Construction method and application of genetically engineered corynebacterium glutamicum for producing pariein amino acid shinorine
Patent Information
- Application Number
- CN202610810395.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-05
- Publication Date
- 2026-08-18
AI Technical Summary
[0005]针对现在通过天然获取Shinorine途径困难且含量少的问题,本发明通过微生物代谢基因工程的方式生产Shinorine
[0037] This invention uses Corynebacterium glutamicum ATCC 13032 as the starting strain. By expressing exogenous genes from Nostoc punctata and Pseudomonas pseudocardioids and overexpressing them on plasmids, the Corynebacterium glutamicum constructed can achieve a maximum Shinorine yield of 1.7 g/L under 72 h fermentation conditions in shake flasks. When this Corynebacterium glutamicum is fermented in a fermenter, the Shinorine yield can reach 13.2 g/L after about 72 h of fermentation. The yield is increased by about 7.6 times from shake flask to fermenter scale-up system.
Smart Images

Figure FT_1
Abstract
Description
Technical Field
[0001] This invention relates to a method for constructing and applying a genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid shinorine, belonging to the fields of microbial metabolic genetic engineering and synthetic biology. Background Technology
[0002] Mycosporine-like amino acids (MAAs) are a class of bioactive natural compounds with ultraviolet absorption capabilities, widely found in marine organisms, algae, and certain bacteria. Shinorine is an important mycosporine-like amino acid, belonging to a class of water-soluble secondary metabolites, and was first isolated and identified from marine cyanobacteria. As a core member of the MAA family, Shinorine is widely found in marine organisms exposed to high-intensity light environments for extended periods, including large marine algae (porphyria, red algae), corals, and certain marine invertebrates. Shinorine, as a representative of disubstituted MAAs, possesses a substituted cyclohexenone ring structure, a common backbone for all MAAs. Glycine is attached at the C3 position, and L-serine at the C1 position, forming a unique disubstituted structure. Its maximum absorption wavelength is 334 nm, covering the UVA region, and it is a demethylated analogue of porphyra-334. After absorbing UV radiation, shinorine dissipates the energy as heat through ultrafast internal conversion, without producing free radicals or phototoxic byproducts. Its photoprotective efficiency significantly reduces DNA damage rates even at micromolar concentrations. Shinorine plays a role in antioxidation and cell protection, free radical scavenging, and anti-aging. In some studies, shinorine has been shown to promote wound healing, reduce collagen and elastin degradation, and possess anti-inflammatory properties, alleviating skin inflammation. Therefore, shinorine shows promise for applications in cosmetics, daily chemical products, pharmaceuticals, and functional foods.
[0003] Shinorine biosynthesis is catalyzed by an enzyme system encoded by the mys gene cluster. The process begins with the synthesis of precursor substances, which is produced via the pentose phosphate pathway. The intermediate product is sedoheptulose-7-phosphate (S7P). S7P is then catalyzed by DDGS synthase (MysA) to generate demethyl-4-deoxycodone (DDG). O-methyltransferase (MysB) converts DDG into 4-deoxydiazotol (4-DG). The next step involves ATP-grasp enzyme (MysC) catalyzing the condensation of 4-DG with glycine to form Mycosporine-Glycine. Finally, non-ribosomal peptide synthase (MysD) attaches a serine residue at the C1 position to form Shinorine.
[0004] Corynebacterium glutamicum, a recognized safe (GRAS) industrial strain, is widely used in the production of high-value-added products such as amino acids and terpenoids due to its non-endotoxin production, rapid growth, and suitability for high-density fermentation. The production of amino acids (MAAs) using Corynebacterium glutamicum is currently at a mature industrial level, exhibiting strong metabolic plasticity, convenient gene editing, and food safety characteristics. As a high-yield amino acid bacterium, Corynebacterium glutamicum can simultaneously provide sufficient amino acid precursors such as glycine and serine, achieving efficient production of MAAs. Summary of the Invention
[0005] To address the difficulties and low yields of naturally obtained Shinorine, this invention produces Shinorine through microbial metabolic genetic engineering. Producing Shinorine using Corynebacterium glutamicum is a highly efficient and environmentally friendly method. This invention provides a genetically engineered Corynebacterium glutamicum for Shinorine production.
[0006] Preferably, this invention provides a strategy for constructing Corynebacterium glutamicum for efficient Shinorine synthesis based on systems metabolic genetic engineering. Using the genetically engineered strain of Corynebacterium glutamicum ATCC 13032 to produce the spore-like amino acid Shinorine, the 3-dehydroquinanate synthase gene (NpmysA), O-methyltransferase gene (NpmysB), ATP-grasp ligase gene (NpmysC) from *Nostoc punctiforme* ATCC 29133, and the D-alanine-D-alanine ligase gene (PpmysD) from *Pseudonocardia pini* are ligated into a gene cluster using RBS and cloned into the pEC-XK99E plasmid. Two acid-producing pathway genes, namely the pyruvate dehydrogenase gene *poxB* and the phosphoacetyltransferase gene *pta*, and the serine dehydrogenase gene *sdaA*, are knocked out using the strong constitutive promoter P... tuf The key enzyme gene cluster was initiated and integrated into the genome. Xylose isomerase gene (xylA), xylulose kinase gene (xylB), and D-xylose:H(+) transporter gene (xylE) from *E. coli* were introduced and integrated into the chromosome at the rph site. The 6-phosphofructokinase gene (pfkA) was weakened. A strong constitutive promoter P was used. tuf The glucose-6-phosphate dehydrogenase gene (zwf) and the 6-phosphate gluconate dehydrogenase gene (gnd) were enhanced. The genetically engineered strain achieved a Shinorine yield of 1.7 g / L after 72 h of shake-flask fermentation. In a 50 L fermenter, the Shinorine yield reached 13.2 g / L.
