A hairpin DNA probe targeting H19 transcript and application thereof

Abstract

The application relates to a hairpin DNA probe targeting an H19 transcript and an application thereof. The hairpin DNA probe comprises, in sequence from 5' to 3', a first stem region, a loop region and a second stem region; the first stem region and the second stem region form a stem structure through base complementary pairing; and the loop region and the second stem region can target a nucleotide region at positions 1582-1612 of the H19 transcript. The hairpin DNA probe can target a local window with structural and accessible properties in the middle domain of H19, has low background when not combined, can be triggered to open when the target H19 exists, and is suitable for specific recognition in a complex cell environment. The hairpin DNA probe involved in the application can be used for imaging detection of H19 itself, and can also be used for H19 enrichment and related protein binding state analysis.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a hairpin DNA probe that targets H19 transcripts and its applications. Background Technology

[0002] H19 is an important long non-coding RNA (lncRNA) associated with tumor development, drug response, and cellular senescence. Existing methods for detecting or enriching lncRNAs mostly employ linear oligonucleotide probes or combinations of multiple probes. Although these methods can achieve a certain degree of hybridization recognition, they often suffer from problems such as high background noise, poor structural accessibility, numerous non-specific bindings, and difficulty in simultaneously achieving imaging and subsequent binding status analysis in complex cellular environments.

[0003] CN106086201A discloses a detection method for serum long non-coding RNA H19, which uses primers to perform real-time quantitative PCR detection of H19.

[0004] For transcripts like H19, which are structurally complex and contain many locally high-GC regions, designing probes solely based on the principle of linear complementarity often encounters the following problems: First, the target site is deeply embedded in a stable double-stranded or dense nucleus structure, making it difficult for the probe to penetrate and open within the cell; second, the target site is too loose or has low complexity, resulting in insufficient hairpin closure background; third, although the probe can recognize RNA, it is not conducive to subsequent analysis of the binding status of related proteins, affecting pull-down and protein detection.

[0005] Therefore, there is an urgent need for a hairpin DNA probe that can maintain low background closure in the unbound state, be effectively triggered to open by target H19 in physiological temperature and real cellular environment, and be used for H19 enrichment and analysis of the binding status of related proteins. This has become one of the technical problems that urgently need to be solved. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide a hairpin DNA probe targeting the H19 transcript and its applications. The hairpin DNA probe of this invention has a low background when not bound to H19, and can be triggered to open in the presence of target H19, enabling specific recognition of H19 in complex cellular environments.

[0007] To achieve this objective, the present invention adopts the following technical solution: In a first aspect, the present invention provides a hairpin DNA probe that targets H19 transcripts, wherein the hairpin DNA probe comprises a first stem region, a loop region, and a second stem region sequentially from 5′ to 3′. The first stem region and the second stem region form a stem structure through complementary base pairing. The loop region and the second stem region can target the nucleotide region at positions 1582-1612 of the H19 transcript.

[0008] Based on the full-length H19 transcript sequence, the central / minimum free energy secondary structure diagram, the base pairing probability diagram, the positional entropy diagram, and the mountain-shaped diagram, this invention screened candidate sites for the central domain of H19 and, through experimental verification, determined that the nucleotide region from position 1582 to 1612 of the H19 transcript was the preferred recognition window.

[0009] Specifically, when screening candidate sites, the following exemplary indicators are preferred for comprehensive evaluation: (1) The GC content of the candidate segment is preferably about 45%-70%, more preferably about 50%-65%; the continuous GC string should not be too long, preferably not exceeding 4-6 nt. (2) In the center / minimum free energy secondary structure diagram, priority should be given to candidate segments located in relatively exposed areas such as macrocycles, inner loops, junctions and stem edges, and the central part of long continuous stable stems should be avoided. (3) In the base pairing probability diagram, if the pairing probability of multiple consecutive bases in the candidate segment is close to a high value (greater than 0.8), it indicates that the region is closer to a rigid stable stem, and it is preferred that the pairing probability of most bases is between about 0.3-0.8. (4) In the position entropy diagram, low entropy regions usually indicate a more fixed conformation, and high entropy regions usually indicate high disorder, and it is preferred that segments with a certain conformational variability (a medium position entropy range of about 0.8-1.8) are selected. (5) In the mountain topography, avoid high plateau stable stem segments and long-distance flat and loose areas, and prefer sites located in areas of local slope change, shoulders or local turning points. (6) Combine RBP site information, prefer candidate segments located near functional RNA structural units.

