Soybean gm pco8 gene, its promoter and application

Abstract

The application discloses a soybean GmPC08 gene, a promoter of the soybean GmPC08 gene and application of the soybean GmPC08 gene, wherein a nucleotide sequence of the promoter of the soybean GmPC08 gene is shown as SEQ ID NO:1, and the soybean GmPC08 gene comprises the promoter and a CDS sequence shown as SEQ ID NO:2. It is found in the application that expression of the GmPC08 gene comprising the excellent natural variation promoter in a soybean plant can significantly improve a soybean seed protein content, the GmPC08 gene comprising the excellent natural variation promoter provides a gene resource and a theoretical basis for soybean breeding, and can be applied to cultivation of a high-protein soybean variety.

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics technology, and more specifically, this invention relates to a promoter of the soybean GmPC08 gene, the soybean GmPC08 gene and its applications. Background Technology

[0002] Soybean (Glycine max) is a globally important crop and one of the most important sources of plant protein and oil for humankind. Seed protein content is a key trait determining soybean quality. In recent years, with the continuous improvement of people's living standards, my country's demand for soybeans has risen sharply. Given the limited arable land per capita, the supply-demand imbalance for soybeans has become increasingly prominent. Therefore, improving soybean seed protein content to enhance soybean quality and economic value is of great significance for ensuring my country's food security.

[0003] With increasing human demand for soybean seed protein, breeding soybeans with high protein content is of great significance. However, the molecular regulatory mechanisms behind soybean seed protein accumulation are highly complex. Understanding this complex trait requires in-depth research into the key genes controlling seed protein formation, accumulation, and regulation. Although many important genetic loci related to seed protein content have been identified in recent years, a large number of genetic regulatory loci remain unclear, and the regulatory mechanisms of protein accumulation still need further exploration.

[0004] Currently, there are a large number of genetic variations in the already abundant soybean germplasm resources that remain to be analyzed and utilized. Therefore, identifying advantageous variations related to high protein content can provide important genetic resources and theoretical guidance for the breeding of high-protein soybean varieties. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide a gene that is highly correlated with the protein content of soybean seeds.

[0006] The technical solutions for achieving the above-mentioned objectives include the following.

[0007] In a first aspect, the present invention provides a promoter for the soybean GmPC08 gene, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0008] In a second aspect, the present invention provides a soybean GmPC08 gene, comprising the promoter of the soybean GmPC08 gene and a CDS sequence as shown in SEQ ID NO:2.

[0009] In a third aspect, the present invention provides a transgenic vector carrying the above-mentioned soybean GmPC08 gene.

[0010] In a fourth aspect, the present invention provides a method for constructing the above-mentioned transgenic vector, comprising the following steps: using soybean genomic DNA containing the promoter of the soybean GmPC08 gene as a template, performing PCR amplification with SEQ ID NO:5 and SEQ ID NO:6 as primers, and then ligating it with a vector plasmid digested with HindIII and BamHI enzymes.

[0011] In a fifth aspect, the present invention provides an engineered bacterium for transforming the above-described transgenic vector.

[0012] In a sixth aspect, the present invention provides the application of the promoter of the soybean GmPC08 gene, the soybean GmPC08 gene, the transgenic vector, or the engineered bacteria in increasing the protein content of soybean seeds or cultivating high-protein soybean varieties.

[0013] A seventh aspect of the present invention provides a method for increasing the protein content of soybean seeds, comprising the following steps: enabling soybean plants to carry and effectively express the GmPC08 gene, wherein the nucleotide sequence of the soybean GmPC08 gene is shown in SEQ ID NO:4.

[0014] This invention, using a natural soybean population as the research object, discovered that haplotypes of the GmPC08 gene, driven by a naturally mutated promoter, exhibit significantly higher seed protein content. By constructing a transgenic vector carrying this superior naturally mutated promoter of the GmPC08 gene and transferring it into Williams 82 cultivar soybean, the resulting T2 generation homozygous mutant plants showed a significant increase in seed protein content. Therefore, promoting the expression of the GmPC08 gene containing a superior naturally mutated promoter in soybean plants can significantly increase soybean seed protein content. The GmPC08 gene containing this superior naturally mutated promoter provides genetic resources and theoretical basis for soybean breeding and can be applied to the cultivation of high-protein soybean varieties. Attached Figure Description

[0015] Figure 1 This is a distribution diagram of seed protein content in 559 soybean germplasms in Example 1 of the present invention.

