A method for detecting food bovine-derived components based on direct spread ultrafast qPCR

Abstract

The application belongs to the technical field of gene detection, and provides a POCT method for detecting food bovine-derived components based on direct spread ultrafast qPCR. The nucleic acid releasing agent contains Tris-HCl, KCl, BSA, L-cysteine hydrochloride, calcium disodium ethylenediaminetetraacetate, mPEG-2000, sodium cocoyl glutamate and maltitol. The nucleic acid releasing agent can release nucleic acid after being heated at 95 DEG C for 3 min, without purification, and the supernatant is directly amplified. The portable qPCR instrument is matched, and the amplification program is compressed, the whole detection is completed in less than 30 min, and the ten-step nucleic acid purification procedure is saved. The method of the application can remove the inhibitors such as hematin, oxidized oil and metal ions in meat products by optimizing the formula of the nucleic acid releasing agent and the qPCR premix, and the Taq enzyme and dNTP can still be efficiently amplified in a reduced amount; the minimum detection of beef components is 0.00001%, and the sensitivity is improved by 10 times compared with the traditional gold standard.

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and in particular to a method for detecting bovine-derived components in food using point-of-care testing (POCT) based on direct amplification ultrafast qPCR. Background Technology

[0002] In recent years, adulteration of beef and its products has become a significant food safety issue affecting public health. With the continuous rise in beef prices, the phenomenon of cheaper meats such as pork, lamb, and chicken being passed off as beef is commonplace in the market. Currently, the main methods for identifying beef and its products are proteomics and gene detection. Protein detection methods are simple and easy to perform, but the proteins in beef are easily denatured after deep processing and heat treatment, making them undetectable. Compared to proteins, DNA has higher thermal stability and species specificity, and can effectively detect species components in foods processed using various methods.

[0003] DNA-based PCR methods are increasingly used in species identification research and applications due to their speed and high accuracy. Traditional PCR methods rely on complex electrophoresis experiments, which significantly limits their application. Real-time quantitative PCR (qPCR) is a highly sensitive method for nucleic acid quantification; it features high sensitivity, strong specificity, and a high degree of automation, and is widely used in gene detection. However, qPCR requires expensive real-time quantitative PCR instruments and specialized technicians, and its application is mainly concentrated in well-equipped professional testing institutions, hindering widespread promotion and application.

[0004] Molecular point-of-care testing (POCT) technology is characterized by its portability, flexibility, speed, efficiency, and ease of operation, eliminating the reliance on complex equipment and specialized personnel required for traditional laboratory testing. Through miniaturization and automation, molecular POCT can achieve real-time detection in workshops, shopping malls, communities, or field settings, providing a new approach to addressing the challenge of implementing gene testing. Currently, qPCR-based POCT technology plays a crucial role in molecular diagnostics due to its high sensitivity and specificity. While it has seen some application in medical pathogen detection and genetic disease testing, its application in food safety testing lags behind, with no reports of its use in identifying the authenticity of beef and its products. Therefore, there is an urgent need in this field for a rapid qPCR-POCT detection technology that is compatible with beef and various processed beef products, combining high sensitivity and specificity, low cost, and portability. Summary of the Invention

[0005] The purpose of this invention is to provide a point-of-care testing (POCT) method for detecting bovine-derived components in food based on direct-amplification ultrafast qPCR. This method addresses the need for rapid on-site nucleic acid detection in beef products. Building upon research on the detection of beef using nucleic acid release agents and direct-fast qPCR, it further integrates portable qPCR to construct a qPCR molecular POCT detection technology for beef adulteration. This technological advancement enables rapid and portable detection of beef products. The POCT detection method established in this study will provide crucial technical support for beef producers and regulatory authorities, and is of great significance to the healthy development of the beef and related industries.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a nucleic acid release agent containing the following raw materials: Tris-HCl 15~25 mM, KCl 15~25 mM, BSA 0.1~0.2 mg / mL, L-cysteine ​​hydrochloride 0.5~1.5 mM, calcium disodium EDTA 1~2 mM, mPEG-2000 0.5~1.5 mg / mL, sodium cocoyl glutamate 1.5~2.5 mg / mL, and maltitol 6~10 mM.

[0007] The present invention also provides the application of the aforementioned nucleic acid releasing agent in nucleic acid extraction.

[0008] This invention also provides a method for nucleic acid extraction, comprising the following steps: Mix the sample with the nucleic acid release agent, heat at 92-98°C for 2-4 minutes, centrifuge, and collect the supernatant to obtain the DNA sample.

[0009] Preferably, the ratio of the sample to the nucleic acid releasing agent is 0.03~0.07g:220~280μL; the centrifugation speed is 3000~5000×g; and the centrifugation time is 20~40s.

