Application of tyrosine decarboxylase OsTyDC1 in enhancing cold tolerance of rice at the seedling stage
Patent Information
- Application Number
- CN202611016542.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-09
- Publication Date
- 2026-08-18
AI Technical Summary
但是直播稻种子直接播种于田间,萌发出苗阶段更容易受到低温胁迫影响
[0024] This invention is the first discovery of the rice tyrosine decarboxylase gene. OsTyDC1 ( LOC_Os10g23900 ( ) is a negative regulator of cold resistance during the rice germination stage, which can be reduced or knocked out. OsTyDC1 The expression of this gene can significantly improve the survival rate and recovery ability of rice under low temperature stress. Compared with the prior art, this invention provides a new cold-resistant gene resource and molecular breeding strategy, which does not require the introduction of exogenous functional genes and does not rely on exogenous hormones or chemical treatments. It has the advantages of high breeding efficiency, genetic stability, and wide application range, and provides important theoretical basis and technical support for the breeding of new cold-resistant rice varieties.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of tyrosine decarboxylase OsTyDC1 in enhancing cold tolerance during the germination stage of rice. Background Technology
[0002] Rice (Oryza sativa L.) is a warm-season crop, and compared to other cereal crops, it is more sensitive to low temperatures and easily suffers from chilling injury. Against the backdrop of decreasing labor force and increased agricultural mechanization, direct-seeded rice has become one of the important development directions for rice production. It has significant advantages compared to traditional transplanted rice. First, direct-seeded rice eliminates the seedling raising and transplanting stages, significantly reducing production costs, freeing up labor, and improving production efficiency. Second, direct-seeded rice reduces the need for continuous flooding, effectively conserving water resources and reducing greenhouse gas emissions. Furthermore, direct-seeding is more conducive to mechanized agricultural operations and large-scale production, improving resource utilization efficiency and agricultural system productivity. Therefore, direct-seeded rice has become one of the important development directions for rice production. However, direct-seeded rice seeds are sown directly in the field, making them more susceptible to low-temperature stress during the germination and seedling stages. Low temperatures can lead to delayed seed germination, reduced emergence rate, and hindered seedling growth, even causing gaps in the rows and affecting plant population establishment. Therefore, improving the cold resistance of rice seedlings during the germination stage is a crucial foundation for ensuring stable and high yields of direct-seeded rice. On the other hand, low temperature is a significant environmental factor limiting the spread of rice to high-latitude and high-altitude regions. Developing cold-resistant varieties during the germination stage is beneficial for expanding the suitable planting area of rice and improving land use efficiency.
[0003] OsTyDC1 is a rice enzyme that encodes tyrosine decarboxylase (TyDC), which catalyzes the decarboxylation of L-tyrosine to produce tyramine. It mainly participates in the metabolic pathways of tyramine-related alkaloids and phenolamides (also known as hydroxycinnamic acid amides), and is usually manifested as a "metabolic reprogramming defense gene" in plant stress resistance.
[0004] Tyramine can serve as a precursor in various metabolic pathways. When plants are subjected to biotic or abiotic stress, tyramine and its derivatives often accumulate. On the one hand, they can enhance cell wall structure and improve tissue mechanical strength and resistance to infection by participating in the cross-linking reaction of cell wall polyphenols and lignin. On the other hand, tyramine and its derivatives also possess certain antioxidant activity, helping to regulate reactive oxygen species (ROS) levels and thus mitigating oxidative damage caused by stress. Furthermore, tyramine can be further converted into bioactive substances such as dopamine, playing a role in plant stress response and signal regulation.
[0005] The TyDC family has been shown to participate in abiotic stress responses in a variety of plants. For example, in apples, TyDC overexpression improves drought tolerance by alleviating stress through increased dopamine levels, enhanced antioxidant capacity, and ABA signaling regulation.