[0010] Based on the above site selection principles, this invention screened three regions of the H19 transcript (such as...). Figure 1 As shown in the figure, a comprehensive comparison of the three candidate sites at the structural and sequence levels was conducted, and the nucleotide region from position 1582 to 1612 of the H19 transcript was finally determined as the preferred recognition window.

[0011] The optimality of this site is mainly reflected in the following aspects: First, the site is located in a local structural transition region within the main structural domain of H19, rather than being deeply embedded in the dense structural nucleus of a continuous long stem; Second, the site exhibits the characteristics of "having certain structural constraints but still being identifiable" in terms of pairing probability, positional entropy, and local structural conformation, which is more conducive to maintaining hairpin closure when there is no target and opening when there is a target; Third, the site is adjacent to the PRPF8 structural motif and binding signals such as AKAP1, WRN, and EFTUD2, suggesting that it is located near a functional RNA structural unit; Fourth, combined with the experimental verification results of hairpin DNA probes, this site is more suitable as an identification window for H19 detection and analysis of the binding status of related proteins.

[0012] Meanwhile, the structural schematic diagram of the hairpin DNA probe involved in this invention is shown below. Figure 2 As shown, the first and second stem regions form a stem structure through base complementarity pairing, and the loop region forms a loop structure. When not bound to H19, the probe presents a closed hairpin structure. At the same time, the loop region and the second stem region of the probe can target the nucleotide region of nucleotides 1582-1612 of the H19 transcript. After specific hybridization with the H19 region, the stem structure triggers dissociation and opens the hairpin structure.

[0013] Preferably, the RNA sequence of nucleotides 1582-1612 of the H19 transcript is shown in SEQ ID NO:1.

[0014] Preferably, the loop region and the second stem region contain the sequence shown in SEQ ID NO:2 for targeting the nucleotide region at positions 1582-1612 of the H19 transcript.

[0015] Preferably, the length of the first stem region and the second stem region of the hairpin DNA probe are each independently 5-8 nucleotides.

[0016] Preferably, the loop region of the hairpin DNA probe is 18-30 nucleotides in length.

[0017] Preferably, the nucleic acid sequence of the hairpin DNA probe is shown in SEQ ID NO:3.

[0018] The specific sequence of SEQ ID NO:1 above is: UACCCAGCUCAAGCCUGGGCCUUUGAAUCCG.

[0019] The specific sequence of SEQ ID NO:2 above is: CGGATTCAAAGGCCCAGGCTTGAGCTGGGTA.

[0020] The specific sequence of SEQ ID NO:3 above is: TACCCAGCCGGATTCAAAGGCCCAGGCT TGAGCTGGGTA.

[0021] Preferably, the hairpin DNA probe is further connected to a detectable marker and / or a capture group.

[0022] Preferably, the detection label includes a fluorescent group and a quenching group located at both ends of the hairpin DNA probe.

[0023] Preferably, the fluorescent group and the quenching group are each independently linked to both ends of the hairpin DNA probe via adenine or thymine.

[0024] Preferably, the nucleic acid sequence of the hairpin DNA probe is as shown in SEQ ID NO:4, specifically: ATACCCAGCCGGATTCAAAGGCCCAGGCTTGAGCTGGGTAT; Preferably, the hairpin DNA probe having the sequence shown in SEQ ID NO:4 is modified with a fluorescent group and a quenching group at both ends.

[0025] Preferably, the capturing group includes any one of biotin, amino, mercapto, azide, or alkynyl.

[0026] Preferably, the biotin is linked to the 5' or 3' end of the hairpin DNA probe via 3-6 thymines.