[0010] The present invention also provides a primer-probe set for detecting bovine components in food, the primer-probe set comprising an upstream primer 1, a downstream primer 1, and a probe 1, wherein the nucleotide sequence of the upstream primer 1 is shown in SEQ ID NO:1, the nucleotide sequence of the downstream primer 1 is shown in SEQ ID NO:2, and the nucleotide sequence of the probe 1 is shown in SEQ ID NO:3.

[0011] This invention also provides a method for detecting bovine-derived components in food using point-of-care testing (POCT) based on direct amplification ultrafast qPCR, comprising the following steps: The DNA sample was amplified by PCR using the primer and probe set described above. When a specific amplification curve appeared in the amplification result, it indicated that the food contained bovine-derived components.

[0012] Preferably, the PCR amplification also uses an internal reference gene, which includes an upstream primer 2, a downstream primer 2, and a probe 2. The nucleotide sequence of the upstream primer 2 is shown in SEQ ID NO:4, the nucleotide sequence of the downstream primer 2 is shown in SEQ ID NO:5, and the nucleotide sequence of the probe 2 is shown in SEQ ID NO:6.

[0013] Preferably, the PCR amplification program is as follows: digestion at 35~39℃ for 1~3 min, pre-denaturation at 93~97℃ for 15~25 s, denaturation at 93~97℃ for 1~3 s, annealing at 55~65℃ for 15~25 s, 40~50 cycles. The PCR amplification reaction system consisted of 12.5–27.4 μL: 5–15 μL of qPCR premix, 0.2–0.6 μL of upstream primer 1, 0.2–0.6 μL of downstream primer 1, 0.2–0.6 μL of upstream primer 2, 0.2–0.6 μL of downstream primer 2, 0.1–0.3 μL of probe 1, 0.1–0.2 μL of probe 2, 4–6 μL of the DNA sample, and 2.5–3.5 μL of ddH2O.

[0014] Preferably, the qPCR premix contains the following ingredients: Tris 0.2-0.3 M, MgCl2 20-30 mM, dNTP 0.05-0.15 mM, Taq DNA polymerase 0.03-0.07 U / μL, polyγ-glutamic acid 1-2 mg / mL, ascorbate palmitate 0.6-1 mg / mL, trehalose-6-phosphate 10-14 mM, and trimethylamine oxide 3-7 mM.

[0015] This invention also provides the application of the aforementioned primer-probe set in the detection of bovine-derived components in food.

[0016] The beneficial effects of this invention are as follows: 1. Portable, fast testing, easy to operate, and short overall time. Traditional gold standard nucleic acid extraction uses magnetic beads and a large benchtop qPCR instrument (20-35 kg). Samples require multiple purification steps including lysis, binding, washing, and elution. Nucleic acid pretreatment takes approximately 72 minutes, and qPCR amplification takes approximately 45 minutes, for a total time of about 2 hours. This process is complex and relies on large benchtop instruments and a specialized laboratory environment. This invention uses a self-developed nucleic acid release agent, which releases nucleic acid with just 3 minutes of heating at 95°C, eliminating the need for purification; the supernatant is directly used. It is paired with a portable qPCR device weighing only 470 g, shortening the amplification process. The entire detection process, from sample processing to results, takes ≤30 minutes, eliminating nearly 10 nucleic acid purification steps. The device is portable and can be used on-site, overcoming the limitations of laboratory space.

[0017] 2. Self-developed compound reagents significantly reduce matrix inhibition and provide excellent detection sensitivity.

[0018] By optimizing the formulation of nucleic acid release agent and qPCR premix, and combining multiple functional adjuvants to synergistically remove endogenous inhibitors such as heme, oxidized fats, and metal ions in deep-processed meat products, this method can still achieve efficient amplification even with lower Taq enzyme and dNTP dosages than conventional formulations. It can stably detect beef-derived components at a content as low as 0.00001% in artificially mixed meat samples, while the traditional gold standard method used as a control has a detection limit of only 0.0001%. The detection sensitivity of this method is 10 times higher than that of the gold standard. Attached Figure Description