[0016] Figure 2 This is a Manhattan plot showing the genome-wide association analysis of seed protein content in 559 soybean germplasms in Example 1 of this invention.

[0017] Figure 3 The GmPC08 gene (GmPC08) is a superior natural variant of the promoter in Example 1 of this invention. hp Nucleotide sequence alignment of the seed protein and its correlation with seed protein content.

[0018] Figure 4The GmPC08 gene (GmPC08) is a superior natural mutation of the promoter in Example 3 of this invention. hp Seed protein content of transgenic lines. Detailed Implementation

[0019] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0020] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0021] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in Green and Sambrook et al., *Molecular Cloning: A Laboratory Manual* (2013), or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0022] In some embodiments of the present invention, a promoter for the soybean GmPC08 gene is disclosed, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0023] In other embodiments of the present invention, a soybean GmPC08 gene is disclosed, which includes the promoter of the soybean GmPC08 gene and the CDS sequence shown in SEQ ID NO:2.

[0024] In some embodiments, the nucleotide sequence of the soybean GmPC08 gene is shown in SEQ ID NO:4.

[0025] In other embodiments of the present invention, a transgenic vector carrying the above-mentioned soybean GmPC08 gene is disclosed.

[0026] In other embodiments of the present invention, a method for constructing the above-mentioned transgenic vector is disclosed, comprising the following steps: using soybean genomic DNA containing the promoter of the soybean GmPC08 gene as a template, performing PCR amplification with SEQ ID NO:5 and SEQ ID NO:6 as primers, and then ligating it with a vector plasmid digested with HindIII and BamHI enzymes.

[0027] In some embodiments, the vector plasmid is pTF101.

[0028] In other embodiments of the present invention, an engineered bacterium for transforming the above-described transgenic vector is disclosed.

[0029] In other embodiments of the present invention, the application of the above-mentioned soybean GmPC08 gene promoter, soybean GmPC08 gene, transgenic vector, or engineered bacteria in improving soybean seed protein content is disclosed.

[0030] In other embodiments of the present invention, the application of the above-mentioned soybean GmPC08 gene promoter, soybean GmPC08 gene, transgenic vector, or engineered bacteria in the cultivation of high-protein soybean varieties is disclosed.

[0031] In other embodiments of the present invention, a method for increasing the protein content of soybean seeds is disclosed, comprising the following steps: enabling soybean plants to carry and effectively express the GmPC08 gene, wherein the nucleotide sequence of the soybean GmPC08 gene is shown in SEQ ID NO:4.

[0032] Unless otherwise specified, the methods used in the following examples are conventional methods. Primer synthesis and sequencing can be completed independently or outsourced to a third-party gene company. Vectors and reagents used are all commercially available.

[0033] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0034] Example 1: Obtaining the GmPC08 gene related to soybean seed protein content

[0035] Includes the following steps;

[0036] 1. Using 559 soybean germplasm resources (231 cultivated soybeans, 207 local soybeans, and 121 wild soybeans) as the research object, the seed protein content of various germplasm types was determined using a near-infrared seed composition analyzer, and the distribution of seed protein content in the population was obtained (see...). Figure 1 );

[0037] 2. Based on the resequencing data of this natural soybean population, a genome-wide association study (GWAS) was performed using the MLM model. The Manhattan plot of the genome-wide association study of seed protein content is shown below. Figure 2As shown in the Manhattan plot, the horizontal axis represents the 20 chromosomes of the soybean genome, and the vertical axis represents the logarithm of the p-value. SNPs on each chromosome form the bars of that chromosome, with each point representing a single SNP. The dashed line in the plot represents the significance threshold. An SNP significantly correlated with seed protein content was found on chromosome 8 (i.e., the SNP site on chromosome 8 that exceeded the threshold), located at 7966968 bp. Interval gene analysis and population haplotype analysis revealed a natural variation in the promoter of the GmPC08 gene (CDS sequence shown in SEQ ID NO:2, and its encoded amino acid sequence shown in SEQ ID NO:3), which was highly correlated with seed protein content. Figure 3 The promoter of the naturally mutated GmPC08 gene (nucleotide sequence shown in SEQ ID NO:1) drives the CDS of the GmPC08 gene (hereinafter referred to as soybean GmPC08). hp The haplotype formed by the gene (whose nucleotide sequence is shown in SEQ ID NO:4) has a significantly higher seed protein content.

