Genetically engineered strain with antifungal activity and application thereof

Abstract

The application belongs to the technical field of bioengineering, and relates to a genetically engineered strain with antifungal activity and application thereof, wherein the genetically engineered strain is obtained by genetic modification on Pseudomonas chlororaphis as a starting strain, and the genetic modification comprises knocking out BLU06_RS17430 genes and BLU06_RS17445 genes. By knocking out the competitive negative regulation gene cluster, the application releases the metabolic bottleneck, and the antifungal activity is significantly improved.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology and relates to a genetically engineered strain with antifungal activity and its application. Background Technology

[0002] The Pseudomonas fluorescens complex contains a variety of plant rhizosphere growth promoters (PGPRs) with biocontrol potential. Among them, Pseudomonas fluorescens not only inherits the excellent characteristics of the Pseudomonas genus, but also has unique advantages that other Pseudomonas fluorescens cannot match: its genome is completely missing virulence gene islands, plant toxin synthesis genes, plant cell wall degradation enzyme genes and type III secretion systems, so it can be safely used for biological control.

[0003] With its rapid growth, strong environmental adaptability, and ease of large-scale cultivation, *Pseudomonas aeruginosa* has been successfully developed into a variety of commercial biocontrol agents. For example, Cedomon® (for barley and oat seed treatment to control leaf spot and net blotch) and Cerall® (for wheat seed treatment to control snow mold and leaf blight), based on strain MA 342, are widely used in Europe; strain AFS009 has been developed into the Howler fungicide; and Anglimicro®, developed by Muen Biotechnology, combines *Pseudomonas aeruginosa* with *Bacillus saffron* and *Bacillus belyss* for the control of bacterial wilt, fusarium wilt, and canker in solanaceous vegetables. Furthermore, the study also confirmed that *Pseudomonas aeruginosa* has significant control efficacy against various soil-borne diseases, including *Salvia miltiorrhiza* root rot caused by combined infections of *Fusarium solani*, *Fusarium oxysporum*, and *Fusarium solani*; rice sheath blight caused by *Rhizoctonia solani*; and walnut rot caused by *Cyclocarya paliurus* and *C. nivea*, while also promoting growth. Current research is delving into the gene clusters for the synthesis of its antimicrobial substances and overcoming industrialization challenges such as fluctuations in field efficacy through strain improvement and formulation development, further solidifying its position as a multifunctional biocontrol and growth-promoting agent. *Pseudomonas chlororaphis* is an important rhizosphere growth-promoting bacterium that can synthesize a variety of antifungal secondary metabolites, such as phenazine-1-carboxamide (PCN), phenazine-1-carboxylic acid (PCA), cyclic lipopeptide viscosin, massetolide E, and siderophore pyoverdine. It exhibits significant antagonistic effects against important plant pathogenic fungi such as *Fusarium graminearum*, *Sclerotium rolfsii* Sacc, and *Rhizoctonia solani*, and has broad application prospects in the green control of agricultural diseases.

[0004] Currently, existing commercially available Pseudomonas biocontrol agents have a limited spectrum of control, and there is an urgent need to provide a product that can simultaneously control multiple fungi. Summary of the Invention

[0005] In view of the shortcomings of the existing technology, the purpose of this invention is to provide a genetically engineered strain with antifungal activity and its application.

[0006] To achieve this objective, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a genetically engineered strain with antifungal activity, wherein the genetically engineered strain is obtained by genetic modification of *Pseudomonas aeruginosa* as the starting strain, and the genetic modification includes knocking out the BLU06_RS17430 gene and the BLU06_RS17445 gene.

[0008] Researchers previously isolated a strain of *Pseudomonas aeruginosa*, DSM21509, from the rhizosphere of plants. Through antiSMASH genome mining, 16 complete secondary metabolic biosynthesis gene clusters (BGCs) were annotated. Among them, the pcd gene cluster encodes a product that catalyzes the synthesis of the peptide compound FR901375. This compound exhibits histone deacetylase inhibitory activity but has potential off-target toxicity to non-target organisms (such as pollinating insects). Furthermore, its synthetic pathway consumes a large amount of primary metabolic precursors (such as malonyl-CoA and amino acids), potentially competing with the major antifungal product for resources. The wild-type DSM21509 strain still retains the potentially toxic metabolite of FR901375 to pollinating insects, posing an ecological safety risk under increasingly stringent requirements for green pest control. Moreover, under conventional fermentation conditions, the yield of the major antifungal product (such as phenazine and cyclic lipopeptides) in the wild-type DSM21509 strain is limited by metabolic resource allocation, making its overall antifungal activity insufficient for large-scale field applications.

