A laccase and its gene, preparation method and application
Patent Information
- Application Number
- CN202610788799.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-03
- Publication Date
- 2026-08-18
AI Technical Summary
该酶具有广谱底物催化活性,可协同高效降解AFB1、ZEN及FB1,有效解决食品与饲料原料中多种霉菌毒素联合污染的技术难题
[0017]This invention provides a laccase BCP36 that simultaneously and efficiently degrades AFB1, ZEN, and FB1, overcoming the limitations of existing single-toxin degradation technologies. It provides a complete application chain (encoding gene → engineered bacteria → preparation process) to realize enzyme preparation production. Given the common problem of multi-toxin contamination in grain and feed raw materials and products, this enzyme has a promising application prospect in the field of bio-enzyme degradation and detoxification.
Smart Images

Figure CN122588023A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural biotechnology, and more specifically to a laccase, its gene, preparation method, and application. Background Technology
[0002] Mycotoxins are toxic secondary metabolites produced by toxin-producing fungi such as Aspergillus flavus, Aspergillus ochraceus, and Fusarium. They mainly include aflatoxin B1 (AFB1), ochratoxin A (OTA), vomitoxin (DON), zearalenone (ZEN), and fumonisin B1 (FB1). Grain products are susceptible to mold contamination during post-harvest processing. Under suitable temperature and humidity conditions, toxin accumulation can lead to serious health risks such as liver and kidney damage, cell necrosis, teratogenicity, and carcinogenicity, posing a significant threat to humans and animals and causing substantial economic losses and international trade barriers.
[0003] Current monitoring of contamination in raw materials and products such as grains and feed shows that aflatoxin and fusarium toxins are important contaminants. Aflatoxin is produced by the metabolism of Aspergillus flavus and Aspergillus parasiticus, mainly contaminating peanuts, corn, wheat, and their products. Among them, AFB1 is the most toxic, with extremely strong hepatotoxicity and carcinogenicity, and is an important contributing factor to liver cancer. Fusarium toxins are a variety of toxic secondary metabolites produced by pathogenic fungi of the Fusarium genus, mainly including zearalenone, fumonisin, and vomitoxin, mainly contaminating corn, wheat, and their products. Vomitoxin has enterotoxicity and mutagenicity, and can cause symptoms such as vomiting and anorexia in animals. ZEN, as an estrogen-like compound, can cause estrogen level disorders in animals, and persistent poisoning can lead to reproductive disorders and miscarriage. Fumonisin is produced by Fusarium verticillata, with fumonisin B1 being its main component. As a ceramide synthase inhibitor, it can interfere with the normal synthesis of sphingolipids, causing neurotoxicity.
[0004] It is worth noting that grains and feed often contain multiple toxin contaminations, such as aflatoxin and fusarium toxins (e.g., AFB1, ZEN, FB1 coexisting). Safely removing these toxins and minimizing raw material and product losses is crucial. Enzymatic degradation is an important method for removing mycotoxin contamination. However, existing biodegradation technologies are mostly designed for single toxins and cannot meet the need for simultaneous detoxification. Therefore, developing enzyme preparations that can efficiently and synergistically degrade multiple key mycotoxins has urgent application value for ensuring food safety and reducing industrial losses. Summary of the Invention
[0005] In view of this, the present invention provides a laccase, its gene, preparation method, and applications. This enzyme has broad-spectrum substrate catalytic activity and can synergistically and efficiently degrade AFB1, ZEN, and FB1, effectively solving the technical problem of co-contamination by multiple mycotoxins in food and feed raw materials.
[0006] A laccase, the amino acid sequence of which is shown in SEQ ID NO.1.
[0007] The present invention also provides a nucleic acid molecule encoding the laccase of claim 1.
[0008] Preferred: The coding sequence of the nucleic acid molecule is shown in SEQ ID NO.2.
[0009] The present invention also provides recombinant vectors, expression cassettes, transgenic cell lines, and recombinant bacteria containing the above-mentioned nucleic acid molecules.
[0010] The present invention also provides the application of the above-mentioned laccase or the above-mentioned nucleic acid molecule or the above-mentioned recombinant vector, expression cassette, transgenic cell line, and recombinant bacteria in the degradation of multiple mycotoxin contamination.