[0027] Preferably, the nucleic acid sequence of the hairpin DNA probe is as shown in SEQ ID NO:5, specifically: ATACCCAGCCGGATTCAAAGGCCCAGGCTTGAGCTGGGTATTTTT.

[0028] Preferably, the 3' end of the hairpin DNA probe having the sequence shown in SEQ ID NO:5 is modified with a capture group.

[0029] In a second aspect, the present invention provides a solidified probe composition for targeting H19, the solidified probe composition comprising the hairpin DNA probe described in the first aspect, and nanoneedles, chips, glass slides, magnetic beads, microspheres or nanoparticles on which the hairpin DNA probe is immobilized.

[0030] Thirdly, the present invention provides a method for detecting H19 in a sample, the method comprising: contacting the hairpin DNA probe described in the first aspect with the sample to be tested, and performing qualitative and / or quantitative analysis of H19 by detecting fluorescence signals and / or microscopic imaging.

[0031] Preferably, the sample includes live cells, fixed cells, tissue sections, cell lysates, in-situ recovered samples, or cell samples treated with TMZ.

[0032] Fourthly, the present invention provides a method for enriching H19-related samples, the method comprising: The hairpin DNA probe with a capture group described in the first aspect is contacted with a sample containing H19 to form a probe-H19 complex, which is then recovered to obtain a sample enriched with H19.

[0033] Fifthly, the present invention provides the use of the hairpin DNA probe of the first aspect or the immobilized probe composition for targeting H19 of the second aspect in the preparation of kits for H19 detection, H19 enrichment or H19-related binding state analysis.

[0034] Preferably, the kit for H19 detection includes an H19 fluorescence in situ hybridization detection kit, an H19 live cell imaging detection kit, and an H19 nanoneedle in situ detection kit.

[0035] Preferably, the kit for H19 enrichment includes an H19 pull-down kit.

[0036] Preferably, the kit for H19-related binding state analysis includes a kit for H19-related IGF2BP1 binding state analysis.

[0037] Compared with the prior art, the present invention has the following beneficial effects: The hairpin DNA probe of this invention can target a structurally important and accessible local window in the central domain of H19, making it more suitable for specific recognition in complex cellular environments. This hairpin structure has low background when unbound and can be triggered to open in the presence of target H19. The hairpin DNA probe of this invention can be used for imaging detection of H19 itself, as well as for H19 enrichment and related protein binding status analysis. This probe showed enhanced H19 signal in both TMZ stimulation and aging models, and detected IGF2BP1-related signals in pull-down / Western blot of aging samples. Attached Figure Description

[0038] Figure 1 This is a schematic diagram showing the location of the three candidate sites in the H19 transcript.

[0039] Figure 2 This is a schematic diagram of the closed-loop state of the hairpin DNA probe when it is not bound to H19.

[0040] Figure 3 This is a diagram demonstrating the open-loop and closed-loop capability of probes designed for three target regions.

[0041] Figure 4 This is a graph showing the ability of the hairpin DNA probe to target H19 within cells.

[0042] Figure 5 This is a graph showing the changes in intracellular H19 expression levels in LN229 cells after TMZ stimulation.

[0043] Figure 6 This is a FISH comparison of intracellular H19 expression levels in LN229 cells after TMZ stimulation and senescence-induced changes.

[0044] Figure 7 This is a qPCR comparison of intracellular H19 expression levels in LN229 cells after TMZ stimulation and senescence induction.

[0045] Figure 8 This is a comparison chart of IGF2BP1 expression in different experimental groups in Example 5. Detailed Implementation

[0046] To further illustrate the technical means and effects of the present invention, the following describes the technical solution of the present invention in conjunction with preferred embodiments of the present invention. However, the present invention is not limited to the scope of the embodiments.

[0047] Example 1 Comprehensive screening of candidate sites and probe design.