[0006] Tyramine-derived hydroxycinnamic acid amide (HCAA) accumulates in tomatoes after infection with Ralstonia solanacearum and may enhance cell wall resistance and limit pathogen spread by cross-linking with cell wall components, thereby improving the plant's resistance to pathogens. Summary of the Invention
[0007] The main problem this invention aims to solve is how to enhance the resistance of rice to low temperature stress in order to improve the survival rate of rice seedlings.
[0008] To address the aforementioned problems, the present invention provides the use of a substance that regulates the expression of the gene encoding the protein OsTyDC1 or a substance that regulates the activity or content of said protein in any of the following: 1) Application in regulating rice's resistance to low-temperature stress; 2) Application in the preparation of products that regulate the resistance of rice to low-temperature stress; 3) Application in cultivating rice varieties with altered resistance to low-temperature stress; 4) Application in the preparation of rice products with altered resistance to low-temperature stress; The protein is any of the following proteins: a1) A protein with the amino acid sequence SEQ ID No:1; the specific sequence of SEQ ID No:1 is:
[0009] a2) A protein having the same function as the amino acid sequence shown in SEQ ID No:1, but with one or more amino acid residues substituted and / or deleted and / or added. a3) Proteins that share more than 80% identity with the amino acid sequence defined by a1) or a2) and have the same function; a4) A fusion protein obtained by attaching a tag to the end of any of the proteins defined in a1)-a3).
[0010] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0011] Furthermore, the substance may be any of the following: c1) Nucleic acid molecules that encode the proteins described above; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3); c5) A transgenic plant cell line containing the nucleic acid molecule described in c1), or a transgenic plant cell line containing the expression cassette described in c2); c6) Transgenic plant tissue containing the nucleic acid molecules described in c1), or transgenic plant tissue containing the expression cassette described in c2); c7) A transgenic plant organ containing the nucleic acid molecule described in c1), or a transgenic plant organ containing the expression cassette described in c2); e1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the protein-encoding gene; e2) An expression cassette containing the nucleic acid molecule described in e1); e3) A recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2); e4) Recombinant microorganisms containing the nucleic acid molecules described in e1), or recombinant microorganisms containing the expression cassette described in e2), or recombinant microorganisms containing the recombinant vector described in e3); e5) A transgenic plant cell line containing the nucleic acid molecule described in e1), or a transgenic plant cell line containing the expression cassette described in e2); e6) Transgenic plant tissue containing the nucleic acid molecules described in e1), or transgenic plant tissue containing the expression cassette described in e2); e7) A transgenic plant organ containing the nucleic acid molecule described in e1) or a transgenic plant organ containing the expression cassette described in e2).
[0012] Further, c1) the nucleic acid molecule is any of the following DNA molecules: d1) The nucleotide sequence is the DNA molecule shown in SEQ ID No:2; d2) DNA molecules that have 90% or more identity with d1) or the defined nucleotide sequence and encode the protein described above; d3) Hybridizes under stringent conditions to a nucleotide sequence defined by d1) or d2) and encodes a DNA molecule that encodes the protein of claim 1.
[0013] When constructing a recombinant plant expression vector using the OsTyDC1 gene, any enhanced or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the ubiquitin promoter of maize. These can be used alone or in combination with other plant promoters.
[0014] The present invention also provides a method for enhancing the resistance of rice to low temperature stress, wherein the method is to inhibit or reduce the activity and / or content of the protein OsTyDC1 in the recipient rice, or / and, inhibit or reduce the expression level of the gene encoding the protein, so as to enhance the resistance of the recipient rice to low temperature stress. The present invention also provides a method for reducing the resistance of rice to low temperature stress, wherein the method is to enhance or increase the activity and / or content of the protein OsTyDC1 in the recipient rice, or / and enhance or increase the expression level of the gene encoding the protein, so as to reduce the resistance of the recipient rice to low temperature stress.
[0015] The present invention also provides a method for breeding rice varieties with enhanced resistance to low temperature stress, comprising inhibiting the expression of the gene encoding the protein OsTyDC1 in the recipient rice to obtain a low temperature stress resistant rice variety, wherein the low temperature stress resistant rice has stronger resistance to low temperature stress than the recipient rice.