[0011] The present invention also provides a method for preparing the above-mentioned laccase, wherein the coding gene of the above-mentioned nucleic acid molecule is inserted into an expression vector, and Pichia pastoris is transformed to obtain recombinant bacteria; laccase expression is then cultured and induced.
[0012] The present invention also provides a multi-mycotoxin degrading enzyme preparation comprising the above-mentioned laccase.
[0013] The present invention also provides a method for degrading a variety of mycotoxins, wherein the above-mentioned laccase or the above-mentioned enzyme preparation is mixed with a variety of mycotoxins to carry out a catalytic reaction.
[0014] Furthermore, the amino acid sequence of laccase BCP36 with degradation and detoxification function can be: a fragment of the sequence shown in SEQ ID NO.1, a modified variant (containing substitution / deletion / insertion of one or more amino acids); or a derived sequence that has ≥90% sequence homology (preferably ≥95%) with the amino acid sequence shown in SEQ ID NO.1 and retains the toxin degradation function.
[0015] The nucleotide sequence encoding laccase BCP36 is: a fragment of the sequence shown in SEQ ID NO.2, a modified variant (containing one or more nucleotide substitutions / deletions / insertions); or a derived sequence having ≥90% sequence homology (preferably ≥95%) with the nucleotide sequence shown in SEQ ID NO.2 and expressing a toxin-degrading protein.
[0016] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a laccase and its gene, a preparation method and its application, and the technical effects achieved are as follows:
[0017] This invention provides a laccase BCP36 that simultaneously and efficiently degrades AFB1, ZEN, and FB1, overcoming the limitations of existing single-toxin degradation technologies. It provides a complete application chain (encoding gene → engineered bacteria → preparation process) to realize enzyme preparation production. Given the common problem of multi-toxin contamination in grain and feed raw materials and products, this enzyme has a promising application prospect in the field of bio-enzyme degradation and detoxification.
[0018] In the case of corn flour contamination with multiple toxins, the degradation and detoxification efficiency of AFB1, ZEN and FB1 were all above 55%; under the conditions of 37℃ and pH 7.5, the degradation rate of AFB1 was 100.0%, the degradation rate of ZEN was 98.8% and the degradation rate of FB1 was 99.8%. Attached Figure Description
[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0020] Figure 1 The attached figure is a schematic diagram of the recombinant expression vector provided by the present invention.
[0021] Figure 2 The attached figure is an SDS-PAGE electrophoresis diagram of the crude protein BCP36 expression product provided by the present invention.
[0022] Figure 3 The attached figure is a chromatogram of ZEN toxin after treatment with the crude BCP36 enzyme solution provided by the present invention for 24 h.
[0023] Figure 4 The attached figure is a comparison chart of the degradation efficiency of ZEN by BCP36 under different treatment conditions provided by the present invention.
[0024] Figure 5 The attached figure shows the catalytic degradation efficiency of ZEN, AFB1, OTA, DON, and FB1 by the crude enzyme solution of BCP36 provided by the present invention.
[0025] Figure 6 The attached figure shows the removal effect of the BCP36 crude enzyme solution provided by the present invention on ZEN, AFB1, and FB1 contamination in corn flour. Detailed Implementation
[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0027] This invention discloses a laccase, its gene, preparation method, and application.
[0028] The experimental reagents used in the examples, namely AFB1, ZEN, and FB1 standards, were purchased from the Tanmo Quality Inspection Standard Material Center. All other reagents and raw materials used were conventional commercially available products. Methods and procedures not mentioned are standard and will not be described further here.
[0029] Example 1
[0030] Preparation of laccase (mycotoxin-degrading enzyme) BCP36
[0031]
[0032] Linearization of expression vector pPICZαA: This was achieved by PCR amplification. Using plasmid DNA as a template, PCR amplification was performed using primer 3 (SEQ ID No. 5: 5'-AGCTTTCTAGAACAAAAACTCATC-3') and primer 4 (SEQ ID No. 6: 5'-AGCTTCAGCCTCTCTTTTC-3'). The reaction conditions were the same as above, but the extension time was extended to 40 s. The amplification product was purified by gel extraction.