[0048] (1) Candidate site confirmation: This invention first analyzes the full-length H19 sequence and its predicted center / minimum free energy of RNAfolds. The results show that the 1000-1800 nt region of H19 is located in the main folding domain of the transcript, preserving a clear structural hierarchy while relatively avoiding the adverse effects of the 5′ extreme G-rich region and the 3′ extreme U-rich region on probe design. Further analysis using a mountain-shaped diagram, base pairing probability map, and positional entropy map reveals that this region is not loosely structured but rather belongs to a region within a continuous folding domain interspersed with locally rearrangeable windows. This makes it suitable for screening structurally responsive probes that maintain a low hairpin closure background while being triggered to open within the cell by the target.

[0049] For this central structural domain, the initial screening criteria were based on GC content of approximately 45%-70%, continuous GC strings not exceeding 4-6 nt, a majority base pairing probability of approximately 0.3-0.8 within the window, a positional entropy of approximately 0.8-1.8, and local configuration located at macrocycle / inner loop / connection point / stem edge. At the same time, the relative positions of local slope change areas, shoulders, or local turning areas in the mountain-shaped map were considered, and the proximity information of RBP sites was combined for comprehensive judgment.

[0050] Around this region, this invention selected three candidate sites and conducted a comprehensive comparison at both the structural and sequence levels. The comprehensive comparison showed that: Site 1 (positions 1582-1612) is located at a local structural transition window, closer to the branch / inner loop-stem junction, and adjacent to or partially overlapping with the PRPF8 structural motif and binding signals of AKAP1, WRN, and EFTUD2, suggesting that this site is located near a functional RNA structural unit; Site 2 (positions 1465-1490) is located in a high-GC dense region, overlapping multiple RBP binding sites, with a more rigid local structure, which is not conducive to intracellular opening; Site 3 (positions 1027-1050) is located at the edge of a stable stem region, and although it has some local exposure, it is still largely structurally skeletal. Details are shown in Table 1.

[0051] Table 1 Note: The specific sequence of SEQ ID NO:1 in Table 1 is: UACCCAGCUCAAGCCUGGGCCUUUGAAUCCG; the specific sequence of SEQ ID NO:6 is: CUUAGGCUGGUGGGGCUGCGGCAAGA; the specific sequence of SEQ ID NO:7 is: UGCGGAGAGGGCCCACAGUGGACU.

[0052] In Table 1, “GC repeatability,” “local configuration,” “pairing probability,” “position entropy,” and “mountain shape” are qualitative or semi-quantitative interpretations based on the full-length transcript sequence, RNAfold prediction of the center / minimum free energy structure diagram, base pairing probability diagram, position entropy diagram, and mountain shape diagram.

[0053] (2) Candidate site verification: (2.1) Hairpin DNA probes were designed for the three target regions numbered 1, 2 and 3 above, and the hairpin DNA probes with sequences as shown in SEQ ID NO:4, SEQ ID NO:8 and SEQ ID NO:9 were obtained in sequence.

[0054] The specific sequence of SEQ ID NO:4 is: ATACCCAGCCGGATTCAAAGGCCCAGGCTTGAGCTGGGTAT.

[0055] The specific sequence of SEQ ID NO:8 is: ACTTAGGTCTTGCCGCAGCCCCACCAGCCTAAGT; The specific sequence of SEQ ID NO:9 is: ATGCGGAGAAGTCCACTGTGGGCCCTCTCCGCAT; The probe is modified with AF488 (green fluorescence) and BHQ1 (fluorescence quencher) at the 5' and 3' ends, respectively, or with AF647 (red fluorescence) and BHQ2 (fluorescence quencher) at the 5' and 3' ends, respectively, for subsequent imaging verification.

[0056] (2.2) Trial grouping and intervention method: Closed-loop group: The above probe with a concentration of 10 μM was treated at 95℃ for 5 min and then slowly cooled to 45℃, then modified into nanoneedles and subjected to microscopic imaging. Open-ring group: The above probe at a concentration of 10 μM was treated at 95℃ for 5 min and then placed directly on ice, then modified into nanoneedles and subjected to microscopic imaging.