[0007] The first objective of this invention is to provide plasmids that can efficiently express the genes NpmysA, NpmysB, NpmysC, and PpmysD.
[0008] In one implementation, the pEC-XK99E plasmid is used as the expression vector;
[0009] In one embodiment, genes NpmysA, NpmysB, NpmysC, and PpmysD are linked into a gene cluster via RBS and constructed onto the pEC-XK99E plasmid to obtain the recombinant plasmid PEC-XK99E-NpmysABC-PpmysD.
[0010] In one embodiment, the 3-dehydroquinanate synthase gene (NpmysA) is derived from Nostocpunctiforme ATCC 29133, and its encoded amino acid sequence is shown in SEQ ID NO.2, and its nucleotide sequence is shown in SEQ ID NO.7.
[0011] In one embodiment, the O-methyltransferase gene (NpmysB) of Nostocpunctiforme ATCC 29133 encodes the amino acid sequence shown in SEQ ID NO.3 and the nucleotide sequence shown in SEQ ID NO.7.
[0012] In one embodiment, the ATP-grasp ligase gene (NpmysC) is derived from Nostocpunctiforme ATCC 29133, and its encoded amino acid sequence is shown in SEQ ID NO.4, and its nucleotide sequence is shown in SEQ ID NO.9.
[0013] In one embodiment, the D-alanine-D-alanine ligase gene (PpmysD) is derived from Pseudonocardia pini, and its encoded amino acid sequence is shown in SEQ ID NO.5, and its nucleotide sequence is shown in SEQ ID NO.10.
[0014] The second objective of this invention is to provide a recombinant Corynebacterium glutamicum that synthesizes Shinorine, wherein the recombinant Corynebacterium glutamicum introduces a xylose utilization gene cluster derived from Escherichia coli K-12 MG1655 and integrates it onto the genome; the expression of the 6-phosphofructokinase gene (pfkA) is weakened, and the expression of the precursor supply genes glucose-6-phosphate dehydrogenase gene (zwf) and 6-phosphogluconate dehydrogenase gene (gnd) is strengthened.
[0015] In one embodiment, the xylose isomerase gene xylA is derived from *Escherichia coli* K-12 MG1655, and its nucleotide sequence is shown in SEQ ID NO. 11; the xylose isomerase gene xylA is generated by a strong constitutive promoter P. tuf Initiate expression;
[0016] In one embodiment, the xylose kinase gene xylB is derived from *Escherichia coli* K-12 MG1655, and its nucleotide sequence is shown in SEQ ID NO. 12; the xylose kinase gene xylB is generated by a strong constitutive promoter P. tuf Initiate expression;
[0017] In one embodiment, the D-xylose:H(+) transporter gene xylE is derived from *Escherichia coli* K-12MG1655, and its nucleotide sequence is shown in SEQ ID NO. 13; the xylose kinase gene xylE is generated by a strong constitutive promoter P. tuf Initiate expression;
[0018] In one implementation, the strongly constitutive promoter P tuf It is an endogenous promoter of Corynebacterium glutamicum, and its nucleotide sequence is shown in SEQ ID NO. 1.
[0019] In one embodiment, the Corynebacterium glutamicum includes, but is not limited to, Corynebacterium glutamicum ATCC 13032.
[0020] In one embodiment, the start codon of the 6-phosphofructokinase gene pfkA is changed from ATG to GTG, and its nucleotide sequence is shown in SEQ ID NO.14.
[0021] In one embodiment, the glucose-6-phosphate dehydrogenase gene zwf is generated by a strong constitutive promoter P. tuf Initiate expression. Its NCBI serial number is BAB98969;
[0022] In one embodiment, the 6-phosphoglucate dehydrogenase gene gnd is generated by a strong constitutive promoter P. tuf Initiate expression. Its NCBI serial number is BAB98845;
[0023] In one embodiment, the RBS used to link the key enzyme gene on the plasmid is the universal RBS of Corynebacterium glutamicum, namely CK1, and the CK1 gene sequence is shown in SEQ ID NO.6.
[0024] In one embodiment, the Corynebacterium glutamicum includes, but is not limited to, Corynebacterium glutamicum ATCC 13032.
[0025] A third objective of this invention is to provide a method for producing the spore-like amino acid Shinorine, wherein the method utilizes the genetically engineered Corynebacterium glutamicum to ferment and produce the spore-like amino acid Shinorine.
[0026] In one embodiment, Corynebacterium glutamicum is routinely cultured in BHIS medium at 30°C and 220 rpm for 16-18 h.
[0027] In one embodiment, *Corynebacterium glutamicum* is fermented and cultured in a modified CGXII culture medium containing 20 g / L glucose, 20 g / L xylose, 5 g / L yeast extract, 5 g / L corn steep liquor, 20 g / L ammonium sulfate, 10 g / L urea, 1 g / L potassium dihydrogen phosphate, 1.0 g / L dipotassium hydrogen phosphate, 42 g / L 3-morpholinopropanesulfonic acid, and trace metal elements. The trace metal elements include: 250 mg / L magnesium sulfate heptahydrate, 10 mg / L ferrous sulfate heptahydrate, 10 mg / L manganese sulfate monohydrate, 1 mg / L zinc sulfate heptahydrate, 0.2 g / L anhydrous copper sulfate, 0.02 mg / L nickel chloride hexahydrate, 0.2 mg / L biotin, 10 mg / L calcium chloride, 30 mg / L protocatechuic acid, and 0.1 mg / L vitamin B1.