[0033] The laccase gene fragment was homologously recombinated with the linearized pPICZɑA vector using a one-step rapid cloning kit (based on the vector terminal homologous sequences introduced at the 5′ end by primers 1 and 2, namely AAAAGAGAGGCTGAAGCT and GAGTTTTGTTCTAGAAAGCT). The product (see schematic diagram of the recombinant expression vector pPICZ-Bcp36) is shown below. Figure 1 Transformed into *E. coli* DH5α competent cells, and screened on LB plates containing 25 μg / mL bleomycin. Positive clones were subjected to plasmid extraction (SanPrep endotoxin-free plasmid DNA mini-extraction kit; Sangon Biotech (Shanghai) Co., Ltd., B518162), amplification using primer 5 (SEQ ID No. 7: 5'-CAGCATCCTCCGCATTAG-3') and primer 6 (SEQ ID No. 8: 5'-GGCATTCTGACATCCTCTT-3'), and sequencing verification. The recombinant plasmid was then electroporated into *Pichia pastoris* GS115 competent cells and screened on YPD medium containing 100 μg / mL bleomycin to obtain engineered strains.
[0034] Positive engineered bacteria were inoculated as single colonies onto YPD plates containing 100 μg / mL bleomycin and streaked. Single colonies were picked and inoculated into BMGY liquid medium (30 ℃, 250 rpm) and cultured until OD500. 600 =2.0–6.0 (approximately 16–24 h). Collect bacterial cells by centrifugation, resuspend in BMMY medium (containing 0.5% methanol), and continue induction at 30 °C. Add methanol every 24 h to maintain induction, for a total of 72 h. After induction, collect the supernatant (crude secretory enzyme solution) by centrifugation.
[0035] Example 2
[0036] SDS-PAGE electrophoresis of crude BCP36 recombinant enzyme solution
[0037] Bacterial cells obtained from BMGY culture were centrifuged at 12,000 g for 10 min at 4 ℃ and resuspended in BMMY medium. During the methanol induction phase (0, 24, 48, and 72 h), 2 mL of bacterial culture was collected and the supernatant was collected under the same centrifugation conditions. The supernatant was subjected to SDS-PAGE electrophoresis and then treated with a protein silver staining kit to record the expression profile of secreted proteins. Figure 2 Results: The molecular weight of BCP36 is approximately 62.5 kDa, and its secretion increased with increasing induction time (0→72 h). Figure 2 The recombinant vector contains an α-factor secretion signal peptide sequence at the front of the BCP36 coding sequence, enabling the target protein to be efficiently secreted into extracellular accumulation; under methanol-induced conditions, the expression level of BCP36 in Pichia pastoris was significantly increased.
[0038] Example 3
[0039] Verification of the degradation efficiency of laccase BCP36 on zearalenone (ZEN)
[0040] To evaluate the degradation efficiency of laccase BCP36 on zearalenone (ZEN) and optimize reaction conditions, a 500 μL reaction system was used to set up a control group and an experimental group. The control group consisted of Tris-HCl buffer without crude enzyme solution, supplemented with 10 μL of ZEN standard (100 μg / mL). The composition of each component in the experimental group is shown in Table 1 below:
[0041]
[0042] The reaction system was incubated with shaking at 37 °C for 24 h, and then 1 mL of methanol was added to terminate the reaction. After methanol extraction and filtration through a 0.2 μm PTFE membrane, the ZEN residue was determined by high-performance liquid chromatography-tandem mass spectrometry (LC-MS / MS). The detection conditions were as follows:
[0043] Chromatographic parameters: Acquity Cortecs UPLC C18 column (1.6 μm, 2.1 × 100 mm); mobile phase A = 1 mM ammonium acetate aqueous solution, B = methanol; flow rate 0.3 mL / min; gradient program: 0–0.5 min 5% B, 0.5–6.5 min linearly up to 90% B, 6.5–7 min maintain 90% B, 7–7.1 min down to 5% B, 7.1–8.5 min equilibrate.
[0044] Mass spectrometry parameters: positive / negative ion switching mode (capillary voltage +2.5 kV / -1.0 kV), source temperature 150 ℃, desolventizing temperature 400 ℃; select reaction monitoring (MRM) mode.