[0057] The fluorescence intensity of the open-ring and closed-ring nanoneedles of the above probe was statistically analyzed using ImageJ. The results are as follows: Figure 3 As shown, the probe corresponding to target region 1 shows no obvious fluorescence in the closed-loop group, while the open-loop group shows obvious fluorescence, indicating that the probe can form a hairpin configuration and can obtain both closed-loop and open-loop states through heat treatment; while the probes corresponding to target regions 2 and 3 show no obvious fluorescence in the closed-loop group and weak fluorescence in the open-loop group, indicating that the above two probes can form a hairpin configuration, but cannot be completely opened under heat treatment.

[0058] Based on the GC content of target region 1, the center / minimum free energy map, the base pairing probability map, the position entropy map, the mountain-shaped map, the RBP binding site relationship, and the above experimental verification, the nucleotide region of positions 1582-1612 of the H19 transcript is confirmed as the preferred recognition window of this invention.

[0059] Example 2 Detection of intracellular H19 in LN229 cells using hairpin DNA probes.

[0060] Trial grouping and intervention methods: Experimental group: The 3' end of the hairpin DNA probe sequence with fluorescent and quenching groups designed in Example 1 for the target region numbered 1 was extended with four thymine residues (SEQ ID NO: 5, hereinafter referred to as hairpin DNA probe No. 1). The probe was then modified into nanoneedles by biotin modification at the 3' end. After being inserted into LN229 cells, the nanoneedles were centrifuged at 500 rpm for 5 min and then placed in a cell culture incubator at 37°C for 45 min. After removing the nanoneedles, they were processed according to the elution procedure and then photographed under a microscope and analyzed using ImageJ.

[0061] Among them, the aforementioned nanoneedles are silicon-based nanoneedle array chips. The nanoneedle chips can be functionalized through surface hydroxylation, amination, biotinylation, and streptavidin linkage steps.

[0062] Specifically, the nanoneedle chip was first treated with a piranha solution (concentrated sulfuric acid: 30% hydrogen peroxide = 3:1, v / v) at 90°C for 90 min to form hydroxyl groups on the silicon surface. After the reaction, the nanoneedle chip was removed by holding its edge with tweezers and washed sequentially with the following reagents: deionized water, methanol, methanol:dichloromethane = 3:1, and dichloromethane, each for 5 min. Then, it was treated overnight with APTES reaction solution (APTES:DCM = 1:4, v / v) to silanize and introduce amino groups onto the nanoneedle surface. After the reaction, the nanoneedles were washed sequentially with the following solvents: anhydrous ethanol, isopropanol, and deionized water, each for 5 min. Next, NHS-biotin (1 µg / mL final concentration, prepared with PBS) was reacted with the amino groups on the nanoneedle surface at 25°C for 1 h to introduce biotin groups. After the reaction, the nanoneedles were washed three times with deionized water for 5 min each time. Finally, streptavidin (10 µg / mL final concentration, prepared with PBS) was incubated at 25°C. h, to form a modified layer on the surface of the nanoneedles that can bind biotinylated probes; after the reaction, wash three times with deionized water, 5 min each time; finally, fix the biotinylated H19 hairpin DNA probe (final concentration 1µM, prepared with enzyme-free PBS) onto the surface of the nanoneedles to obtain an H19 capture nanoneedle chip; after the reaction, wash three times with deionized water, 5 min each time. Before detection, discard the original culture medium, gently wash with PBS, and add a small amount of serum-free culture medium to each well to keep the cells moist. Then, use tweezers to pick up the functionalized nanoneedle chip, aspirate excess liquid from the bottom of the chip, keep the nanoneedle array surface moist, and ensure the array surface faces the cells, smoothly covering the cell surface. Place the culture plate in a plate centrifuge, and centrifugation force to allow the nanoneedles to enter the cells. Centrifugation settings: 500 rpm, ramp 3 rpm / s, decelerate 6 rpm / s, 5 min. After centrifugation, the cells and nanoneedles were incubated together in a 37°C, 5% CO2 incubator for 45 min to allow intracellular H19 to fully hybridize with the hairpin DNA probes on the nanoneedle surface and trigger the opening of the hairpin structure. After incubation, serum-free culture medium was slowly added along the inner wall of the well plate, allowing the nanoneedle chip to gradually detach from the cell surface using liquid buoyancy. The chip was then removed by grasping the edge with tweezers, avoiding lateral sliding during removal to reduce cell scratching and loss of captured material. The removed nanoneedle chip was first washed in 0.05% SDS + 0.05% Tween-20 solution for 5 min to remove non-specifically adsorbed components; then washed three times with 5×SSC + 0.05% Tween-20, 5 min each time; and further briefly washed with DEPC water to reduce the risk of RNA degradation. The chips were then photographed using a conventional fluorescence microscope and analyzed using ImageJ.