[0028] Shake flasks at 30°C, incubate until OD. 600 =1.0±0.1, add IPTG to a final concentration of 0.8~1.2 mM, and continue induction culture at 30°C and 220 rpm for no less than 72 h;
[0029] The fermenter was operated at 30°C, with a stirring speed of 200-800 r / min, an aeration rate of 2-6 vvm, and a pH of 7.0±0.2, until fermentation reached OD. 600 When the concentration is 15±0.5, add IPTG to a final concentration of 0.8~1.2mM and induce culture at 30°C for no less than 72 h. If necessary, add antibiotics of appropriate concentration.
[0030] More preferably, the induction culture in the fermenter system shall be no less than 72 h.
[0031] In one embodiment, during the reaction, glucose and xylose at a concentration of 500 g / L are added to maintain a final concentration of 10-15 g / L, while 50% ammonia is added to bring the pH of the entire system to 7.0, thereby maintaining the production of the product Shinorine.
[0032] Preferably, when the concentration of glucose or xylose in the reaction system is less than 10 g / L, glucose or xylose is added at once to a final concentration of 10 g / L to ensure sufficient energy and normal cell growth, thereby promoting the continuous production of Shinorine.
[0033] In one embodiment, using glucose or xylose as a carbon source, exogenous genes derived from *Nostocpunctiforme* ATCC 29133 and *Pseudonocardia pini* are used to efficiently produce the spore-like amino acid shinorine.
[0034] A fourth objective of this invention is to provide the application of the recombinant Corynebacterium glutamicum in the preparation of a spore-like amino acid, Shinorine.
[0035] The fifth objective of this invention is to provide the application of the recombinant Corynebacterium glutamicum in the fields of food, cosmetics, pharmaceutical development, and biomaterials.
[0036] The beneficial effects of this invention are:
[0037] This invention uses Corynebacterium glutamicum ATCC 13032 as the starting strain. By expressing exogenous genes from Nostoc punctata and Pseudomonas pseudocardioids and overexpressing them on plasmids, the Corynebacterium glutamicum constructed can achieve a maximum Shinorine yield of 1.7 g / L under 72 h fermentation conditions in shake flasks. When this Corynebacterium glutamicum is fermented in a fermenter, the Shinorine yield can reach 13.2 g / L after about 72 h of fermentation. The yield is increased by about 7.6 times from shake flask to fermenter scale-up system. Attached Figure Description
[0038] Figure 1 Schematic diagram of recombinant plasmid pEC-XK99E-NpmysABC-PpmysD. Detailed Implementation
[0039] 1. The plasmids, restriction enzymes, PCR enzymes, column DNA extraction kits, and DNA gel recovery kits used in the following examples are commercial products. The specific operations should be performed in accordance with the kit instructions.
[0040] 2. Routine procedures such as colony PCR, nucleic acid agarose gel electrophoresis, heat shock transformation, preparation of competent cells, and extraction and preservation of bacterial genomes were performed according to Molecular Cloning: A Laboratory Manual (Fourth Edition).
[0041] 3. The sequencing of plasmids and DNA products was completed by Shanghai Sangon Biotech Co., Ltd.
[0042] 4. Preparation of competent Escherichia coli cells: TAKARA kit.
[0043] 5. Reference for competent cells of Corynebacterium glutamicum: Jiang, Y., Qian, F., Yang, J. et al. CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. NatCommun. 8, 15179 (2017).
[0044] 6. Fermentation process and detection of the spore-like amino acid Shinorine:
[0045] (1) BHIS liquid culture medium: BHI 37 g / L, D-sorbitol 91 g / L.
[0046] (2) BHIS solid medium: BHI 37 g / L, D-sorbitol 91 g / L, 15 g / L agar powder.
[0047] (3) Fermentation medium 1: Contains 20 g / L glucose, 20 g / L xylose, 5 g / L yeast extract, 5 g / L corn steep liquor, 20 g / L ammonium sulfate, 10 g / L urea, 1 g / L potassium dihydrogen phosphate, 1.0 g / L dipotassium hydrogen phosphate, 42 g / L 3-morpholinopropanesulfonic acid, and trace metal elements; the trace metal elements include: 250 mg / L magnesium sulfate heptahydrate, 10 mg / L ferrous sulfate heptahydrate, 10 mg / L manganese sulfate monohydrate, 1 mg / L zinc sulfate heptahydrate, 0.2 g / L anhydrous copper sulfate, 0.02 mg / L nickel chloride hexahydrate, 0.2 mg / L biotin, 10 mg / L calcium chloride, 30 mg / L protocatechuic acid, and 0.1 mg / L vitamin B1. When adding the plasmid for expression, kanamycin at a final concentration of 25 μg / mL and IPTG at a final concentration of 0.9 mM should be added to induce plasmid activity.
[0048] (4) Fermentation medium 2: Contains 40 g / L glucose, 5 g / L yeast extract, 5 g / L corn steep liquor, 20 g / L ammonium sulfate, 10 g / L urea, 1 g / L potassium dihydrogen phosphate, 1.0 g / L dipotassium hydrogen phosphate, 42 g / L 3-morpholinopropanesulfonic acid, and trace metal elements; the trace metal elements include: 250 mg / L magnesium sulfate heptahydrate, 10 mg / L ferrous sulfate heptahydrate, 10 mg / L manganese sulfate monohydrate, 1 mg / L zinc sulfate heptahydrate, 0.2 g / L anhydrous copper sulfate, 0.02 mg / L nickel chloride hexahydrate, 0.2 mg / L biotin, 10 mg / L calcium chloride, 30 mg / L protocatechuic acid, and 0.1 mg / L vitamin B1. When adding the plasmid for expression, kanamycin at a final concentration of 25 μg / mL and IPTG at a final concentration of 0.9 mM should be added to induce plasmid activity.