[0038] SEQ ID NO:1(2101bp)

[0039] TAAAAAT AAAAATAAAATATTTTCTTCTTCCCCACTCTATTTATACCGAATTTTCCCTCTCCCTTTCTACCCCCAAAACCCCTCTTCACTTTCAATCTCTTTCCCTTCCTTTCCTTGTCTTTTTATTTTTTTACATCAAAATTAAAATAATAACACCCATCAAACAAACCACACTTCTCCCCCTCCCTTTGAAAACACCTCAATCAATCTCG

[0040] SEQ ID NO:2(1770bp)

[0041]

[0042] SEQ ID NO:3(590aa)

[0043] MIMAALNSSTCAKPQFPHPLSSSFSSSSSLTRDLGFPTRFQKKPIRKVVDCALHSPPVIHFPNQPYNKPEITKEPTTSTAERPQWNPFQKAAAKALDMFESALLSRELNQPFPKTTDPRVQIAGNFAPVPEHPVEHSLPVIGTIPDAINGVYLRNGANPLFKPKAGHHLFDGDGMVHAVKFNDGTASYACRFTETQRLMQERKLGKPVFPKAIGELHGHSGIARLMLFYARGLCGIVDHRRGAGAANAGLVFFNGKLLAMSEDDFPYELRITASGDLETIGRYSFHGQLNSSMIAHPKVDPVSGELFTLSYDVTSKILKYFHFSPEDERKSPDIEIPLDAPTMTHDFAITENFVVIPDQQVVFKLGEMIKGGSPVIYDGEKKSRFGILPKYASDASSIVWVDSPDTFFFHFWNAWEERDKDEVVVIGSCMTPPDSIFNDREERLKSVLTEVRLNMRSGKARRRVLVEEMNLEAGMVNRKRLGRKTRFAYLCIAEPWPKVSGVAKVDLESGEVKRHEYGERRFGGEPFFLPTRGGNGNEDEGYVMAFVHDEMTWQSELQILNALDLKLEATVMLPSRVPYGFHGTFVEAH*

[0044] SEQ ID NO:4(3871bp)

[0045] TAAAAAT AAAAATAAAATATTTTCTTCTTCCCCACTCTATTTATACCGAATTTTCCCTCTCCCTTTCTACCCCCAAAACCCCTCTTCACTTTCAATCTCTTTCCCTTCCTTTCCTTGTCTTTTTATTTTTTTACATCAAAATTAAAATAATAACACCCATCAAACAAACCACACTTCTCCCCCTCCCTTTGAAAACACCTCAATCAATCTCG ATG

[0046] Example 2: Construction of GmPC08 hp Transgenic vectors

[0047] This embodiment constructs a system containing GmPC08. hp A transgenic vector (driven by a naturally occurring promoter of the GmPC08 gene) includes the following steps:

[0048] 1. Extract high seed protein content wild soybean germplasm ZYD2718 (containing GmPC08) using the CTAB method or a plant genomic DNA extraction kit (NuClean Plant Genomic DNA Kit). hp Leaf genomic DNA (genes), in GmPC08 hp Forward adapter amplification primers for genes: proGmPC08 hp -HindIII-F (SEQ ID NO:5) and reverse adapter amplification primer GmPC08 hp -BamHI-R (SEQ ID NO:6) was used for PCR amplification to obtain GmPC08. hp Gene fragments.

[0049] The reaction system is shown in Table 1. The amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 sec; 60℃ annealing for 30 sec; 72℃ extension for 5 min, 35 cycles; 72℃ extension for 10 min.

[0050] proGmPC08 hp -HindIII-F (SEQ ID NO:5):

[0051] GACCTGCAGGCATGCAAGCTTGAGAATGGATCGATCTGGTTCACATTAGTTC

[0052] GmPC08 hp -BamHI-R (SEQ ID NO:6):

[0053] ATCCTTGTAGTCCATGGATCCATGAGCCTCCACAAAACGTGC

[0054] Table 1

[0055]

[0056]

[0057] 2. Purify the PCR products according to the kit instructions.