[0063] Control group: Nanoneedles modified with hairpin DNA probes, similar to the experimental group, were used but did not penetrate LN299 cells and were treated in the same manner as described above.

[0064] The results are as follows Figure 4 As shown, the experimental group was able to detect a stronger fluorescence signal in the cells, indicating that the No. 1 hairpin DNA probe can be triggered by H19 in a real cell environment, thereby generating a detectable signal.

[0065] Example 3 Analysis of H19 expression levels after TMZ stimulation.

[0066] Construction of the TMZ-stimulated LN229 cell model (hereinafter referred to as the TMZ-stimulated model): LN229 cells were cultured for 24 h with 50 μM TMZ (prepared from DMSO stock solution to 50 mM and diluted with complete culture medium at a ratio of 1:1000).

[0067] The TMZ stimulation model and LN229 cells without TMZ stimulation were treated according to the intervention method of the experimental group in Example 2. The results are as follows: Figure 5 As shown, LN229 cells stimulated with TMZ showed a stronger fluorescence signal, indicating that the No. 1 hairpin DNA probe involved in this invention can be used to monitor changes in H19 levels in a drug-stimulated model.

[0068] Example 4 Validation of FISH under TMZ stimulation and aging conditions.

[0069] TMZ-stimulated cells: A TMZ stimulation model was constructed following the method described in Example 3; Senescent cell induction: LN229 cells were cultured continuously for 5 days in complete medium containing 50 μM TMZ (with daily medium changes). On the 6th day, the TMZ-containing medium was removed and replaced with complete medium without TMZ. This process was repeated for 3 days to induce senescence.

[0070] The TMZ-stimulated cells, senescent cells, and LN229 cells without TMZ stimulation and senescence induction were treated with hairpin DNA probe No. 1, and then subjected to FISH staining and imaging. The results are as follows: Figure 6 As shown.

[0071] Meanwhile, RNA was extracted and qPCR was performed on the TMZ-stimulated cells, senescent cells, and LN229 cells that were neither TMZ-stimulated nor senescence-induced. The results are as follows: Figure 7 As shown.

[0072] The FISH staining and qPCR steps are as follows: (1) The specific steps of FISH staining are as follows: After washing cells three times with PBS, add 4% paraformaldehyde fixative and fix at room temperature for 10 min. Remove the fixative and wash three times with PBS on a shaker at room temperature for 5 min each time. Then add 10 μg / mL Proteinase K prepared with PBS and digest at room temperature for 5 min, followed by washing twice with PBS on a shaker for 5 min each time. Fix again with 4% paraformaldehyde fixative at room temperature for 10 min, and then wash twice with PBS on a shaker for 5 min each time. To reduce background, add 0.5 M HCl and wash for 5 min on a shaker at room temperature, followed by washing twice with PBS on a shaker for 5 min each time. Then add freshly prepared acetylation solution at a 1:400 ratio and treat on a shaker at room temperature for 10 min, followed by washing twice with PBS on a shaker for 5 min each time. In the hybridization step, a hybridization solution containing hairpin DNA probes was prepared using RNase-free methods (Yeast RNA diluted 1:100 and hairpin DNA probes at a final concentration of 1 μg / ml was added to the Hybridization Solution). The solution was then shaken at 49°C in the dark for 20 min, followed by an ice bath for 2 min before use. Washing Buffers I, II, and III were prepared separately. Samples were added to the Hybridization Solution containing Yeast RNA, sealed, and pre-hybridized at 49°C in the dark for 20 min on a shaker to obtain the hybridization solution. Different cell samples were then added to the hybridization solution, sealed, and hybridized at 49°C in the dark for 3 h on a shaker. After probe recovery, the cells were washed three times (8 min each) with preheated Washing Buffer I at 49°C in the dark on a shaker; and once each with Washing Buffers II and III for 8 min each. Cell nuclei were stained with Hoechst 33342 staining solution in the dark, washed twice with PBS on a shaker in the dark, and then photographed under a fluorescence microscope.