[0019] Figure 1 For the optimization results of rapid portable qPCR reaction conditions, (A) primer concentration, (B) probe concentration, (C) annealing temperature, (D) extension time; Figure 2 To demonstrate the specificity of molecular POCT detection, the blue curve represents the beef-specific amplification curve, and the red curve represents the internal reference gene amplification curve. Figure 3 To demonstrate the specificity of traditional qPCR detection, the blue amplification curve represents the beef-specific amplification curve, the blue straight line represents the detection curves for components from sheep, donkey, fish, shrimp, pig, goose, chicken, and duck, as well as the negative control, and the red amplification curve represents the internal reference gene amplification curve. Figure 4 To assess the sensitivity of molecular POCT detection, amplification curves of molecular POCT for artificially mixed samples with beef incorporation ratios ranging from 10% to 0.000001% are shown; blue curve: beef-specific amplification curve, red curve: internal reference gene amplification curve. Figure 5 The standard curve for molecular POCT detection is shown (x-axis represents the percentage of beef adulteration, y-axis represents the Ct value). Figure 6The sensitivity of traditional qPCR detection is shown in the amplification curves of traditional qPCR for 6 gradient samples (1 to 6 represent beef incorporation ratios from 10% to 0.0001% in descending order); blue curve: beef-specific amplification curve, red curve: internal reference gene amplification curve; Figure 7 The standard curve for traditional qPCR detection is shown (x-axis represents the percentage of beef adulteration, y-axis represents the Ct value). Detailed Implementation

[0020] This invention provides a nucleic acid release agent containing the following raw materials: Tris-HCl 15~25 mM, KCl 15~25 mM, BSA 0.1~0.2 mg / mL, L-cysteine ​​hydrochloride 0.5~1.5 mM, calcium disodium EDTA 1~2 mM, mPEG-2000 0.5~1.5 mg / mL, sodium cocoyl glutamate 1.5~2.5 mg / mL, and maltitol 6~10 mM.

[0021] In this invention, the nucleic acid releasing agent is further preferably composed of the following raw materials: Tris-HCl 20 mM, KCl 20 mM, BSA 0.15 mg / mL, L-cysteine ​​hydrochloride 1 mM, calcium disodium EDTA 1.5 mM, mPEG-2000 1 mg / mL, sodium cocoyl glutamate 2 mg / mL and maltitol 8 mM.

[0022] The present invention also provides the application of the aforementioned nucleic acid releasing agent in nucleic acid extraction.

[0023] This invention also provides a method for nucleic acid extraction, comprising the following steps: Mix the sample with the nucleic acid release agent, heat at 92-98°C for 2-4 minutes, centrifuge, and collect the supernatant to obtain the DNA sample.

[0024] In this invention, the preferred ratio of the sample to the nucleic acid releasing agent is 0.03~0.07g:220~280μL, more preferably 0.05g:250μL; the preferred centrifugation speed is 3000~5000×g, more preferably 4000×g; the preferred centrifugation time is 20~40s, more preferably 30s; the preferred heating temperature is 95℃, and the preferred heating time is 3min.

[0025] The present invention also provides a primer-probe set for detecting bovine components in food, the primer-probe set comprising an upstream primer 1, a downstream primer 1, and a probe 1, wherein the nucleotide sequence of the upstream primer 1 is shown in SEQ ID NO:1, the nucleotide sequence of the downstream primer 1 is shown in SEQ ID NO:2, and the nucleotide sequence of the probe 1 is shown in SEQ ID NO:3.

[0026] This invention also provides a method for detecting bovine-derived components in food using point-of-care testing (POCT) based on direct amplification ultrafast qPCR, comprising the following steps: The DNA sample was amplified by PCR using the primer and probe set described above. When a specific amplification curve appeared in the amplification result, it indicated that the food contained bovine-derived components.

[0027] In this invention, the PCR amplification also uses an internal reference gene, which includes an upstream primer 2, a downstream primer 2, and a probe 2. The nucleotide sequence of the upstream primer 2 is shown in SEQ ID NO:4, the nucleotide sequence of the downstream primer 2 is shown in SEQ ID NO:5, and the nucleotide sequence of the probe 2 is shown in SEQ ID NO:6.

[0028] In this invention, the preferred PCR amplification program is: digestion at 35-39°C for 1-3 min, pre-denaturation at 93-97°C for 15-25 s, denaturation at 93-97°C for 1-3 s, annealing at 55-65°C for 15-25 s, for 40-50 cycles; more preferably: digestion at 37°C for 2 min, pre-denaturation at 95°C for 20 s, denaturation at 95°C for 1 s, annealing at 60°C for 20 s, for 45 cycles; The preferred PCR amplification reaction system is 12.5–27.4 μL: 5–15 μL qPCR premix, 0.2–0.6 μL upstream primer 1, 0.2–0.6 μL downstream primer 1, 0.2–0.6 μL upstream primer 2, 0.2–0.6 μL downstream primer 2, 0.1–0.3 μL probe 1, 0.1–0.2 μL probe 2, 4–6 μL of the DNA sample, and 2.5–3.5 μL ddH2O; A further preferred concentration is 20 μL: 10 μL qPCR premix, 0.4 μL upstream primer 1, 0.4 μL downstream primer 1, 0.4 μL upstream primer 2, 0.4 μL downstream primer 2, 0.2 μL probe 1, 0.15 μL probe 2, 5 μL of the DNA sample, and 3.05 μL ddH2O.

