final concentrations of kanamycin, spectinomycin, IPTG, and arabinose in the medium were 50 μg / mL, 50 μg / mL, 1 mM, and 10 mM, respectively.

[0045] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, cell biology, recombinant DNA technology, and related fields, which have been well described in existing literature.

[0046] Example 1: Construction of engineered strains

[0047] Based on the designed synthetic route of DCI in *E. coli*, an engineered strain was constructed. Starting from wild-type BL21(DE3), gene editing was performed using CRISPR / Cpf1 gene editing technology. pgi was knocked out to block carbon flux to the TCA cycle, zwf was downregulated to reduce excessive G6P flow to the PPP pathway, glf derived from *Modomonas* was introduced into the galR site of the *E. coli* genome, ptsG was replaced with glk from the *E. coli* genome, and the araBAD gene was knocked out to facilitate the subsequent use of the arabinose promoter.

[0048] Table 1 Primers used in gene editing

[0049]

[0050]

[0051] Example 2: Construction of a heterologous synthesis pathway for DCI

[0052] Based on the above figure, a heterologous synthesis pathway plasmid was constructed in E. coli. Based on the sequence information of *Escherichia coli* BL21(DE3), primers IMP-f: 5'-TAAGATTCGAAGAGAGATTGTTGTAAAAGGAGATATAATGCATCCGATGCTGAACATCG-3' and IMP-r: 5'-AGCAGACTGTTACttaacgcttcagagcgtcgct-3' were designed. These primers were used to amplify the suhB gene (which produces the enzyme IMP after expression) using *E. coli* BL21(DE3) as a template. Based on the sequence of *Saccharomyces cerevisiae*, primers IPS-F: 5'-ATGACCGAAGACAACATCGCTCCGATCACCTCTGTTAAAGTTGTTACCGACAAGTGCACGTACAAGGACAACG-3' and IPS-R: 5'-TGCATTATATCTCCTTTTACAACAATCTCTCTTCGAATCTTAGTTCGTTTTGAG -3', the ino1 gene was amplified using *Saccharomyces cerevisiae* as a template, and the vector was obtained by reverse amplification using pACYCDuet plasmid as a template. The above fragment was then used to construct the recombinant expression plasmid IPS-IMP using the Gibson Assembly Clonging Kit (New England Biolabs). Colony PCR and sequencing confirmed successful plasmid construction. Codon optimization was performed at GenScript, and the genes OEPa and OEPb were synthesized. The vector was obtained by reverse amplification using pET28a plasmid as a template. The gene fragment was then used to construct the recombinant expression plasmid MtOEPA-B using the Gibson Assembly Clonging Kit (New England Biolabs). Colony PCR and sequencing confirmed successful plasmid construction.

[0053] Example 3: Shake-flask fermentation verification and OEPa and OEPb expression optimization

[0054] The engineered bacterial strain constructed earlier was prepared into competent cells using a kit. The plasmid expressing the heterologous pathway gene was chemically transformed into the engineered strain and plated on kanamycin and spectinomycin-resistant plates. After single colonies grew, colony PCR verification was performed. Strains with correct sequencing were selected, preserved, and fermentation began. Single colonies from the plates were inoculated into LB medium containing the two antibiotics and cultured as a primary seed culture at 37°C and 220 rpm for 12 hours. Then, 1% of the inoculum was transferred to 250 mL shake flasks containing 50 mL of TB medium (containing the two antibiotics and 20 g / L glucose as substrate). The culture was then carried out at 37°C and 220 rpm for 3 hours. Then, arabinose and IPTG were added for induction. After induction, the culture conditions were changed to 30°C and 220 rpm for 48 hours of fermentation. Figure 4 As shown, the heterologous pathway was successfully introduced into *E. coli*, resulting in the synthesis of DCI at a yield of 0.76 g / L and the accumulation of precursor MI at 9.66 g / L. Although DCI synthesis was achieved, the results indicate that inositol dehydrogenase and inositol isomerase are the key rate-limiting steps in DCI synthesis. The expression of the enzymes MtOEPA and MtOEPB, expressed by genes OEPa and OEPb, will be optimized next. By predicting the RBS intensity on plasmids and constructing an RBS library, four RBS sequences of different intensities (A>B>E>D) corresponding to the two genes were obtained. Using the original plasmids as templates, primers were designed to introduce the RBS sequences onto the plasmids, resulting in 16 different plasmids. These 16 plasmids, along with plasmids carrying the suhB and ino1 genes, were then chemically transformed into engineered strains, as shown below. Figure 5 As shown, a strain with significant breakthroughs in DCI synthesis was obtained, with a DCI conversion rate of up to 5.925853% and a significant reduction in MI accumulation.

[0055] Table 2. Different RBS combinations regulating the expression of OEPa and OEPb and their conversion rates

[0056]

[0057] Table 3. Optimized RBS sequence list for OEPa-OEPb

[0058]

[0059] Example 4: Downregulating the competitive pathway zwf to promote the synthesis of chiral inositol

[0060] Based on the predicted RBS intensity of zwf on the genome, gradient-intensity RBS sequences were designed to replace the existing RBS, resulting in two strong and four weak RBS sequences (A1>A2, E1-E4 decreasing sequentially). The performance of the engineered strains was verified by shake-flask fermentation, using the same method as in Example 3. The results showed that the engineered strain E1, with moderately weakened RBS, achieved the highest chiral inositol conversion rate of 7.738173% despite a slight decrease in growth. The RBS intensity of engineered strains A1-C4 decreased sequentially, while the RBS intensity of the control strain C2 was between that of A2 and E1. Figure 6 ).