[0009] *Pseudomonas aeruginosa* exhibits strong antagonistic activity against plant pathogenic fungi and also promotes plant growth and induces systemic acquired resistance, making it a potential candidate for novel biopesticides. Current strain modification strategies primarily focus on activating or enhancing the synthesis pathway of a single major antifungal substance, while research on whether deleting non-major biosynthetic gene clusters can improve the overall antifungal phenotype remains limited. Existing technologies mainly concentrate on increasing the yield of target products by activating silent gene clusters or overexpressing major gene clusters, such as activating silent BGCs through strong promoter replacement or enhancing expression by introducing exogenous regulatory factors.

[0010] This invention aims to provide an engineered strain with enhanced antifungal activity by deleting the BLU06_RS17430 and BLU06_RS17445 genes, resulting in the inactivation of the pcd gene cluster and reducing ecological risks. The BLU06_RS17430 gene encodes acetyl-CoA dehydrogenase, and the BLU06_RS17445 gene encodes an NAD(P) / FAD-dependent oxidoreductase.

[0011] Preferably, the *Pseudomonas aeruginosa* is *Pseudomonas aeruginosa* strain DSM21509.

[0012] Preferably, the nucleotide sequence of the BLU06_RS17430 gene includes the sequence shown in SEQ ID NO:1.

[0013] SEQ ID NO:1:

[0014]

[0015] Preferably, the nucleotide sequence of the BLU06_RS17445 gene includes the sequence shown in SEQ ID NO:2.

[0016] SEQ ID NO:2:

[0017] ATGAGTACTGAACTTTCTTTAGTGGATTTCGATTTCATTGTGATCGGTGGCAGCTACGCCGGGCAGTCGGCGGCAATGCAACTGGCCAGGGCTCGCCGGCGTGTACTGGTGATGGACGCCGGCGTGCGCCGCAACCGTTTTTCCCGGACGCTACACGGTTTGCCTGGGCAGGAGGGGCGCTCACCCGATGTCATTGCGCAGGAGGGGCGGGCGCAAATCATCGCTTATCCGAATGTGCAGTGGTTGGAGGAGGAGGCCACAAACGCGGAGCGCACCGAGTCCGGATTTGTCGTTCGCGGTCAGTCGGGGCAACGTTTTTTTGCTCCGAACGTGGTGTTAGCCACAGGTGTGGAGGATGACTTGCCGCCTGTGGACGGATTGGCCCAGCGCTGGGGTCGTAGCGTATTCCATTGCCCTTATTGCCATGGCTACGAATTGAATCAGGGCTACATCGGCGTGCTCGCGGTCGACGAAGTCGCCTATCAATACGCATTGATGCTGCTTGACTGGGGGACAGTAATCCTCCTGACCGACGGCAGGTTCGAACCCGATGAGGCTCAACGTGAGGCCTTGGCAGAACATGGGGTGTTGATTGAGTCGCAACGGGTGTTACGCATTGTTGATACAGCGACTGTCGAGTTGGGTGATGGGCGAAAAATTGTCTTGGACGGTTTGTTCTGTGCCAGTCACATCCGTATGGCGAGCCCGCTTGCCGTACAACTGGGCTGCGCCTTCGAAGAGGGGCCAATGGGCCCCTACATTTGCACCAGCGAAACCATGGAAACTTCGGTCCCTGGAGTGTTTGCCTGCGGTGACATGGTTCGCTTGGGCGGAACCGTCCCCCTGGCCGTGGGTTCAGGTGCCCAGGCAGGACTTGCCGCGCACCGGGCGTCAGCACAACGTTGA。

[0018] Preferably, the fungus includes any one or a combination of at least two of Sclerotium rolfsii, Fusarium graminearum or Rhizoctonia solani.

[0019] Preferably, the BLU06_RS17430 gene encodes acetyl-CoA dehydrogenase, and the BLU06_RS17445 gene encodes a NAD(P) / FAD-dependent oxidoreductase.