[0029] In this invention, the qPCR premix preferably contains the following ingredients: Tris 0.2~0.3 M, MgCl2 20~30 mM, dNTP 0.05~0.15 mM, Taq DNA polymerase 0.03~0.07 U / μL, polyγ-glutamic acid 1~2 mg / mL, ascorbate palmitate 0.6~1 mg / mL, trehalose-6-phosphate 10~14 mM, and trimethylamine oxide 3~7 mM; Further preferred formulations contain the following ingredients: Tris 0.25 M, MgCl2 24 mM, dNTP 0.1 mM, Taq DNA polymerase 0.05 U / μL, polyγ-glutamic acid 1.5 mg / mL, ascorbate palmitate 0.8 mg / mL, trehalose-6-phosphate 12 mM, and trimethylamine oxide 5 mM.

[0030] This invention also provides the application of the aforementioned primer-probe set in the detection of bovine-derived components in food.

[0031] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0032] Example

[0033] 1. Materials and Methods

[0034] 1.1 Materials and Reagents

[0035] The magnetic bead-based DNA extraction kits for processed foods and animal tissues were purchased from Celes Biotech (Jilin) ​​Co., Ltd. (Changchun, China). Tris-HCl, MgCl2, KCl, EDTA, calcium disodium EDTA, L-cysteine ​​hydrochloride, betaine, and DMSO were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). dNTP mixture and Taq DNA polymerase were purchased from Baori Biotechnology (Beijing) Co., Ltd. (Beijing, China). Poly(γ-glutamic acid), trehalose-6-phosphate, trimethylamine oxide, ascorbate palmitate, mPEG-2000, sodium cocoyl glutamate, and maltitol were purchased from Shanghai Yuanye Biotechnology Co., Ltd. Triton X-100 and BSA were purchased from Sigma-Aldrich (USA). The qPCR master mix (QN213) was purchased from Nanjing Novizan Biotechnology Co., Ltd. (Nanjing, China). Fresh beef, mutton, donkey meat, fish, shrimp, pork, goose, chicken, duck, and 45 samples of processed beef products were all purchased from multiple supermarkets in Changchun, China.

[0036] 1.2. DNA extraction from meat

[0037] 1.2.1. DNA Extraction and Purification Using Magnetic Beads

[0038] DNA was extracted from different types of meat following the steps described in the kit instructions. The purity and concentration of the sample DNA were measured using a micro-volume spectrophotometer (NanoDrop™ One, Thermo Scientific™, USA) to ensure its OD value. 260 / 280 After the value is 1.9±0.1, the extracted DNA is stored at -80℃ for later use.

[0039] 1.2.2. Nucleic acid extraction using nucleic acid release agents

[0040] Nucleic acid release agent: Place 0.05 g of food sample into 250 μL of the four different nucleic acid release agents shown in Table 1, and vortex thoroughly to mix. Heat the mixture at 95 °C for 3 min, and immediately centrifuge at 4000 × g for 30 seconds. Take 5 μL of the supernatant as the amplification template.

[0041] Table 1. Formulations of nucleic acid releasing agents used in some comparative examples

[0042] 1.3. Primer and probe design

[0043] Download cattle and other non-target species from the GenBank® (NCBI / NIH, Bethesda, MD, USA) database: buffalo (MT182644.1), yak (KR676431.1), domestic cattle (GU249573.1), sheep (MN882069.1), donkey (OL660219.1), fish (OM928846.1), shrimp (HQ401318.1), pig (AB015083.1), goose (EU863202.1), chicken (KM224422.1), and duck (KJ833587.1). cytb Genes were sequenced and sequence alignment was performed using Vector NTI Advance 11.0 software (Invitrogen, Carlsbad, CA) to select conserved regions of bovine gene sequences (SEQ ID NO: 7) for primer and probe design. Furthermore, Primeselet software (DNASTAR, Madison, WI, USA) was used to evaluate primer annealing temperature, primer dimers, and hairpin structures, and the Blast tool (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) was used to verify the species specificity of primers and probes. Additionally, primers designed for eukaryotes in previous studies were used. 18S rDNAThe primers and probes (18S-F / R / P) designed based on (SEQ ID NO:8) served as internal reference genes in this experiment. Therefore, both primers and probes were synthesized by Sangon Biotech Co., Ltd., and the primer and probe sequences are shown in Table 2.