[0049] (5) Fermentation process for producing the spore-like amino acid shinorine: The constructed strain was inoculated into BHI liquid medium, and kanamycin was added to a final concentration of 25 μg / mL. The culture was carried out overnight at 30°C and 220 rpm for 16–18 h to obtain the seed culture. 2 mL of the seed culture was inoculated into 50 mL of fermentation medium and cultured at 30°C and 220 rpm until the OD reached the target concentration. 600 =1.0±0.1, add IPTG to a final concentration of 0.9 mM, and continue induction culture at 30°C and 220 rpm for 72 h. Take 1 mL of fermentation broth, centrifuge at 10,000 rpm for 10 min, collect the supernatant, and use it for HPLC analysis.
[0050] (6) HPLC detection conditions: High performance liquid chromatography (HPLC) system (Agilent); chromatographic column: ZORBAX Eclipse Plus C18; detector: Agilent UV detector; UV absorption wavelength: 330 nm; mobile phase: 0.25% formic acid aqueous solution; flow rate: 0.65 mL / min; column temperature: 35°C; injection volume: 10 μL.
[0051] Example 1: Construction of pEC-XK99E-NpmysABC-PpmysD expression plasmid
[0052] The genes NpmysA, NpmysB, NpmysC, and PpmysD were synthesized by a biotechnology company (Shanghai Diwin Biotechnology Co., Ltd.) according to the amino acid sequences on NCBI and cloned into the multiple cloning site of the vector pEC-XK99E, thereby obtaining the plasmid pEC-XK99E-NpmysA-NpmysB-NpmysC-PpmysD, hereinafter referred to as pEC-XK99E-NpmysABC-PpmysD.
[0053] Example 2: Construction of Corynebacterium glutamicum genetic engineering strain
[0054] The specific steps for constructing gene-editing plasmids and recombinant strains are as follows (the primer sequences involved are shown in Table 1):
[0055] The exogenous gene xylABE was integrated into the rph site of Corynebacterium glutamicum ATCC 13032 using the SacB-assisted CRISPR-FnCpf1 gene editing system, and the strong constitutive promoter P was utilized. tuf For efficient expression, refer to the CRISPR / Cpf1 gene editing system. See Zhang, J., et al. (2020). De Novo Engineering of Corynebacterium glutamicum for l-Proline Production. ACS Synthetic Biology 9(7): 1897–1906.
[0056] The specific steps are as follows:
[0057] (1) Constructing plasmid pK18mobsacB-spec-Δrph::P tuf -xylABE
[0058] Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream and downstream fragments of the rph gene were amplified by PCR using rph-UH / DH-F / R primers (Table 1); the constitutive promoter P was amplified using ptuf-F / R. tuf Using pK18-F / R primers, the vector fragment was amplified using plasmid pK18mobsacB-spec as a template; using xylA-ptuf-F / xylE-rph-R primers, the gene fragment xylABE was amplified using plasmid pXMJ19-xylABE as a template. Homologous recombination was used to assemble multiple fragments at 50 °C for 30 min. After chemical transformation into DH5α, and successful verification through culture, bacterial selection, plasmid extraction, and sequencing, the recombinant gene editing plasmid pK18mobsacB-spec-Δrph::P was obtained. tuf -xylABE.
[0059] (2) Construction of recombinant strains of Corynebacterium glutamicum
[0060] The gene-editing plasmid pK18mobsacB-spec-Δrph::P constructed above was applied... tuf-xylABE was transferred into *Corynebacterium glutamicum* via electroporation at a concentration of 800–1000 ng, operated at 25 μF, 200 Ω, and 2.5 kV. The transformed knockout strains were then plated on spectinomycin-resistant BHIS plates. Single-crossover mutants were selected, and individual colonies of each mutant were cultured in BHIS medium for 16–18 h. Once single colonies appeared, the strains were picked and cultured overnight to create competent cells. The constructed pJYS3-rph-N23 plasmid was then transferred into competent cells via electroporation as described above. The cells were heat-shocked at 46 °C for 6 min, incubated on a shaker at 30 °C for 2 h, and plated on BHIS plates containing kanamycin and sucrose. The plates were then incubated at 30 °C until single colonies appeared. Successfully grown single colonies were identified as double-crossover mutants. Colony PCR was used to verify the correct editing of the strain, and the samples were then sent to a sequencing company for further confirmation of gene integration. The successfully validated strains were inoculated into test tubes containing BHIS medium and cultured overnight at 34 °C to remove plasmids. The plasmids were then streaked onto BHIG agar plates containing kanamycin to screen for plasmid-free strains, ultimately yielding plasmid-free antibiotic-free Corynebacterium glutamicum strains for the next round of editing or fermentation validation.
[0061] For the knockout or integration of other genes into the target gene, please refer to the above procedures.
[0062] (3) Constructing genetically engineered Corynebacterium glutamicum containing plasmid pEC-XK99E-NpmysABC-PpmysD
[0063] The recombinant strain with successfully edited genes was prepared as an electroporation competent state. pEC-XK99E-NpmysABC-PpmysD was transferred into the constructed recombinant strain by electroporation as described in (2). Then, it was spread on a BHIS agar plate containing kanamycin resistance. After colonies grew, genetically engineered Corynebacterium glutamicum containing plasmid pEC-XK99E-NpmysABC-PpmysD was obtained for fermentation verification.