[0020] In a second aspect, the present invention provides the application of the genetically engineered strain with antifungal activity according to the first aspect in the preparation of a biocontrol agent.

[0021] Thirdly, the present invention provides a biological control agent, wherein the strain in the biological control agent includes the genetically engineered strain with antifungal activity described in the first aspect.

[0022] Fourthly, the present invention provides the application of a genetically engineered strain with antifungal activity according to the first aspect or a biological control agent according to the third aspect in the preparation of a biological pesticide with antifungal efficacy.

[0023] Preferably, the biological pesticide is used to control any one or at least two of wheat scab, peanut white mold, or rice damping-off.

[0024] Using the fermentation products of engineered strains as active ingredients, or directly using the strain as the main active microorganism in microbial agents, can prevent and control wheat scab, peanut white mold, and rice damping-off.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] This invention uses *Pseudomonas aeruginosa* DSM21509 as the starting strain and employs a double-crossover homologous recombination method to target and knock out the biosynthetic genes BLU06_RS17430 and BLU06_RS17445 encoding FR901375 in its genome, obtaining a mutant strain Δpcd with inactivated gene clusters. By knocking out the competitive negative regulatory gene clusters, the metabolic bottleneck is removed, resulting in a synergistic increase in the production of multiple major antifungal products and a significant enhancement in antifungal activity. Mycelial growth rate experiments verified that this mutant strain exhibits significantly higher inhibition rates against *Fusarium graminearum*, *Sclerotium graminearum*, and *Rhizoctonia solani* than the wild type, and FR901375 is undetectable in the fermentation products. This mutant strain can be used to produce antifungal active products or to prepare microbial pesticides. Attached Figure Description

[0027] Figure 1 This is a pEB17 plasmid map.

[0028] Figure 2 This is a result of liquid chromatography.

[0029] Figure 3 This is a comparison chart of the antibacterial effects of wild-type Pseudomonas aeruginosa DSM21509 strain and Δpcd strain against Sclerotium truncatum in a confrontation culture experiment.

[0030] Figure 4 This is a comparison chart of the antibacterial effects of wild-type Pseudomonas aeruginosa DSM21509 and Δpcd strains against Fusarium graminearum in a confrontation culture experiment.

[0031] Figure 5 This is a comparison chart of the antibacterial effects of wild-type Pseudomonas aeruginosa DSM21509 and Δpcd strains against Rhizoctonia solani in a confrontation culture experiment. Detailed Implementation

[0032] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.

[0033] The *Pseudomonas aeruginosa* strain DSM21509 was purchased from the German National Culture Collection Center.

[0034] Escherichia coli ST18 (DSM22074) was purchased from the German National Culture Collection Center.

[0035] The strains of *Rhizoctonia solani*, *Rhizoctonia solani*, and *Fusarium graminearum* were all purchased from the China Center for Type Culture Collection.

[0036] Fusarium graminearum is CCTCC AF 2014011, Sclerotium graminearum is CCTCC AF 2018022, and Rhizoctonia solani is CCTCC CF 2008550.

[0037] Example 1

[0038] Construction of mutant strains

[0039] Escherichia coli ST18 was used as the cloning host and conjugation transfer donor. pEB17 was used as the gene knockout plasmid. For the knockout of the BLU06_RS17430 and BLU06_RS17445 genes, upstream and downstream homologous arm amplification primers and plasmid backbone amplification primers were designed, and their sequences are shown in Table 1.

[0040] Table 1

[0041]

[0042] 1.1 Construction of knockout plasmid

[0043] Knockout plasmids were constructed using the Gibson assembly method. Using pEB17 plasmid as a template, linearization was performed using plasmid backbone amplification primers (pEB17-RS17445-F / R or pEB17-RS17430-F / R). Simultaneously, using *Pseudomonas aeruginosa* DSM21509 genomic DNA as a template, the upstream and downstream homologous arms of the target gene (approximately 1000 bp each) were amplified using upstream and downstream homologous arm amplification primer pairs (RS17445-del-HAL-F / R and RS17445-del-HAR-F / R, RS17430-del-HAL-F / R and RS17430-del-HAR-F / R).

[0044] The plasmid map of pEB17 plasmid is as follows: Figure 1 As shown, its nucleotide sequence is shown in SEQ ID NO:21.