[0044] Table 2 Primer and probe sequence information

[0045] The nucleotide sequence of the conserved region of the bovine gene sequence (SEQ ID NO:7) is as follows: ggctccaacaatccaacaggaatttcctcagacgtagacaaaatcccattccacccctactataccattaaggacatcttaggggccctcttactaattctagctctaatactactagtactattcgcacccgacctcctcggagaccccagataactacaccccagccaatccactcaacacaccccctcacatcaaacc; eukaryotes 18S rDNA The nucleotide sequence of (SEQ ID NO:8) is as follows: cttaaaggaattgacggaagggcaccaccaggagtggagcctgcggcttaatttgactcaacacgggaaacctcacccggcccggacacggacaggattgacagattgatagctctttctcgattccgtgggtggtggtgcatggccgttcttagttggtggagcgatttgtctgg.

[0046] 1.4. Establishment and optimization of molecular POCT system

[0047] 1.4.1. Screening and optimization of qPCR premix formulation

[0048] With the primer final concentration fixed at 0.5 μmol / L, probe final concentrations at 0.2 μmol / L (Beef-P and 18S-P), and amplification program (37℃ contamination digestion for 2 min; 95℃ pre-denaturation for 20 s; 95℃ denaturation for 1 s; 60℃ annealing for 20 s, 45 cycles) all reaction conditions unchanged, three gradients of bovine DNA templates (1 ng / μL, 100 pg / μL, and 10 pg / μL) were used. Amplification systems were prepared using four different qPCR premix formulations from Comparative Examples 1 to 4 in Table 3. Each test was repeated three times.

[0049] Table 3. Formulations of qPCR premixes used in some comparative examples

[0050] 1.4.2. Optimization of rapid and portable qPCR

[0051] POCT detection of beef was performed using a FORQUANT Smart 2 portable qPCR instrument (Fanjing, Chengdu, China). DNA was extracted according to the extraction method in 1.2.1, and 5 μL of DNA was used as template. To optimize the qPCR reaction program, while keeping other conditions constant, primer concentrations (0.2 μmol / L, 0.4 μmol / L, 0.6 μmol / L, and 0.8 μmol / L), probe concentrations (0.10 μmol / L, 0.15 μmol / L, 0.20 μmol / L, and 0.25 μmol / L), annealing temperatures (56℃, 58℃, 60℃, and 62℃), and amplification times (10 s, 20 s, 30 s, and 40 s) were optimized using 1 ng / μL, 100 pg / μL, and 10 pg / μL bovine DNA as templates. Throughout the optimization process, the concentrations of 18S-F / R and 18S-P were kept constant at 0.4 μmol / L and 0.15 μmol / L, respectively. Each test was repeated three times.

[0052] 1.4.3. Establishment of the Molecular POCT System

[0053] The molecular POCT detection method in this study was performed as follows: After separating the DNA sample using the preferred rapid nucleic acid release agent of Comparative Example 4 (1.2.2), 5 μL of serially diluted DNA (1 ng / μL, 100 pg / μL, and 10 pg / μL) was used as the template for direct rapid qPCR. Based on the optimized premix of Comparative Example 4 (1.4.1) and the optimized primers, probes, temperature, and amplification time parameters (1.4.2), a 20 μL reaction system was prepared: 10 μL of optimal qPCR premix, 0.4 μL of each primer (Beef-F / R, 18S-F / R, storage concentration 10 μmol / L), 0.2 μL and 0.15 μL of Beef-P and 18S-P probes (storage concentration 10 μmol / L), 5 μL of DNA template, and 3.05 μL of ddH2O. The amplification program was set as follows: 37℃ contamination digestion for 2 min, 95℃ pre-denaturation for 20 s, 95℃ denaturation for 1 s, 60℃ annealing for 20 s, 45 cycles.

[0054] 1.5. Establishment of traditional qPCR (gold standard)

[0055] Nucleic acid extraction was performed using the magnetic bead method described in section 1.2.1, and amplification was performed using a Gentier 96E qPCR instrument (Tianlong, Shanxi, China), which served as the gold standard for this study. The traditional qPCR conditions were set as follows: 10 μL qPCR master mix, 0.4 μL each primer (Beef-F / R, ...). 18S 0.2 μL of Beef-P probe and 0.15 μL of 18S-P probe (stored concentration 10 μmol / L) were added, along with 5 μL of DNA template and 3.05 μL of ddH2O. The amplification program was set as follows: 37°C contamination digestion for 2 minutes, 95°C pre-denaturation for 30 seconds, 95°C denaturation for 10 seconds, 60°C annealing for 30 seconds, for 45 cycles.

[0056] 1.6. Detection Specificity of POCT

[0057] DNA was extracted from nine different meat samples (beef, mutton, donkey meat, pork, goose, chicken, duck, fish, and shrimp) using a nucleic acid release agent, and amplified under optimized conditions to verify the specificity of the established POCT detection method. During the detection process, eukaryotic organisms were used... 18S rDNA ddH2O was used as an internal reference gene and as a negative control. To further evaluate the detection specificity of the molecular POCT method, the gold standard method described in Section 1.5 was simultaneously used to detect the above nine meat samples. Each test was repeated three times.