[0016] Specifically, the inhibition of the expression of the gene encoding the protein OsTyDC1 in the recipient rice includes introducing the nucleic acid molecule described in e1), the expression cassette described in e2), or the recombinant vector described in e3) into the recipient rice to obtain a rice variety with enhanced resistance to low-temperature stress.
[0017] In the above method, the expression of the gene encoding the protein OsTyDC1 in the inhibitory receptor rice is achieved by the CRISPR / Cas9 system.
[0018] In the above method, the target site for gene editing by the CRISPR / Cas9 system is positions 880-899 of SEQ ID No:2.
[0019] In the above method, inhibiting the expression of the gene encoding the protein OsTyDC1 in the recipient rice can be achieved by performing at least one of the following mutations on the gene encoding the protein shown in SEQ ID No:2 in the recipient rice genome: 1) OsTyDC1 The nucleotide "G" is deleted at position 884 of SEQ ID No:2 in the gene; 2) OsTyDC1 The nucleotide “5'-CGCCTGGG-3'” between positions 885 and 892 of SEQ ID No:2 in the gene is deleted.
[0020] In this article, the low-temperature stress resistance can refer to improving the survival rate. The survival rate can refer to the bud stage survival rate.
[0021] In this article, the treatment conditions for low-temperature stress can be: treatment at 2℃ for 60 h-72 h.
[0022] In this article, the rice mentioned can be rice ZH11.
[0023] In this article, the recombinant microorganism may be Agrobacterium EHA105.
[0024] This invention is the first discovery of the rice tyrosine decarboxylase gene. OsTyDC1 ( LOC_Os10g23900 ( ) is a negative regulator of cold resistance during the rice germination stage, which can be reduced or knocked out. OsTyDC1 The expression of this gene can significantly improve the survival rate and recovery ability of rice under low temperature stress. Compared with the prior art, this invention provides a new cold-resistant gene resource and molecular breeding strategy, which does not require the introduction of exogenous functional genes and does not rely on exogenous hormones or chemical treatments. It has the advantages of high breeding efficiency, genetic stability, and wide application range, and provides important theoretical basis and technical support for the breeding of new cold-resistant rice varieties. Attached Figure Description
[0025] Figure 1 for ostydc1 Sequencing peak diagram and sequence alignment diagram of the mutation site. A represents ZH11 and... ostydc1-1 and ostydc1-2 Nucleotide sequence alignment results; B represents ZH11 and... ostydc1-1 and ostydc1-2 Nucleotide sequencing peak alignment results; C represents ZH11 and... ostydc1-1 and ostydc1-2 A schematic diagram of amino acid coding.
[0026] Figure 2 for OsTyDC1 Overexpression lines OsTyDC1 Expression level detection. Where A is... pH2GW7 - OsTyDC1 Schematic diagram of vector construction; B represents Q-PCR detection. OsTyDC1 Overexpression lines OsTyDC1 The amount of expression.
[0027] Figure 3 for OsTyDC1 Phenotypic and statistical graphs of cold-treated mutant plants. A, B, and C represent ZH11 and os plants at the bud stage. tydc1-1 and ostydc1-2Phenotypic images taken 10 days after recovery following 72 hours of cold treatment at 2°C; D represents survival rate statistics. Student's t-test was used for significance analysis. All data are statistical results of three biological replicates (n>24), ** represents p <0.01, * represents p <0.05.
[0028] Figure 4 for OsTyDC1 Phenotypic and statistical graph of transgenic plants after cold treatment. A, B, and C represent ZH11 plants that have grown to the bud stage. OsTyDC1 -OE1 and OsTyDC1 -OE2 cells were cold-treated at 2°C for 60 hours, and the phenotype was restored after 10 days of growth. D represents the corresponding survival rate statistics. Student's t-test was used for significance analysis. All data are statistical results of three biological replicates (n>24). ** represents p <0.01. Detailed Implementation
[0029] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0031] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0032] ZH11 in the following examples is described in: Luo W et al., COLD6-OSM1 module senseschilling for cold tolerance via 2′,3′-cAMP signaling in rice. Molecular Cell, 2024, 84:4224-4238. This biomaterial is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.