[0061] Table 4. RBS sequences corresponding to zwf and their conversion rates

[0062]

[0063] Example 5: Synergistic regulation of glucose transport and phosphorylation promotes DCI synthesis

[0064] Based on strain E1 in Example 4, the glucose transport system of the engineered strain was finely regulated. The expression of glf and glk was synergistically regulated by controlling the RBS intensity. Shake-flask fermentation was used to verify the strain's performance, with fermentation conditions as in Example 3. The results showed that the engineered strain G21 had the highest chiral inositol conversion rate, reaching 8.890092%, which was 14.84% higher than strain E1. RBS intensities are shown in Table 5, where Glf and Glk represent the corresponding proteins of the gene. The RBS intensity of CK was between that of A and E. Figure 7 ).

[0065] Table 5. RBS sequences used in GLF-GLK optimization and their corresponding conversion rates.

[0066]

[0067] Table 6. Strains and their corresponding conversion rates

[0068]

[0069] Example 6: Performance of engineered strains and optimized plasmids in a 5-L bioreactor

[0070] The production performance of a 5-L bioreactor was tested using strain G21. The primary seed culture was cultured on LB medium, and the secondary seed culture on TB medium, following the same process as shake-flask fermentation. TB medium was used as the fermentation medium in the bioreactor. The secondary seed culture was transferred to the bioreactor at a 5% inoculum rate. The aeration rate was maintained at 2 vvm, and the stirring speed was maintained at 300-800 rpm (only increasing, not decreasing). When the bacteria in the bioreactor grew to the OD... 600At 20°C, arabinose and IPTG were added for induction. The feed consisted of 600 g / L glucose as the carbon source and 60 g / L yeast extract and peptone as the nitrogen source. The results were as follows: Figure 8 As shown, the bacterial growth stationary phase is maintained for a relatively long time, and the OD... 600 At around 70, the requirements for high-density production are met, and the final DCI conversion rate is 2.009375%, far exceeding the level of shake-flask operation.

[0071] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A recombinant bacterium that produces high levels of D-chiral inositol, characterized in that, The recombinant bacteria were derived from Escherichia coli. The gene encoding glucose-6-phosphate isomerase and the araBAD coding region of the arabinose operon were knocked out, the expression of glucose-6-phosphate 1-dehydrogenase was reduced, and glucose transporter, inositol-1-phosphate synthase, inositol monophosphatase, D-monositol dehydrogenase and D-pineol dehydrogenase were overexpressed. The glucose-specific PTS enzyme IIBC component gene was replaced with the glucokinase coding gene. Among them, D-manganol dehydrogenase is enhanced by the RBS sequence shown in SEQ ID NO.1, and D-pineol dehydrogenase is enhanced by the RBS sequence shown in SEQ ID NO.

2.

2. The recombinant bacteria according to claim 1, characterized in that, The expression of the glucose-6-phosphate 1-dehydrogenase is regulated by the RBS sequence shown in SEQ ID NO.

3.

3. The recombinant bacteria according to claim 1, characterized in that, The glucose transporter is expressed via RBS as shown in SEQ ID NO.4, and the glucokinase is expressed via RBS as shown in SEQ ID NO.

5.

4. The recombinant bacteria according to claim 1, characterized in that, The NCBI number of the phosphoglucono-isomerase is 948535; the NCBI number of araB in the coding region of the araBAD arasose operon is 946017; the NCBI number of araA is 947511; the NCBI number of araD is 945294; the NCBI number of the glucose-6-phosphate 1-dehydrogenase is 946370; the NCBI number of the glucose transporter is 79904430; the NCBI number of the inositol-1-phosphate synthase is 853288; the NCBI number of the inositol monophosphatase is 947025; the gene sequence encoding the D-monosodium dehydrogenase MtOEPa is shown in SEQ ID NO.6; the gene sequence encoding the D-pinelol dehydrogenase MtOEPb is shown in SEQ ID NO.7; the NCBI number of the glucokinase is 946858; and the NCBI number of the glucose-specific PTS enzyme IIBC component gene is 945652.

5. The recombinant bacteria according to claim 1, characterized in that, The Escherichia coli includes Escherichia coli BL21(DE3).

6. A microbial agent containing the recombinant bacteria as described in any one of claims 1-5.

7. The use of the recombinant bacteria according to any one of claims 1-5 or the microbial agent according to claim 6 in the preparation of D-chiral inositol.

8. A method for improving the conversion rate of D-chiral inositol, characterized in that, The method involves inoculating the recombinant bacteria according to any one of claims 1-5 or the microbial agent according to claim 6 into a fermentation medium for fermentation culture.

9. The method according to claim 8, characterized in that, During the fermentation process, arabinose is added to induce expression.

10. The method according to claim 8, characterized in that, The inoculum size for the fermentation culture is 1%-10%.