[0045] SEQ ID NO:21:

[0046]

[0047] The linearized vector, upstream homologous arm, and downstream homologous arm were mixed at a molar ratio of 1:3:3 and added to Gibson assembly premix (Aibotec, 2×Multi Seamless Assembly Mix). The mixture was incubated at 50°C for 1 hour. 5 μL of the assembly product was transformed into *E. coli* ST18 competent cells and plated on LB agar plates containing 50 μg / mL kanamycin. The plates were incubated overnight at 37°C. Single colonies were picked and colony PCR was performed using primers pEB17-test-F / R. Positive clones were sent to a sequencing company (Yokang Biotechnology) for sequencing confirmation. The correctly sequenced plasmids were named pHZY1-ΔBLU06_RS17430 and pHZY2-ΔBLU06_RS17445.

[0048] 1.2 Conjugation Transfer and Knockout Screening

[0049] Escherichia coli ST18 donor bacteria containing pHZY1-ΔBLU06_RS17430 and Pseudomonas aeruginosa DSM21509 recipient bacteria were inoculated separately into LB liquid medium (donor bacteria supplemented with 50 μg / mL kanamycin and 50 μg / mL 5-aminolevulinic acid) and cultured at 30℃ and 220 rpm until OD. 600 The concentration range was 0.6–0.8. 1 mL of bacterial culture was taken from each culture, centrifuged at 5000 rpm for 3 min, the supernatant was discarded, and the culture was resuspended twice with an equal volume of LB broth. Finally, both bacterial cultures were resuspended in 200 µL of LB broth, mixed, centrifuged at 5000 rpm for 3 min, the supernatant was discarded, and the culture was resuspended in 50 µL of LB broth. The mixture was then spotted onto the center of an LB agar plate containing 50 μg / mL 5-aminolevulinic acid and incubated at 30°C for 24 h. The bacterial colony was scraped off with a sterile pipette tip, resuspended in 1 mL of LB broth, and the entire culture was spread onto an LB agar plate containing 50 μg / mL kanamycin and incubated at 30°C for 24 h. Genomic DNA was extracted from the grown colonies and amplified by PCR using the knockout verification primers BLU06_RS17430-tF and BLU06_RS17430-tR, followed by sequencing.

[0050] 1.3 Plasmid Circulation

[0051] Positive clones were inoculated into 3 mL of antibiotic-free LB liquid medium and cultured at 30°C and 220 rpm for 24 h. An appropriate amount of bacterial suspension was centrifuged at 5000 rpm for 3 min, and the bacterial cells were collected. The cells were resuspended in 150 µL of sterile water and spread onto low-salt solid LB agar plates containing 15% sucrose. The plates were then cultured at 30°C for 48 h. Sucrose served as a reverse selection agent; only colonies lacking the plasmid containing the sacB gene could grow. Single colonies were picked and streaked onto both antibiotic-free LB agar plates and LB agar plates containing 50 μg / mL kanamycin. Colonies that grew on antibiotic-free LB agar plates but not on kanamycin-containing LB agar plates were identified as the successfully looped BLU06_RS17430 knockout mutant strains.

[0052] 1.4 BLU06_RS17445 gene knockout

[0053] Using the BLU06_RS17430 knockout mutant as the recipient strain of *E. coli* ST18 containing pHZY2-ΔBLU06_RS17445, steps 1.2 were repeated. PCR amplification and sequencing were performed using the knockout verification primers BLU06_RS17445-tF and BLU06_RS17445-tR. Step 1.3 was repeated to obtain a double knockout mutant strain of BLU06_RS17430 and BLU06_RS17445 with successfully circularized plasmid. This mutant strain was named Δpcd.