[0058] 1.7. Detection Sensitivity of POCT

[0059] Nucleic acid release agents were used to release nucleic acids from artificially mixed meat samples (beef, pork, chicken, duck, and lamb) containing different proportions of beef (10%, 1%, 0.1%, 0.01%, 0.001%, 0.0001%, 0.00001%, and 0.000001%), and amplification was performed using the optimized conditions described in Section 1.4 to evaluate the sensitivity of the detection method. Simultaneously, to further evaluate the detection sensitivity of the established POCT method, sensitivity testing was performed using the gold standard method described in Section 1.5. During the sensitivity testing process, eukaryotic... 18S rDNA ddH2O was used as an internal reference gene and as a negative control. Each test was repeated three times.

[0060] 1.8. Real Sample Detection

[0061] To evaluate the detection performance of the established molecular point-of-care testing (POCT) method in complex real-world samples, this study conducted a blind test on 45 commercially available food samples. Nucleic acid samples were prepared from 45 processed foods using a nucleic acid release reagent, and these DNA samples were subsequently amplified using an optimized direct rapid quantitative PCR procedure. To ensure detection accuracy, these food samples were also validated using conventional quantitative PCR (1.5) as the gold standard method.

[0062] 1.9. Statistical Analysis

[0063] Optimization experiments for primer concentration, probe concentration, annealing temperature, and extension time were performed in triplicate. Data are expressed as mean ± standard deviation (Mean ± SD). One-way ANOVA was used for statistical analysis, and Tukey's test was used for multiple comparisons between groups. Different lowercase letters indicate statistically significant differences. p <0.05)

[0064] 2. Results and Discussion

[0065] 2.1. Optimization of Nucleic Acid Release Agent Formulation

[0066] Four groups of gradient release agents were used to treat beef tissue samples, and the qPCR Ct value was used as the evaluation index. The results are shown in Table 4. Comparative Example 1 used the traditional lysis buffer method to extract nucleic acid, with an average Ct value of 26.59±0.22. Comparative Example 2 added L-cysteine ​​hydrochloride, calcium disodium EDTA, and maltitol, which alleviated the interference of collagen and metal ions, and the Ct value was slightly improved to 25.74±0.21. Comparative Example 3 introduced mPEG-2000 to further remove lipid and heme inhibition, and the index was further optimized. Comparative Example 4 (the formula of this invention) combined all functional adjuvants and supplemented the sodium cocoyl glutamate emulsifying component, and the Ct value was reduced to 23.42±0.30. The results confirmed that the multi-component combination has a synergistic effect, and the release agent of this invention can effectively reduce the interference of endogenous substances in deep-processed beef on nucleic acid extraction and subsequent amplification.

[0067] Table 4. Extraction and amplification results of nucleic acid release agents with different formulations

[0068] 2.2. Optimization of qPCR premix formulation

[0069] DNA templates at concentrations of 1 ng, 100 pg, and 10 pg were used, and amplification was performed using four different qPCR premix solutions. The mean Ct value, coefficient of variation (CV), amplification efficiency, and linear correlation coefficient (Rt) were used for each group. 2The performance of the premixed solutions was evaluated, and the results are shown in Table 5. The repeatability CV for all concentration gradients in each group was <1%, indicating good reproducibility of the amplification with the four premixed solutions; R0 was <1% for all systems. 2 All values ​​were >0.9917, with amplification efficiency ranging from 92.71% to 97.24% (90% to 110% acceptable range). The quantitative linearity was excellent, meeting the requirements for fluorescence qPCR detection. With the gradual addition of the self-developed enhancement components to the premix, the Ct values ​​decreased sequentially at the same template concentration: Comparative Example 1 (blank premix) showed the highest overall Ct value; Comparative Example 2 showed slight improvement in amplification after adding conventional enhancers such as DMSO and betaine; Comparative Example 3, with the addition of some novel adjuvants, further shifted the Ct value forward; Comparative Example 4, representing the optimized premix formulation of this invention, showed the lowest Ct value across the entire template gradient. The results confirm that the compound enhancement system of this invention can effectively antagonize endogenous inhibitors remaining in processed foods, significantly improving qPCR amplification sensitivity.

[0070] Table 5. Amplification results of different qPCR premix formulations

[0071] 2.3. Development and Optimization of Molecular POCT

[0072] To establish an efficient and rapid qPCR detection system, this study used DNA templates at concentrations of 1 ng / μL, 100 pg / μL, and 10 pg / μL, and conducted systematic gradient optimization experiments on annealing temperature, primer concentration, and probe concentration. The results showed that the amplification efficiency was optimal when the primer and probe concentrations were 0.4 μmol / L and 0.2 μmol / L, respectively; the Ct value of the detection system at an annealing temperature of 60℃ was significantly lower than that at other temperature gradients; furthermore, the Ct value was also significantly reduced when the extension time was set to 20 seconds. Figure 1 (A~D).