[0064] Table 1 Primers used for plasmid and genome construction
[0065] tal-UH-F GACATGATTACGAATTCGGTATCCGTGAGCACGCTATG tal-UH-R CGTGCTGATTGTGCAAGATCATCAATGTGAGAC tal-DH-F GATCTTGCACAATCAGCACGCTGCATCAGTAACG tal-DH-R GCCAGTGCCAAGCTTGCACGAAAGAAATTGGTTCTTCCAT Cgl1036-UH-F GACATGATTACGAATTCCGCATGCAATTGCATCAGCGGAT Cgl1036-UH-R CGGATCTAAACGATCTCCACTCTTCTGCGCCCGTCACACG NpmysA-F CCAGGAGGACATACAATGAGTAATGTACAAGCTTCATTTGAAGCAAC NpmysD-R GGGTACCGAGCTCTTAGTTTTGCAGGACTTTTTTATTAGAGCC PpmysD-R GGGTACCGAGCTCTTAGCCTCTGCGCGCCGCGGT AmmysD-R GGGTACCGAGCTCTTAGTGGTGGTGGTGGTG Cgl1036-DH-F GTAGAGCTGGGCGGTGATTACGGTGACGTCCATCTCGAGGGGGTGGAT Cgl1036-DH-R GCCAGTGCCAAGCTTCGCAAGTGGATTCTCCACCTTCTG lldA-UH-F CTATGACATGATTACGAATTCCAACGCCATCGGCATTTGGGCACC lldA-UH-R CTTCGGATCTAAACGATCTGGGTGGTTCCTTTCGGAGGG AmmysD-R GGGTACCGAGCTCTTAGTGGTGGTGGTGGTG lldA-DH-F GTAGAGCTGGGCGGTGATTAAAGTTTCTCTCCTTAGCTATT lldA-DH-R CCAGTGCCAAGCTTGTCCTAGGTGGGATGCGAGG ptuf-F AGATCGTTTAGATCCGAAGGAAAACGT ptuf-R TGTATGTCCTCCTGGACTTCGTG tal-N23-F CGCCATGAGCATCGACGACGTTCATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC of N23-R GAACGTCGTCGATGCTCATGGCGATCTACAACAGTAGAAATTCGGATCCATTAT Cgl1036-N23-F ATACTGCGTCAGCCTGGCGCTTGATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC Cgl1036-N23-R CTCCCTCGAAGAACTCGAGCCACATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC lldA-N23-F CTCCCTCGAAGAACTCGAGCCACATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC lldA-N23-R GTGGCTCGAGTTCTTCGAGGGAGATCTACAACAGTAGAAATTCGGATCCATTAT sdaA-UH-F GACATGATTACGAATTCGTCCACCACTCGCTCCGTGGC sdaA-UH-R AGCCGTACCGGGCTGAGGGTGGGCCTTTCTATGGTGGTGT sdaA-DH-F ACCCTCAGCCCGGTACGGCTTTAACACGGCTTGGATTTTG sdaA-DH-R GCCAGTGCCAAGCTAGGTGAATGCCCCTGTGGTGATCAA poxB-UH-F GACATGATTACGAATTCCGTTAATGAGGAAAACCGAACCC poxB-UH-R TATCAATCATCACTGAACTCCTCAACGTTATGGCTATTGTGT poxB-DH-F TGAGGAGTTCAGTGATGATTGATACACCTGCTGTTCTCATTG poxB-DH-R GACGGCCAGTGCCAAGCTTGGTACGGAAAGTGCCATCGCT pta-UH-F GACATGATTACGAATTCTCACCGACACCGGCGGTGAACAC pta-UH-R GTTCAGGCTGAAATTAGAAAGGCGATGTTGGCATTGGCACTTG pta-DH-F GAGTTCAAAACAAGTGCCAATGCCAACATCGCCTTTCTAAT pta-DH-R CAGTGCCAAGCTTTTGCCAAAATACGAGCAACGTCCAACG I'm B-UH-F GCTATGACATGATTACGAATTCCACGGTGGAAACGGTGGCGCGTTTCC I'm B-UH-R CTTCGGATCTAAACGATCTGGTCGGACTCCTTTTATTATCAGGAAAG nagB-DH-F GGTAGAGCTGGGCGGTGATTAAAACAAAAAGGAAAGTAGTGTGT nagB-DH-R CCAGTGCCAAGCTTGCACCCCATCCTTCCCGTGCAACTGTT ppc-UH-F CTATGACATGATTACGAATTCCGGGAAACTTTTTTAAGAAAGG ppc-UH-R GATCTAAACGATCTTAACTACTTTAAACACTCTTTCAC ppc-DH-F TAGAGCTGGGCGGTGATTAATCCAGCCGGCTGGGTAGTACTCG ppc-DH-R CCAGTGCCAAGCTTGAAGTATTCAAGGGGATTTCCGATAATTCCC NpmysA-F CCAGGAGGACATACAATGAGTAATGTACAAGCTTCATTTGAAGCAAC PpmysD-R GGGTACCGAGCTCTTAGCCTCTGCGCGCCGCGGGT ptuf-F AGATCGTTTAGATCCGAAGGAAAACGT ptuf-R TGTATGTCCTCCTGGACTTCGTG sdaA-N23-F CAGCTCGCATGTCGATATCACGTATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC sdaA-N23-R ACGTGATATCGACATGCGAGCTGATCTACAACAGTAGAAATTCGGATCCATTAT nagB-N23-F CACCATCTGGGCTGTAGACCTCTATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC nagB-N23-R AGAGGTCTACAGCCCAGATGGTGATCTACAACAGTAGAAATTCGGATCCATTAT ppc-N23-F GAACAGTGGGATGACATCGACGGATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC ppc-N23-R CCGTCGATGTCATCCCACTGTTCATCTACAACAGTAGAAATTCGGATCCATTAT poxB-N23-F GAACGTGCACCCACTCAAATATCTATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC poxB-N23-R AGATATTGAGTGGGTGCACGTTCATCTCACAACAGTAGAAATTCGGATCCATTAT pta-N23-F