[0045] The results showed that the degradation rates of experimental group 2 (acetylsyleugenone only) and experimental group 3 (copper sulfate only) were low. Figure 3 This indicates that a single cofactor is unlikely to effectively activate enzyme activity; in experimental groups 4–6, under the condition of simultaneous addition of acetylsuccine, copper sulfate, and reducing cofactors NADPH / NADH, the ZEN degradation efficiency was >98%, and there was no significant difference between groups; the LC-MS / MS chromatogram of experimental group 4 showed that the ZEN peak area decreased to the background level ( Figure 4 The study confirmed that laccase BCP36 can almost completely degrade ZEN under optimized conditions. Overall, the efficient degradation of ZEN by laccase BCP36 depends on the synergistic effect of the mediator acetylsuccinone and copper sulfate, and the NADPH / NADH cofactor is not essential.
[0046] Example 4
[0047] The degradation of various mycotoxins by laccase BCP36
[0048] The reaction was prepared as follows: 450 μL of crude enzyme solution was added to 25 μL of Tris-HCl buffer (pH 7.5, 1M), 5 μL of acetylsuccione solution (100 mM), and 2.5 μL of copper sulfate solution (1 M). After mixing, ZEN, AFB1, OTA, DON, and FB1 were added sequentially to final concentrations of 2.0, 1.0, 1.0, 5.0, and 10.0 μg / mL, respectively. Sterile deionized water was added to a final volume of 500 μL. The reaction was incubated at 37 ℃ for 24 h, and the toxin residue was determined according to the method in Example 3. The catalytic degradation efficiency of laccase BCP36 for the toxin was calculated based on the residue.
[0049] The results showed that laccase BCP36 exhibited extremely high catalytic degradation efficiency (>98%, specifically 100.0% for AFB1, 98.8% for ZEN, and 99.8% for FB1) for three toxins; its degradation ability for OTA was poor; and it had no significant degradation effect on the vomitoxin DON. Figure 5 ).
[0050] Example 5
[0051] Removal of mycotoxin contamination from feed by laccase (degrading enzyme) BCP36
[0052] The engineered bacteria were induced to express the enzyme according to the method in Example 1, and the supernatant was collected by centrifugation after 72 h. 5 g of corn flour (containing AFB1, ZEN, and FB1 at final concentrations of 2.0, 1.0, and 10.0 μg / g, respectively) was added to sterile water to prepare a suspension. 1 mL of crude enzyme supernatant, along with appropriate amounts of acetylsuccine and copper sulfate, were added, mixed well, and incubated at 37 ℃ and 200 r / min for 24 h. The control group used an equal volume of sterile water instead of the crude enzyme solution. Treatment method: Extraction was performed with 4 times the volume of acetonitrile, followed by the addition of sodium chloride to separate the layers. The organic phase was collected, concentrated to dryness by nitrogen blowing, and reconstituted with 1 mL of 30% acetonitrile aqueous solution. After filtration through a filter membrane, the residual amounts of the three toxins were detected. The degradation rate of each toxin was calculated based on the toxin levels in the control group.
[0053] The results showed that, in the feed matrix, laccase BCP36 achieved a degradation and detoxification efficiency of over 55% for AFB1, ZEN, and FB1. Figure 6 This indicates that the enzyme maintains good toxin degradation ability in complex matrices, demonstrating strong application potential.
[0054] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.
[0055] Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A laccase, characterized in that, The amino acid sequence is shown in SEQ ID NO.
1.
2. The nucleic acid molecule encoding the laccase of claim 1.
3. The nucleic acid molecule as described in claim 2, characterized in that: The coding sequence of the nucleic acid molecule is shown in SEQ ID NO.
2.
4. A recombinant vector, expression cassette, transgenic cell line, or recombinant bacteria containing the nucleic acid molecule described in claim 2 or 3.
5. The application of the laccase of claim 1, the nucleic acid molecule of claim 2 or 3, or the recombinant vector, expression cassette, transgenic cell line, or recombinant bacteria of claim 4 in the degradation of multiple mycotoxin contamination.
6. The method for preparing laccase according to claim 1, characterized in that: The coding gene of the nucleic acid molecule described in claim 2 or 3 is inserted into the expression vector, and Pichia pastoris is transformed to obtain recombinant bacteria; laccase expression is then induced.
7. A multi-mycotoxin degrading enzyme preparation, characterized in that: It contains the laccase as described in claim 1.
8. A method for degrading multiple mycotoxins, characterized in that: The laccase of claim 1 or the enzyme preparation of claim 7 is mixed with a variety of mycotoxins to carry out a catalytic reaction.