[0073] 2.4. Specificity of Molecular POCT Analysis

[0074] To verify the specificity of the established molecular point-of-care testing (POCT) method for beef-derived foods, this study selected various animal tissue samples, including beef, mutton, donkey meat, fish, shrimp, pork, goose, chicken, and duck, and employed a method containing eukaryotic organisms. 18S rDNA The molecular POCT system was used as an internal control for detection. Test results showed that only beef samples exhibited specific amplification curves; no amplification signals were detected in other animal samples and the blank control. Figure 2 This indicates that the molecular POCT detection method developed in this study has no cross-reactivity with other animal-derived components and exhibits excellent specificity. Furthermore, this result is consistent with the detection results of DNA extraction using magnetic beads combined with conventional qPCR. Figure 3This further confirms the high specificity of this molecular POCT method.

[0075] 2.5. Sensitivity of Molecular POCT Analysis

[0076] To evaluate the sensitivity of the molecular POCT method developed in this study, we tested meat samples containing different proportions of beef. The results showed that this method can reliably detect beef components as low as 0.00001% in mixed meat samples. Figure 4 (Table 6) demonstrates extremely high detection sensitivity. Within the test range, beef content and Ct value showed a significant negative correlation with good linearity. The standard curve equation is y = -2.8543x + 19.866, R² = 0.988 ( Figure 5 ).

[0077] In contrast, the gold standard method based on magnetic bead nucleic acid extraction combined with traditional qPCR also showed a detection limit as low as 0.0001% for mixed meat samples of beef. Figure 6 Its standard curve equation is y = –3.1254x + 36.521, R² = 0.987. Figure 7 ).

[0078] Previously, based on mitochondrial NADH dehydrogenase subunit 5 ( ND5 Researchers have developed a beef-specific qPCR detection method with a detection limit of 0.01% for the beef gene. Another research team has developed a multiplex qPCR technique with a sensitivity of 0.5% for analyzing beef components in mixed samples. In this study, the molecular POCT detection method achieved a sensitivity of 0.00001% for analyzing beef content in meat mixtures, significantly higher than previously reported beef qPCR detection methods. Furthermore, the molecular POCT detection method developed in this study does not require complex DNA extraction and purification steps, and the portable qPCR detection is simple and rapid, laying the foundation for converting beef-specific gene detection into a POCT mode.

[0079] Table 6 Comparison of Ct values ​​for the detection sensitivity of molecular POCT and traditional qPCR

[0080] 2.6. Analysis of Real Samples

[0081] Forty-five real samples were analyzed using the established molecular point-of-care testing (POCT) technique. Parallel validation of the same batch of samples was performed using the conventional qPCR method described in Section 1.5, aiming to systematically evaluate the performance of molecular POCT in beef component detection. Results showed that 10 samples pre-confirmed to contain the target component all showed positive signals via molecular POCT, while samples without the target component tested negative, preliminarily validating the effectiveness of the technique. Furthermore, the results of conventional qPCR were completely consistent with those of the molecular POCT technique, further confirming the accuracy of the molecular POCT method developed in this study. Compared with the gold standard method, the Ct values ​​obtained by the molecular POCT technique showed a slight overall decreasing trend, with the decrease remaining within the range of 0.95–2.43 (Table 7).

[0082] Table 7. Ct values ​​of food samples detected by molecular POCT and gold standard methods

[0083] Traditional species-specific qPCR detection techniques have always relied on bulky qPCR instruments (weighing approximately 20–35 kg). This study utilizes a portable qPCR instrument for rapid bovine-derived detection. This device weighs only 470 g and measures 21.5 cm × 7.8 cm × 17.3 cm, significantly improving the convenience of on-site application. Addressing the needs of molecular point-of-care testing (POCT), this method integrates nucleic acid release agents with rapid, portable qPCR technology, enabling on-site identification of beef components in food samples within 30 minutes. As a novel detection technology, it can be widely applied in grassroots testing sites, food company self-inspection, and market screening, providing an effective molecular point-of-care detection solution for the rapid identification of beef components in processed foods.

[0084] in conclusion

[0085] This study developed a rapid on-site detection technique for beef components based on nucleic acid release agents, direct rapid qPCR technology, and a portable qPCR instrument. This technique is highly portable, completing sample testing within 30 minutes, with a detection limit as low as 0.00001% for beef components in artificially prepared meat samples, exhibiting high specificity. The actual sample detection rate is consistent with traditional qPCR results, making it suitable for rapid on-site identification of beef components. This technology provides a reliable technical solution for rapid on-site nucleic acid identification of beef components in food.