[0033] The pH2GW7 and pDONR207 vectors used in the following examples were provided by Professor Luo Jie of Hainan University and are described in: Shen S et al., An Oryza-specific hydroxycinnamoyl tyramine gene clustercontributes to enhanced disease resistance[J]. Science Bulletin, 2021, 66(23): 2369–2380. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention; it may not be used for any other purpose.
[0034] Example 1 OsTyDC1 Creation of transgenic plants Based on the genetic information provided by the Rice Genomes MSU database (http: / / rice.uga.edu / cgi-bin / gbrowse / rice / ), OsTyDC1 The gene number is LOC_Os10g23900 It encodes tyrosine decarboxylase. The gene has a CDS length of 1581 bp, contains only one exon, and encodes a protein containing 526 amino acids.
[0035] The amino acid sequence of the OsTyDC1 protein is shown in SEQ ID No:1, the nucleotide sequence of the coding sequence (CDS) of the OsTyDC1 protein is shown in SEQ ID No:2, and the genomic sequence of the OsTyDC1 protein is the same as the CDS sequence.
[0036] 1. Obtaining overexpression materials (1) Modification of pH2GW7 carrier Approximately 0.2 g of seedlings of the maize variety Zhongzuo-Zhongdan 8 (purchased from Beijing Zhongnongzuo Technology Development Co., Ltd.) were cut and ground in liquid nitrogen. Then, 800 μL of freshly prepared extraction buffer (containing 0.1 M Tris-HCl pH 8.0, 50 mM EDTA, 0.5 M NaCl, 1% SDS, and 1% β-mercaptoethanol) was added, and the mixture was vigorously shaken to resuspend it completely. The mixture was then incubated at 65°C for 30 min, inverted every 5 min to mix. Next, 250 μL of pre-chilled 5 M potassium acetate aqueous solution was added, and the mixture was immediately inverted and incubated on ice for 5 min. An equal volume of phenol / chloroform was added, and the mixture was extracted once, centrifuged at 10000 g for 5 min. The supernatant was collected, and 0.6 times the volume of isopropanol was added to precipitate the DNA. The mixture was incubated at room temperature for 40 min. It was then centrifuged at 10000 g for 15 min at 4°C, and the supernatant was discarded. The precipitate was washed once with 70% ethanol and once with 100% ethanol. After drying, the precipitate was dissolved in 20 μL of RNase-free concentrate containing 100 μg / mL. Maize genomic DNA was obtained in H2O.
[0037] Take 2 μL of the above maize genomic DNA solution as a template, and in the sample containing... Sac I recognize site 5 Primer (5'-TC) GAGCTC CTGCAGTGCAGCGTGACCCGG-3') and with Spe I identification site 3 Primer (5'-TC) [[ID=3S4]]ACTAGT Using primers (AAGTAACACCAAACAACAGGG-3'), PCR amplification was performed. The PCR reaction conditions were: 94℃ for 3 min; then 94℃ for 45 seconds, 62℃ for 45 seconds, 72℃ for 2 min, for a total of 35 cycles; and finally 72℃ for 10 min. After the reaction, the PCR product was detected by 0.8% agarose gel electrophoresis, which showed that an amplified fragment of approximately 2 kb in length was obtained, consistent with the expected result. The target fragment was recovered and sequenced to confirm that it was the maize ubiquitin promoter (UbiPro, nucleotide sequence SEQ ID No:5). The above-mentioned maize ubiquitin promoter (UbiPro) can also be synthesized artificially.
[0038] The 35S Promoter was excised from the vector pH2GW7 using restriction endonucleases Sac I and Spe I. The linearized large fragment of the vector was recovered and linked to the maize ubiquitin promoter (UbiPro) with sticky ends obtained by double digestion with Sac I and Spe I in (2) to obtain the recombinant vector pH2GW7-UbiPro.