[0054] Test Example 1

[0055] FR901375 content detection

[0056] Activated OD600=1 wild-type DSM21509 and Δpcd mutant bacterial cultures were inoculated at 2% (v / v) into LB, TSB, and R2A liquid media, respectively. Simultaneously, 2% (w / v) of activated sterile macroporous adsorption resin XAD-2 was added, and the cultures were incubated at 30℃ and 220 rpm for 48 h. After incubation, the resin in the culture medium was collected and washed 2-3 times with sterile water to remove surface-adsorbed bacteria. Subsequently, an equal volume of analytical grade methanol was added, and the resin was eluted under the same conditions (30℃, 220 rpm) with shaking for 2 h. The methanol eluent was collected, concentrated and dried using a rotary evaporator, and then reconstituted with 500 μL of methanol for analysis using ultra-high performance liquid chromatography-high resolution mass spectrometry. Chromatographic column: C18 column (4.6 × 150 mm, Agilent); mobile phase: 50% acetonitrile / water containing 0.1% TFA; flow rate: 1.0 mL / min. Results are as follows: Figure 2 As shown, the wild type showed a characteristic peak of FR901375 at a retention time of 7.5 min, while FR901375 was not detected in the fermentation broth of the Δpcd mutant, proving that the pcd gene cluster deletion mutation was successful.

[0057] Test Example 2

[0058] Confrontation Cultivation Experiment

[0059] Wild-type DSM21509 and the Δpcd mutant were streaked onto LB agar plates and activated overnight at 30°C. *Sclerotium rolfsii* Sacc., *F. graminearum*, and *R. solani* were inoculated onto PDA plates and incubated at 25°C until the colony edges became active. Fungal discs were collected along the edge of the fungal colony using a punch (φ=8 mm) and inoculated into the center of LB, R2A, and TSB agar plates. At three different locations 3 cm from the center of the fungal disc, 2.5 μL of the test strain's bacterial suspension (OD) was spotted onto each plate. 600 =1). Plates inoculated only with mycelial cakes served as a blank control. Three biological replicates were set up for each treatment. Incubation was performed at 25°C for 3–7 days (depending on fungal growth rate). Fungal colony diameter was measured using the cross-hatching method, and the inhibition rate was calculated.

[0060]

[0061] Φ Blank: Diameter of fungal colonies in the blank control group;

[0062] Φ mushroom cake: diameter of the mushroom cake;

[0063] Φ Sample: Diameter of fungal colonies in a confrontation plate.

[0064] Relative inhibition rate (%) = Mutant inhibition rate / Wild-type inhibition rate × 100%

[0065] The results are shown in Table 2. The Δpcd mutant strain showed significantly higher inhibition rates against *Rhizoctonia solani*, *Fusarium graminearum*, and *Rhizoctonia solani* than the wild type, with relative inhibition rates exceeding 100% (i.e., the mutant strain exhibited higher activity). Representative images are shown below. Figures 3-5 .

[0066] Table 2

[0067]

[0068] The above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A genetically engineered strain with antifungal activity, characterized in that, The genetically engineered strain was obtained by genetic modification of Pseudomonas aeruginosa as the starting strain. The genetic modification included knocking out the BLU06_RS17430 gene and the BLU06_RS17445 gene.

2. The genetically engineered strain with antifungal activity according to claim 1, characterized in that, The *Pseudomonas aeruginosa* strain mentioned is *Pseudomonas aeruginosa* strain DSM21509.

3. The genetically engineered strain with antifungal activity according to claim 1 or 2, characterized in that, The nucleotide sequence of the BLU06_RS17430 gene includes the sequence shown in SEQ ID NO:

1.

4. The genetically engineered strain with antifungal activity according to any one of claims 1-3, characterized in that, The nucleotide sequence of the BLU06_RS17445 gene includes the sequence shown in SEQ ID NO:

2.

5. The genetically engineered strain with antifungal activity according to any one of claims 1-4, characterized in that, The fungi include any one or a combination of at least two of the following: Sclerotium graminearum, Fusarium graminearum, or Rhizoctonia solani.

6. The genetically engineered strain with antifungal activity according to any one of claims 1-5, characterized in that, The BLU06_RS17430 gene encodes acetyl-CoA dehydrogenase, and the BLU06_RS17445 gene encodes NAD(P) / FAD-dependent oxidoreductase.

7. The use of the genetically engineered strain with antifungal activity according to any one of claims 1-6 in the preparation of biocontrol agents.

8. A biological control agent, characterized in that, The strains in the biocontrol agent include any one of the genetically engineered strains with antifungal activity as described in claims 1-6.

9. The use of the genetically engineered strain with antifungal activity according to any one of claims 1-6 or the biocontrol agent according to claim 8 in the preparation of a biopesticide with antifungal efficacy.

10. The application according to claim 9, characterized in that, The biological pesticide is used to control any one or at least two of the following: wheat scab, peanut white mold, or rice damping-off.

Images