[0073] (2) The qPCR steps are as follows: Reverse transcription was performed using PrimeScript™ RT Master Mix (Perfect Real Time): After mixing total RNA with the reagents according to the instructions, reverse transcription was performed at 37°C for 15 min, followed by inactivation at 85°C for 5 seconds. The resulting cDNA was then ready for use.

[0074] qPCR amplification: The TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) kit was used. When preparing the reaction system, cDNA template, primers and TB Green premix solution were added. A two-step program was run on a real-time quantitative PCR instrument: pre-denaturation (95℃, 30 s) and cyclic amplification (95℃, 5 s denaturation; 60℃, 34 s annealing extension; 40 cycles). Fluorescence signals were collected during the extension phase. Finally, the amplification specificity was verified by melting curve analysis.

[0075] The upstream primer for qPCR is shown in SEQ ID NO:10: CACTGGCCTCCAGAGCCCGT; The downstream primer for qPCR is shown in SEQ ID NO:11: CGTCTTGGCCTTCGCAGCTG.

[0076] Figure 6 and Figure 7 The results showed that stronger fluorescence signals could be detected in the cells regardless of whether they were stimulated by TMZ or senescence induced, indicating that H19 was highly expressed in the cells after TMZ stimulation or senescence induction, which is consistent with the results of qPCR verification.

[0077] The above results indicate that the No. 1 hairpin DNA probe of the present invention is not only suitable for intracellular detection mediated by nanoneedles, but also for fixed cell FISH systems.

[0078] Example 5 Pull-down / Western blot detection of H19-IGF2BP1 related samples under aging conditions.

[0079] H19 is a class of lncRNAs associated with tumorigenesis, drug response, and cellular senescence, and can serve as an RNP organization platform for dynamic association with RNA-binding proteins. IGF2BP1 is an RNA-binding protein involved in RNA stability, localization, and translational regulation. Existing H19 binding information suggests the presence of IGF2BP1-related binding signals in H19 transcripts, indicating that H19 has the basis for forming a related RNP complex with IGF2BP1. This association may be in a low-abundance, dynamic equilibrium state under basal conditions, but during cellular state changes such as drug stimulation or senescence induction, H19 expression levels and its RNP organization state may be remodeled, making the H19-related IGF2BP1 complex easier to capture and detect. Therefore, hairpin DNA probes targeting H19 can recognize intact H19 molecules and be used to further analyze the H19-related IGF2BP1 binding status.

[0080] The 3' end of the hairpin DNA probe sequence No. 1 was extended with four thymine residues (SEQ ID NO: 5), and biotin was modified at the 3' end of SEQ ID NO: 5. The hairpin DNA probe was then immobilized on streptavidin magnetic beads (P2151-200 μl, Beyotime) using biotin. The beads were then incubated at 25°C for 2 h with cell lysis buffer (RIPA lysis buffer, P0013D, Beyotime) obtained under non-denaturing, low-detergent conditions. The magnetic beads were washed three times with 1×Washing Buffer II (PBS (pH 7.4), 0.05% Tween-20) (each wash for 1 min to separate adsorption), and the binding protein was eluted with loading buffer containing 2% SDS. Western blot analysis was then performed.

[0081] Meanwhile, magnetic beads that were not modified with hairpin DNA probes were used as a control and were treated in the same manner as described above.