[0039] The structure of the vector pH2GW7-UbiPro is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:5 between the two restriction sites of Sac I and Spe I in the vector pH2GW7, while keeping the other sequences of the vector pH2GW7 unchanged.
[0040] (2) Expression vector pH2GW7- OsTyDC1 Construction Will OsTyDC1 After amplification of cDNA from *Oryza sativa* L. ssp. *japonica* cv. *Nipponbare*, the PCR product was cloned into the pDONR207 vector (provided by Professor Luo Jie of Hainan University) via a BP recombination reaction to construct an entry clone. Subsequently, the entry clone was subjected to an LR recombination reaction with the plant expression vector pH2GW7, allowing the target gene to be directionally inserted downstream of the Ubi promoter, thus constructing the recombinant expression vector pH2GW7-. OsTyDC1 Finally, the recombinant plasmid was transferred into Agrobacterium and used for genetic transformation of rice to obtain overexpressing transgenic plants.
[0041] The recombinant expression vector pH2GW7-OsTyDC1 was obtained by inserting the DNA fragment shown in SEQ ID No:2 into the attR1 and attR2 sites of the destination vector via an LR recombination reaction within the pH2GW7-UbiPro expression vector. The recombinant target sequence retained attB1 (5'-ACAAGTTTGTACAAAAAAGCAGGCT-3') and attB2 (5'-ACCACTTTGTACAAGAAAGCTGGGT-3') sequences at both ends, respectively. A schematic diagram of the recombinant expression vector pH2GW7-OsTyDC1 is shown below. Figure 2 A.
[0042] 2. Obtaining genetically modified rice The pH2GW7-OsTyDC1 plasmid was transformed into Agrobacterium EHA105 (Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6: 271–282, available to the public from the Institute of Botany, Chinese Academy of Sciences). Overexpressing engineered bacteria with positive clones were obtained by screening on kanamycin-containing resistant plates, and the positive clones were identified by PCR.
[0043] Will pUN1301- The OsTyDC1 plasmid was used to infect callus tissue of GLA4 rice. Agrobacterium expressing pH2GW7-OsTyDC1 was cultured overnight at 28°C and 200 rpm with shaking. The bacterial culture was collected by centrifugation, and the supernatant was discarded. The bacterial cells were then resuspended in AAM-AS medium and infected with callus for 20 min. The callus tissue was then transferred to subculture medium N6D2C and cultured in the dark for 3 days. The callus tissue was then washed 5 times with sterile water containing 300 mg / L cephalosporin, dried with sterile filter paper, and transferred to N6D2S1 medium for first-generation selection. Two weeks later, the callus tissue was transferred to N6D2S2 medium for second-generation selection (2 weeks / generation). The resistant callus tissue that had grown vigorously after 3 generations of selection was taken and transferred to differentiation medium (1) and cultured in a differentiation incubator (12-hour photoperiod, 28°C during the day and 25°C at night) for 7 days. Then it was transferred to differentiation medium (2) and cultured in a differentiation incubator until regenerated seedlings were produced. The regenerated plants take root and grow strong on the rooting and seedling culture medium; when the seedlings grow to about 10 cm, the container sealing film is opened, the seedlings are hardened off for 2-3 days, and then the seedlings are transferred to an artificial climate chamber for cultivation to obtain T0 generation transgenic rice.
[0044] The culture media used are shown in Table 1 below.
[0045] Table 1. Culture medium formulations used
[0046] 3. Overexpression OsTyDC1 Identification of rice Extraction of T2 generation to pH2GW7- OsTyDC1Total RNA from rice seedlings was treated with RNase-free DNase I. 2 μg of total RNA was reverse transcribed into the first strand of cDNA using M-MLV reverse transcriptase. Gene-specific primers were designed using Primer Express 2.0 (Applied Biosystems), with UBI primers as internal standards. The UBI forward primer was 5´-AGGGTTCACAAGTCTGCCTATTT-3´, and the reverse primer was 5´-TCTTCCATGCTGCTCTACCACA-3´. The temperature range (Tm) was 55–60°C, the GC content was 40–60%, and the amplified target fragment length was 100–150 bp. Primers used for quantitative PCR detection are as follows: Forward primer: 5´- GCATCAACGTCGTTCCCTTC -3´; Reverse primer: 5´- GGTGGTCCCGAGGATGGA -3´.