GCGGTAAATGCTGCTGCWINDSTTAAATAAAACGAAAGGCTCAGTCGAAGAC pta-N23-R GTTGTTGCAGCAGCATTTACCGCATCTACAACAGTAGAAATTCGGATCCATTAT pK18-F AAGCTTGGCACTGGCCGTCGTT pK18-R GAATTCGTAATCATGTCATAGCTGTTTCCTGTG rph-UH-F ANSWERGATTACGAATCTCTGGGTGACTGGTGTGTTTTTGCT rph-UH-R CGGATCTAAACGATCTAACCACCAGTTAAGGACAC rph-DH-F GCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGCAAATGAATACAGGGTACCTTCCAGC rph-DH-R GCCAGTGCCAAGCTTATGGTTTGGTGCCGTTTACCATCACGAA xylA-ptof-F AGTCCAGGAGGACATACAATGCAAGCCTATTTTGACCAGCT xylE-rph-R AACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTACAGCGTAGCAGTTTG xylA-F CAGAATTAATTAAGCTTATGCAAGCCTATTTTGACCAGCT xylA-R SUPPORT ACCTCCTTTTTATTTGTCGAACAGATAATGGTTTACCAGATTTTC xylB-F TAAAAAGGAGTTGTCATGTATATCGGGATATCTTGGCACC xylB-R CATGACAACCTCCTTTTTACGCCATTAATGGCAGAAGTTGC xylE-F TAAAAAGGAGTTGTCATGAATACCCAGTATAATTCCAGTTATATTTTCGATT xylE-R CTGCAGGCATGCTTACAGCGTAGCAGTTTGTTGTGTTTTC Pzwf-UH-F ATGACATGATTACGAATTCCCCAGCTATTTTCGCAGC Pzwf-UH-R GGATCTAAACGATCTCGAACTAATTCGATTTCATG Pzwf-DH-F CAGGAGGACATACAGTGAGCAAAACACGACCCC Pzwf-DH-R GCCAGTGCCAAGCTTGCCATCTTCTTCGCGAAGTCCCT Pgnd-UH-F TATGACATGATTACGAATTCCTTCGAGGAAGTCTCCAAAGAC Pgnd-UH-R CGGATCTAAACGATCTGAAAATCCAACCATTTTAGG Pgnd-DH-F CCAGGAGGACATACAATGCCGTCAAGTACGATCAATAAC Pgnd-DH-R CAGTGCCAAGCTTCTGTGCCTTGTCCACGCCCAAG NpmysA-F CCAGGAGGACATACAATGAGTAATGTACAAGCTTCATTTGAAGCAAC PpmysD-R GGGTACCGAGCTCTTAGCCTCTGCGCGCCGCGGT ptuf-F AGATCGTTTAGATCCGAAGGAAAACGT ptuf-R TGTATGTCCTCCTGGACTTCGTG rph-N23-F CCGGTGCCCTGAATTTCCACGAAATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC rph-N23-R TTCGTGGAAATTCAGGGCACCGGATCTACAACAGTAGAAATTCGGATCCATTAT pfka-UH-F TATGACATGATTACGAATTCGCAGGCCTCCAAGCGGGAG pfka-UH-R CAATTCGCACGTCTTCCATATTAAACCCATCACAACAC pfka-DH-F GGAAGACGTGCGAATTGCTACTCTCAC pfka-DH-R CCAGTGCCAAGCTTGTTCGAATGGAACTTCCTTC pK18-R GAATTCGTAATCATGTCATAGCTGTTTCCTGTG
[0066] Example 3: Production of Shinorine, a spore-like amino acid, by shake-flask fermentation
[0067] Based on Example 2, the genetically engineered strain was subjected to shake-flask fermentation at 30°C and 220 rpm throughout the process, and cultured until OD. 600=1.0±0.1, add IPTG to a final concentration of 0.9 mM. After 72 h of shake-flask fermentation, samples were taken. 1 mL of fermentation broth was centrifuged at 10,000 rpm for 10 min, and the supernatant was collected for HPLC analysis. After stable expression of the xylose utilization gene in the recombinant strain, the yield of Shinorine was significantly increased, from 1.12 g / L in strain Cgs-09 to 1.5 g / L in strain Cgs-10. By weakening the glucose glycolysis pathway gene pfkA and changing the start codon from ATG to GTG, Shinorine accumulated to 1.6 g / L during shake-flask fermentation. To increase the carbon flux of the pentose phosphate pathway, the original promoters of the precursor genes zwf and gnd were replaced with the strong constitutive promoter P. tuf Replacement increases the supply of precursors, thereby promoting the production of Shinorine.
[0068] By combining various strategies, a genetically engineered strain capable of high-efficiency production was obtained by expressing the plasmid pEC-XK99E-NpmysABC-PpmysD in a recombinant strain. The strain could accumulate up to 1.7 g / L during 72 h of shake-flask fermentation.
[0069] Detailed information on shake-flask fermentation of the genetically engineered strains is shown in Table 2.