[0082] Western blot results are as follows Figure 8 As shown, the IGF2BP1 signal was very low in the magnetic bead group without hairpin DNA probes, indicating limited background adsorption of streptavidin magnetic beads. The IGF2BP1 signal was also low in the normal cell + hairpin DNA probe group, indicating a low basal recovery level of the H19-related IGF2BP1 complex in the uninduced state. After senescence induction, the hairpin DNA probe-modified magnetic beads targeting H19 were able to detect IGF2BP1-related signals in the pull-down product, indicating that this probe can be used to recover the H19-related RNP complex and detect the binding status of IGF2BP1 and other related proteins. This result further demonstrates that the probe of this invention is suitable for analyzing the binding status of H19-related proteins in drug-induced senescence.

[0083] The applicant declares that the technical solution of this invention is illustrated by the above embodiments, but this invention is not limited to the above embodiments, that is, it does not mean that this invention must rely on the above embodiments to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the products of this invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of this invention.

[0084] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0085] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

Claims

1. A hairpin DNA probe targeting H19 transcripts, characterized in that, The hairpin DNA probe comprises a first stem region, a loop region, and a second stem region sequentially from 5′ to 3′. The first stem region and the second stem region form a stem structure through complementary base pairing. The loop region and the second stem region can target the nucleotide region at positions 1582-1612 of the H19 transcript.

2. The hairpin DNA probe according to claim 1, characterized in that, The RNA sequence of the H19 transcript from nucleotides 1582 to 1612 is shown in SEQ ID NO:

1.

3. The hairpin DNA probe according to claim 1 or 2, characterized in that, The loop region and the second stem region contain the sequence shown in SEQ ID NO:2, which is used to target the nucleotide region from position 1582 to 1612 of the H19 transcript.

4. The hairpin DNA probe according to any one of claims 1-3, characterized in that, The length of the first and second stem regions of the hairpin DNA probe is independently 5-8 nucleotides. Preferably, the loop region of the hairpin DNA probe is 18-30 nucleotides in length.

5. The hairpin DNA probe according to any one of claims 1-4, characterized in that, The nucleic acid sequence of the hairpin DNA probe is shown in SEQ ID NO:

3.

6. The hairpin DNA probe according to any one of claims 1-5, characterized in that, The hairpin DNA probe is also attached with a detection marker and / or a capture group; Preferably, the detection label includes a fluorescent group and a quenching group located at both ends of the hairpin DNA probe; Preferably, the fluorescent group and the quenching group are each independently linked to both ends of the hairpin DNA probe via adenine or thymine; Preferably, the capturing group includes any one of biotin, amino, mercapto, azide, or alkynyl. Preferably, the biotin is linked to the 5' or 3' end of the hairpin DNA probe via 3-6 thymines.

7. A solid-phase probe composition for targeting H19, characterized in that, The immobilized probe composition includes the hairpin DNA probe according to any one of claims 1-6, and nanoneedles, chips, glass slides, magnetic beads, microspheres or nanoparticles on which the hairpin DNA probe is immobilized.

8. A method for detecting H19 in a sample, characterized in that, The method includes: The hairpin DNA probe of any one of claims 1-6 is contacted with the sample to be tested, and H19 is qualitatively and / or quantitatively analyzed by detecting fluorescence signals and / or microscopic imaging. Preferably, the sample includes live cells, fixed cells, tissue sections, cell lysates, in-situ recovered samples, or cell samples treated with TMZ.

9. A method for enriching H19-related samples, characterized in that, The method includes: The hairpin DNA probe with a capture group as described in claim 6 is contacted with a sample containing H19 to form a probe-H19 complex, which is then recovered to obtain a sample enriched with H19.

10. The use of the hairpin DNA probe of any one of claims 1-6 or the immobilized probe composition for targeting H19 of claim 7 in the preparation of a kit for H19 detection, H19 enrichment or H19-related binding state analysis; Preferably, the kit for H19 detection includes an H19 fluorescence in situ hybridization detection kit, an H19 live cell imaging detection kit, and an H19 nanoneedle in situ detection kit. Preferably, the kit for H19 enrichment includes an H19 pull-down kit; Preferably, the kit for H19-related binding state analysis includes a kit for H19-related IGF2BP1 binding state analysis.

Images