[0047] Dilute the reverse transcription product 20-fold and use 3 μL as a template. Prepare the reaction solution using the SYBR GREEN PCR kit (SYBR® Green Realtime PCR Master Mix, Toyobo, Japan) as follows (15.0 μL): 7.5 μL SYBR® Green Realtime PCR Master Mix, 0.25 μL forward primer, 0.25 μL reverse primer, 3.0 μL cDNA, and 4.0 μL H2O.
[0048] The PCR program was run on a real-time quantitative PCR instrument MX3000P (Stratagene, USA): 95℃ for 2 min; 95℃ for 15 s, 58℃ for 10 s, 72℃ for 15 s; for a total of 45 cycles; 95℃ for 30 s, 58℃ for 30 s, 95℃ for 30 s. The relative expression level of the gene was calculated based on the CT value.
[0049] The results are as follows Figure 2 As shown in Figure B, when UBI is used as an internal control, compared with wild-type rice (ZH11), OsTyDC1 -OE1 and OsTyDC1 -T2 generation of OE2 plants converted to pH2GW7- OsTyDC1 rice seedlings OsTyDC1 The expression abundance of the target gene was upregulated to varying degrees, indicating that the expression of the target gene was... OsTyDC1 It has been successfully expressed at the transcriptional level.
[0050] 4. OsTyDC1CRISPR / Cas9 mutant identification The mutant seeds used in this invention were purchased from a commercial company (Baige Gene Technology (Jiangsu) Co., Ltd., No.: BG101393D08), and the initial material was heterozygous. Individual plants of this material were self-pollinated to obtain a T1 segregating population. Genotyping of the T1 individuals was performed, and homozygous mutant individuals were screened. These were further self-pollinated to obtain a stable, heritable T2 homozygous mutant line for subsequent phenotypic analysis and functional studies.
[0051] T2 generation rice DNA was extracted and used as a template for PCR reaction according to the following system: 0.2 μL PrimerSTAR HSDNA Polymerase (5 U / μL), 10 μL 2 GC buffer, 1.8 μL dNTPs, 0.5 μL 5' primer (10 μM), 0.5 μL 3' primer (10 μM), and ddH2O added to a final volume of 20 μL. Primer sequences: 5'-CGTCAGGGTCGTCTGGTTGTC -3', 3'-AGCCACTTGTGGGCGTTCAT -3'. The PCR program was as follows: pre-denaturation at 98℃ for 30 seconds, followed by PCR cycling with the following parameters: denaturation at 98℃ for 10 seconds → annealing at 52℃ for 15 seconds → extension at 72℃ for 4 min for 20 seconds, for 35 cycles, followed by synthesis at 72℃ for 10 min.
[0052] The results are as follows Figure 1 As shown: Obtain OsTyDC1 Loss-of-function mutants of genes ostydc1-1 and ostydc1-2 .
[0053] Sequencing analysis revealed that, compared to the wild-type ZH11 genomic DNA, ostydc1-1 Of the two homologous chromosomes OsTyDC1 The genes all underwent the following mutations: OsTyDC1 The deletion of nucleotide G at position 884 of SEQ ID No:2 in the gene; the deletion of this nucleotide causes a frameshift, resulting in premature termination of translation and loss of function of the OsTyDC1 protein, thereby... OsTyDC1 Gene knockout Figure 1 (A, B, and C in the middle).
[0054] Sequencing analysis revealed that, compared to the wild-type ZH11 genomic DNA, ostydc1-2 Of the two homologous chromosomes OsTyDC1 The genes all underwent the following mutations: OsTyDC1The nucleotide sequence “5'-CGCCTGGG-3'” between positions 885 and 892 of SEQ ID No:2 in the gene is deleted. This deletion causes a frameshift, resulting in an alteration of the OsTyDC1 amino acid profile, leading to the loss of function of the OsTyDC1 protein. OsTyDC1 Gene knockout Figure 1 (A, B, and C in the middle).