[0070] Table 2. Detailed information on shake-flask fermentation of genetically engineered strains
[0071] strain name Host genotype and plasmids culture medium Shinorine yield (g / L) Cgs-011 C. glutamicum ATCC 13032 carrying plasmid pEC-XK99E Culture medium 2 0 Cgs-012 C. glutamicum ATCC 13032 carrying plasmid pEC-XK99E-NpmysABCD Culture medium 2 0.06 Cgs-021 C. glutamicum ATCC 13032 Δtal carrying plasmid pEC-XK99E-NpmysABCD Culture medium 2 0.2 Cgs-022 C. glutamicum ATCC 13032 Δtal carrying plasmid pEC-XK99E-NpmysABC-AmmysD Culture medium 2 0.19 Cgs-023 C. glutamicum ATCC 13032 Δtal carrying plasmid pEC-XK99E-NpmysABC-PpmysD Culture medium 2 0.22 Cgs-03 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf - NpmysABC carrying plasmid pEC-XK99E-NpmysABC-PpmysD]]> Culture medium 2 0.38 Cgs-04 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD carrying plasmid pEC-XK99E-NpmysABC-PpmysD]]> Culture medium 2 0.52 Cgs-05 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD ΔnagB::P tuf -NpmysABC-PpmysD carrying plasmid pEC-XK99E-NpmysABC-PpmysD]]> Culture medium 2 0.68 Cgs-06 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD ΔnagB::P tuf -NpmysABC-PpmysD Δppc:: P tuf -NpmysABC-PpmysD carrying plasmid pEC-XK99E-NpmysABC-PpmysD]]> Culture medium 2 0.87 Cgs-07 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD ΔnagB::P tuf -NpmysABC-PpmysD Δppc:: P tuf -NpmysABC-PpmysD ΔpoxB carrying plasmid pEC-XK99E-NpmysABC-PpmysD]]> Culture medium 2 0.93 Cgs-08 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD ΔnagB::P tuf -NpmysABC-PpmysD Δppc:: P tuf -NpmysABC-PpmysD ΔpoxB Δpta carrying plasmid pEC-XK99E- NpmysABC-PpmysD]]> Culture medium 2 1.0 Cgs-09 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD ΔnagB::P tuf -NpmysABC-PpmysD Δppc:: P tuf -NpmysABC-PpmysD ΔpoxB Δpta ΔsdaA carrying plasmid pEC-XK99E- NpmysABC-PpmysD]]> Culture medium 2 1.12 Cgs-09 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD ΔnagB::P tuf -NpmysABC-PpmysD Δppc:: P tuf -NpmysABC-PpmysD ΔpoxB Δpta ΔsdaA carrying plasmid pEC-XK99E-NpmysABC-PpmysD]]> Culture medium 1 1.03 Cgs-10 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD ΔnagB::P tuf -NpmysABC-PpmysD Δppc:: P tuf -NpmysABC-PpmysD ΔpoxB Δpta ΔsdaA Δrph:: P tuf -xylABE carrying plasmid pEC-XK99E-NpmysABC-PpmysD]]> Culture medium 1 1.5 Cgs-11-1 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD ΔnagB::P tuf -NpmysABC-PpmysD Δppc:: P tuf -NpmysABC-PpmysD ΔpoxB Δpta ΔsdaA Δrph:: P tuf -xylABE pfkA (ATG→GTG) carrying plasmid pEC-XK99E-NpmysABC-PpmysD]]> Culture medium 1 1.58 Cgs-11-2 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD ΔnagB::P tuf -NpmysABC-PpmysD Δppc:: P tuf -NpmysABC-PpmysD ΔpoxB Δpta ΔsdaA Δrph:: P tuf -xylABEΔ pfkA carrying plasmid pEC-XK99E-NpmysABC-PpmysD]]> Culture medium 1 0.96 Cgs-12 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD ΔnagB::P tuf -NpmysABC-PpmysD Δppc:: P tuf -NpmysABC-PpmysD ΔpoxB Δpta ΔsdaA Δrph:: P tuf -xylABE pfkA(ATG→GTG)ΔP zwf :: P tuf carrying plasmid pEC-XK99E-NpmysABC-PpmysD]]> Culture medium 1 1.63 Cgs-13 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -NpmysABC-PpmysD ΔlldA::P tuf -NpmysABC-PpmysD ΔnagB::P tuf -NpmysABC-PpmysD Δppc:: P tuf -NpmysABC-PpmysD ΔpoxB Δpta ΔsdaA Δrph:: P tuf -xylABE pfkA(ATG→GTG)ΔP zwf :: P tuf ΔP gnd :: P tuf Carrying plasmid pEC-XK99E- NpmysABC-PpmysD]]> Culture medium 1 1.7
[0072] Example 4: Synthesis of Shinorine by Fed-batch Culture in Fermenter
[0073] Fed-batch fermentation experiments of Shinorine in a 50 L fermenter were conducted on genetically engineered strains.
[0074] The genetically engineered Corynebacterium glutamicum Cgs-13 strain obtained in Example 2, which showed good performance, was inoculated into liquid BHIS medium containing kanamycin and cultured overnight at 30°C and 220 rpm for 16–18 h to obtain a primary seed culture. This primary seed culture was then inoculated into a new fermentation system for further expansion culture at 30°C and 220 rpm. 600 =1.0±0.1, to obtain secondary seed culture, which was then inoculated into a 50 L fermenter to achieve a final volume of 20 L culture system (medium 1) for fermentation. Fermentation was carried out at 30°C, with a stirring speed of 220 rpm, an aeration rate of 1~2 vvm, and a pH of 7.0±0.2, until OD reached. 600When the concentration of saturation reaches 15 ± 0.5, add IPTG to a final concentration of 0.9 mM and induce incubation at 30°C for at least 72 h. Dissolved oxygen is controlled by adjusting the stirring speed (220 rpm) and aeration rate (2–6 vvm). During the reaction, add a mother liquor of 500 g / L glucose or 500 g / L xylose to maintain the final glucose and xylose concentrations at 10–15 g / L. Simultaneously, add 50% ammonia to maintain the pH of the entire system at 7.0, thereby maintaining the production of the product Shinorine.