[0086] As shown in the above embodiments, this invention provides a method for POCT detection of bovine-derived components in food based on direct amplification ultrafast qPCR. The nucleic acid release agent of this invention contains: Tris-HCl, KCl, BSA, L-cysteine ​​hydrochloride, calcium disodium EDTA, mPEG-2000, sodium cocoyl glutamate, and maltitol. This nucleic acid release agent releases nucleic acids upon heating at 95°C for 3 minutes, eliminating the need for purification. The supernatant is directly amplified. Combined with a portable qPCR instrument and a compressed amplification program, the entire detection process takes ≤30 minutes, eliminating ten nucleic acid purification steps. This method, through optimized formulation of the nucleic acid release agent and qPCR premix, can remove inhibitors such as heme, oxidized fats, and metal ions from meat products. Even with reduced Taq enzyme and dNTP levels, amplification remains highly efficient. The detection limit for beef components is as low as 0.00001%, representing a 10-fold increase in sensitivity compared to the traditional gold standard.

[0087] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A nucleic acid releasing agent, characterized in that, It contains the following ingredients: Tris-HCl 15~25 mM, KCl 15~25 mM, BSA 0.1~0.2 mg / mL, L-cysteine ​​hydrochloride 0.5~1.5 mM, calcium disodium EDTA 1~2 mM, mPEG-2000 0.5~1.5 mg / mL, sodium cocoyl glutamate 1.5~2.5 mg / mL and maltitol 6~10 mM.

2. The application of the nucleic acid releasing agent according to claim 1 in nucleic acid extraction.

3. A method for nucleic acid extraction, characterized in that, Includes the following steps: Mix the sample with the nucleic acid releasing agent described in claim 1, heat at 92-98°C for 2-4 minutes, centrifuge, and collect the supernatant to obtain the DNA sample.

4. The method according to claim 3, characterized in that, The ratio of the sample to the nucleic acid releasing agent of claim 1 is 0.03~0.07g: 220~280μL; the centrifugation speed is 3000~5000×g, and the centrifugation time is 20~40s.

5. A primer and probe set for detecting bovine-derived components in food, characterized in that, The primer-probe set includes upstream primer 1, downstream primer 1, and probe 1. The nucleotide sequence of the upstream primer 1 is shown in SEQ ID NO:1, the nucleotide sequence of the downstream primer 1 is shown in SEQ ID NO:2, and the nucleotide sequence of probe 1 is shown in SEQ ID NO:

3.

6. A method for detecting bovine-derived components in food using point-of-care testing (POCT) based on direct amplification ultrafast qPCR, characterized in that, Includes the following steps: When the DNA sample described in claim 3 is subjected to PCR amplification using the primer and probe set described in claim 4, and a specific amplification curve appears in the amplification result, it indicates that the food contains bovine-derived components.

7. The method according to claim 6, characterized in that, The PCR amplification also used an internal reference gene, which includes upstream primer 2, downstream primer 2 and probe 2. The nucleotide sequence of the upstream primer 2 is shown in SEQ ID NO:4, the nucleotide sequence of the downstream primer 2 is shown in SEQ ID NO:5, and the nucleotide sequence of the probe 2 is shown in SEQ ID NO:

6.

8. The method according to claim 7, characterized in that, The PCR amplification program is as follows: digestion at 35-39℃ for 1-3 min, pre-denaturation at 93-97℃ for 15-25 s, denaturation at 93-97℃ for 1-3 s, annealing at 55-65℃ for 15-25 s, for 40-50 cycles. The PCR amplification reaction system consists of 12.5–27.4 μL: 5–15 μL of qPCR premix, 0.2–0.6 μL of upstream primer 1, 0.2–0.6 μL of downstream primer 1, 0.2–0.6 μL of upstream primer 2, 0.2–0.6 μL of downstream primer 2, 0.1–0.3 μL of probe 1, 0.1–0.2 μL of probe 2, 4–6 μL of the DNA sample as described in claim 3, and 2.5–3.5 μL of ddH2O.

9. The method according to claim 8, characterized in that, The qPCR premix contains the following ingredients: Tris 0.2-0.3 M, MgCl2 20-30 mM, dNTP 0.05-0.15 mM, Taq DNA polymerase 0.03-0.07 U / μL, polyγ-glutamic acid 1-2 mg / mL, ascorbate palmitate 0.6-1 mg / mL, trehalose-6-phosphate 10-14 mM, and trimethylamine oxide 3-7 mM.

10. The application of the primer-probe set according to claim 5 in the detection of bovine-derived components in food.

Images