[0055] Example 2: Phenotypic observation of transgenic rice 1. ostydc1 Phenotypic observation of mutant lines OS tydc1-1 / ZH11 and ostydc1-2 T2 generation seeds of / ZH11 and corresponding wild-type ZH11 seeds were placed in kraft paper bags and soaked at room temperature for 2 days. After the seeds showed signs of sprouting, they were transferred to petri dishes and placed in a 37℃ constant temperature incubator to promote germination. When the seedlings grew to 5–10 mm and the roots were about 10–20 mm long, seeds with uneven germination or those that did not meet the standards were removed, and seedlings with uniform development were selected for subsequent treatment.
[0056] The petri dishes were slowly placed into a 2°C water bath for cryogenic treatment. During the process, cold water was slowly added to the petri dishes, ensuring the water level was full and free of air bubbles, with the entire petri dish submerged approximately 5 cm below the water surface to guarantee uniform temperature. The treatment time was 72 h. After cryogenic treatment, the petri dishes were transferred to an artificial climate chamber for recovery culture for 10 days (light intensity 10000 µmol / m² / s, light duration 14 h / d, temperature 30°C). The plants were then photographed, and the survival rate was recorded. Each line had 24 seeds, and each treatment was repeated three times. The average value was used for statistical analysis.
[0057] The photographic results are as follows Figure 3 As shown in AC: ZH11 and ostydc1-1 , ostydc1-2 The buds were treated in a low-temperature water bath at 2°C for 72 hours and allowed to recover growth for 10 days. ostydc1- , The mutants showed significant differences in tolerance to low-temperature stress compared to wild-type rice ZH11.
[0058] Survival rate statistics as follows As shown in Figure D: After treatment at 2℃ for 72 h, growth recovered in 10 days. and The survival rates were 20.07% and 16.39%, respectively, while the survival rate of wild-type ZH11 was approximately 3.61%.
[0059] The above results indicate that low-temperature treatment The survival rate of mutant rice was significantly higher than that of wild type.
[0060] 2. Phenotypic observation of overexpression lines Number -OE1 / ZH11 and -OE2 / ZH11 T2 generation conversion Rice seeds and ZH11 (wild type) seeds were placed in kraft paper bags and soaked at room temperature for 2 days. After the seeds showed signs of sprouting, they were transferred to petri dishes and placed in a 37℃ constant temperature incubator to germinate. When the seedlings grew to 5–10 mm and the roots were about 10–20 mm long, seeds with uneven germination or those that did not meet the standards were removed, and seedlings with uniform development were selected for subsequent treatment.
[0061] The petri dishes were slowly placed into a 2°C water bath for cryogenic treatment. During the process, cold water was slowly added to the petri dishes, ensuring the dishes were completely filled with water and free of air bubbles, with the entire petri dish submerged approximately 5 cm below the water surface to guarantee uniform low temperature. The treatment time was 60 h. After cryogenic treatment, the petri dishes were transferred to an artificial climate chamber for recovery culture for 10 days (light intensity 10000 µmol / m² / s, light duration 14 h / d, temperature 30°C). The plants were then photographed, and the survival rate was recorded. Each line had 24 seeds, and each treatment was repeated three times. The average value was used for statistical analysis.
[0062] The photographic results are as follows As shown in AC: ZH11 and -OE1、 -OE2 buds were treated in a low-temperature water bath at 2°C for 60 hours and allowed to recover growth for 10 days. -OE1 and -OE2 showed significantly different tolerance to low-temperature stress compared to wild-type rice ZH11.
[0063] Survival rate statistics as follows As shown in Figure D, growth recovered after 10 days following treatment at 2℃ for 60 h. -OE1 and The survival rates for -OE2 were 13.57% and 22.77%, respectively, while the survival rate for wild-type ZH11 was approximately 43%.