[0075] After 72 hours of fermentation, strain Cgs-13 achieved a Shinorine yield of 13.2 g / L and an OD of [missing value]. 600 The highest reached 139.
[0076] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid shinorine, characterized in that, Starting with Corynebacterium glutamicum ATCC 13032, the gene cluster NpmysABC-PpmysD was heterologously expressed on plasmid pEC-XK99E; the gene cluster NpmysABC-PpmysD was integrated into the genome; the competing pathway gene tal was knocked out, as were the acid production pathway genes poxB and pta, and the serine dehydrogenase gene sdaA; the xylose isomerase gene xylA, the xylulose kinase gene xylB, and the D-xylose:H(+) transporter gene xylE from Escherichia coli were integrated into the genome; the expression of the glucose glycolysis pathway 6-phosphofructokinase gene pfkA was attenuated; and a strong constitutive promoter P was used. tuf Enhance the expression of glucose-6-phosphate dehydrogenase gene zwf and 6-phosphate gluconate dehydrogenase gene gnd; The gene cluster NpmysABC-PpmysD consists of the 3-dehydroquinanate synthase gene NpmysA, the O-methyltransferase gene NpmysB, the ATP-grasp ligase gene NpmysC, and the D-alanine-D-alanine ligase gene PpmysD; genes NpmysA, NpmysB, and NpmysC are derived from *Nostoc punctata* ATCC 29133; gene PpmysD is derived from *Pseudonocardia pini*.
2. A genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid shinorine, characterized in that, The following methods were used to modify Corynebacterium glutamicum ATCC 13032 as the starting strain: 1) Knock out the transaldolase gene tal; 2) Knock out the short-chain dehydrogenase gene Cgl1036 and replace it with one generated by a strong constitutive promoter P. tuf The gene cluster that initiates expression is NpmysABC-PpmysD; 3) Knock out the putative L-lactate dehydrogenase gene lldA and replace it with one generated by the strong constitutive promoter P. tuf The gene cluster that initiates expression is NpmysABC-PpmysD; 4) Knock out the N-acetylglucosamine-6-phosphate isomerase gene nagB and replace it with one generated by a strong constitutive promoter P. tuf The gene cluster that initiates expression is NpmysABC-PpmysD; 5) Knock out the putative ribonuclease pH gene rph and replace it with the strong constitutive promoter P. tuf Initiate expression of the gene cluster xylABE, which consists of xylose isomerase gene xylA, xylulose kinase gene xylB, and D-xylose:H(+) transporter gene xylE; 6) Import the recombinant plasmid pEC-XK99E-NpmysABC-PpmysD; The gene cluster NpmysABC-PpmysD consists of the 3-dehydroquinanate synthase gene NpmysA, the O-methyltransferase gene NpmysB, the ATP-grasp ligase gene NpmysC, and the D-alanine-D-alanine ligase gene PpmysD; genes NpmysA, NpmysB, and NpmysC are derived from Nostoc punctata ATCC 29133; gene PpmysD is derived from Pseudonocardia pini.
3. The genetically engineered Corynebacterium glutamicum for producing the spore-like amino acid Shinorine according to claim 2, characterized in that, The modification method also includes: The start codon of the 6-phosphofructokinase gene pfkA was changed from ATG to GTG.
4. The genetically engineered Corynebacterium glutamicum for producing the spore-like amino acid Shinorine according to claim 3, characterized in that, The modification method also includes: The original promoter of the glucose-6-phosphate dehydrogenase gene zwf was replaced with the strong constitutive promoter P. tuf .
5. The genetically engineered Corynebacterium glutamicum for producing the spore-like amino acid Shinorine according to claim 4, characterized in that, The modification method also includes: The original promoter of the 6-phosphoglucate dehydrogenase gene gnd was replaced with the strong constitutive promoter P. tuf .
6. The genetically engineered Corynebacterium glutamicum for producing the spore-like amino acid Shinorine according to claim 2, characterized in that, The recombinant plasmid includes the following modification method: 1) Using plasmid PEC-XK99E as a vector; 2) Genes NpmysA, NpmysB, NpmysC and PpmysD were integrated into plasmid PEC-XK99E and expressed to obtain PEC-XK99E-NpmysABC-PpmysD.
7. The genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid Shinorine according to any one of claims 2-6, characterized in that, 1) The strongly constitutive promoter P tuf The nucleotide sequence is shown in SEQ ID NO.1; 2) The amino acid sequence of the 3-dehydroquinanate synthase is shown in SEQ ID NO.2; 3) The amino acid sequence of the O-methyltransferase is shown in SEQ ID NO.3; 4) The amino acid sequence of the ATP-grasp ligase is shown in SEQ ID NO.4; 5) The amino acid sequence of the D-alanine-D-alanine ligase is shown in SEQ ID NO.
5.
8. A method for constructing a genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid shinorine, characterized in that, The method for modifying the starting strain as described in any one of claims 2-8.
9. The use of the genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid Shinorine according to any one of claims 1-8, or the genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid Shinorine constructed by the method of claim 9, in the production of Shinorine.