[0064] The above results indicate that after low-temperature treatment The survival rate of the overexpression lines was significantly lower than that of the wild type.
[0065] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. The use of a substance that regulates the expression of the gene encoding the protein OsTyDC1 or a substance that regulates the activity or content of said protein in any of the following: 1) Application in regulating rice's resistance to low-temperature stress; 2) Application in the preparation of products that regulate the resistance of rice to low-temperature stress; 3) Application in cultivating rice varieties with altered resistance to low-temperature stress; 4) Application in the preparation of rice products with altered resistance to low-temperature stress; The protein is any of the following proteins: a1) A protein with the amino acid sequence SEQ ID No:1; a2) A protein having the same function as the amino acid sequence shown in SEQ ID No:1, but with one or more amino acid residues substituted and / or deleted and / or added. a3) Proteins that share more than 80% identity with the amino acid sequence defined by a1) or a2) and have the same function; a4) A fusion protein obtained by attaching a tag to the end of any of the proteins defined in a1)-a3).
2. The application according to claim 1, characterized in that, The substance is any one of the following: c1) A nucleic acid molecule encoding the protein described in claim 1; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3); c5) A transgenic plant cell line containing the nucleic acid molecule described in c1), or a transgenic plant cell line containing the expression cassette described in c2); c6) Transgenic plant tissue containing the nucleic acid molecules described in c1), or transgenic plant tissue containing the expression cassette described in c2); c7) A transgenic plant organ containing the nucleic acid molecule described in c1), or a transgenic plant organ containing the expression cassette described in c2); e1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the protein-encoding gene; e2) An expression cassette containing the nucleic acid molecule described in e1); e3) A recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2); e4) Recombinant microorganisms containing the nucleic acid molecules described in e1), or recombinant microorganisms containing the expression cassette described in e2), or recombinant microorganisms containing the recombinant vector described in e3); e5) A transgenic plant cell line containing the nucleic acid molecule described in e1), or a transgenic plant cell line containing the expression cassette described in e2); e6) Transgenic plant tissue containing the nucleic acid molecules described in e1), or transgenic plant tissue containing the expression cassette described in e2); e7) A transgenic plant organ containing the nucleic acid molecule described in e1) or a transgenic plant organ containing the expression cassette described in e2).
3. The application according to claim 2, characterized in that: c1) The nucleic acid molecule is any of the following DNA molecules. d1) The nucleotide sequence is the DNA molecule shown in SEQ ID No:2; d2) has 90% or more identity with the nucleotide sequence defined in d1) and is a DNA molecule encoding the protein of claim 1; d3) Hybridizes under stringent conditions to a nucleotide sequence defined by d1) or d2) and encodes a DNA molecule that encodes the protein of claim 1.
4. A method for enhancing the resistance of rice to low-temperature stress, characterized in that: The method is to inhibit or reduce the activity and / or content of the protein described in claim 1 in the recipient rice, or / and to inhibit or reduce the expression level of the gene encoding the protein described in claim 1, so as to enhance the low temperature stress resistance of the recipient rice.
5. A method for reducing the resistance of rice to low-temperature stress, characterized in that: The method is to enhance or increase the activity and / or content of the protein described in claim 1 in the recipient rice, or / and enhance or increase the expression level of the gene encoding the protein described in claim 1, so as to weaken the low temperature stress resistance of the recipient rice.
6. A method for breeding rice varieties with enhanced resistance to low-temperature stress, characterized in that, Including inhibiting the expression of the gene encoding the protein described in claim 1 in the recipient rice, to obtain a low-temperature stress resistant rice variety, wherein the low-temperature stress resistant rice has stronger low-temperature stress resistance than the recipient rice.
7. The method according to claim 6, characterized in that, The inhibition of the expression of the gene encoding the protein of claim 1 in the recipient rice comprises introducing the nucleic acid molecule of claim 4 (e1), the expression cassette of claim 4 (e2), or the recombinant vector of claim 4 (e3) into the recipient rice to obtain a rice variety with enhanced resistance to low temperature stress.