[0058] 3. Vector digestion and recombination ligation

[0059] 3 μg of pTF101 vector was digested with restriction endonucleases HindIII and BamHI, and the mixture was incubated at 37℃ for 1 h. The linearized vector was then recovered and purified, and recombinant ligation was performed according to the reaction system shown in Table 2, incubated at 37℃ for 30 min.

[0060] Table 2

[0061] Element volume Linearized carrier 0.03 pmol <![CDATA[GmPC08 hp Gene fragments 0.06 pmol 5×CEⅡBuffer 2μL Exnase II 1μL <![CDATA[ddH2O]]> Make up to 10 μL

[0062] 4. Transformation of competent states and identification

[0063] The ligation product was transformed into *E. coli* TOP10 competent cells and plated. Positive clones were picked and expanded in LB broth containing the corresponding antibiotics. PCR identification and sequencing verification were performed using primers GmPC08-F (SEQ ID NO:7) and Flag-R (SEQ ID NO:8), thus obtaining clones carrying GmPC08. hp A transgenic vector for the gene (GmPC08 gene driven by a naturally mutated promoter, nucleotide sequence as shown in SEQ ID NO:4).

[0064] GmPC08-F (SEQ ID NO:7): GGAAAACTCCTCGCCATGTC

[0065] Flag-R(SEQ ID NO:8):GTTCTTGTCATCGTCATCCT

[0066] Example 3: Agrobacterium-mediated transformation of soybeans

[0067] Includes the following steps:

[0068] 1. Obtaining soybean explants

[0069] Williams 82 soybean seeds with smooth surfaces, free from cracks, disease spots, and mold were sterilized with chlorine for 10–14 hours, and then cultured in the dark on MS basal medium. After germination, the two cotyledons were cut along the midline in a clean bench, the two original leaf buds were removed, and a wound about 3 mm long was made at the junction of the cotyledon and hypocotyl.

[0070] 2. Soybean genetic transformation

[0071] Agrobacterium-mediated genetic transformation was used to transform the GmPC08-carrying cells from Example 2. hp The EHA105 strain of the gene transgenic vector infected cotyledon wounds, and transgenic plants were obtained after induction culture.

[0072] 3. Screening for heritable transgenic plants

[0073] Transgenic seedlings of generation T0 were screened by spraying with 160 mg / L glufosinate (Basta) and identified by PCR to obtain positive plants. These were then propagated to obtain generation T1 plants. Total DNA was extracted from the leaves of generation T2 transgenic plants.

[0074] 4. Quality assessment of transgenic plants

[0075] The protein content of transgenic soybean seeds was determined by near-infrared spectroscopy. The results are as follows: Figure 4 As shown. Figure 4 The results showed that, compared to the cultivated soybean variety Williams 82 (W82), the two varieties carrying GmPC08... hp The transgenic lines all showed significantly increased seed protein content.

[0076] The above results indicate that the soybean GmPC08 gene (nucleotide sequence shown in SEQ ID NO:4), including the promoter with natural variation, can promote the accumulation of soybean seed protein.

[0077] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0078] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A promoter for the soybean GmPC08 gene, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

1.

2. A soybean GmPC08 gene, characterized in that, It includes the promoter of the soybean GmPC08 gene as described in claim 1 and the CDS sequence shown in SEQ ID NO:

2.

3. The soybean GmPC08 gene according to claim 2, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

4.

4. A transgenic vector carrying the soybean GmPC08 gene as described in claim 2 or 3.

5. A method for constructing a transgenic vector as described in claim 4, characterized in that, The procedure includes the following steps: using soybean genomic DNA containing the promoter of the soybean GmPC08 gene as described in claim 1 as a template, performing PCR amplification with SEQ ID NO:5 and SEQ ID NO:6 as primers, and then ligating it with a vector plasmid digested with HindIII and BamHI enzymes.

6. The construction method according to claim 5, characterized in that, The vector plasmid is pTF101.

7. An engineered bacterium that transforms the transgenic vector of claim 4.

8. The application of the promoter of the soybean GmPC08 gene as described in claim 1, the soybean GmPC08 gene as described in claim 2 or 3, the transgenic vector as described in claim 4, or the engineered bacteria as described in claim 7 in improving the protein content of soybean seeds.

9. The application of the promoter of the soybean GmPC08 gene as described in claim 1, the soybean GmPC08 gene as described in claim 2 or 3, the transgenic vector as described in claim 4, or the engineered bacteria as described in claim 7 in the cultivation of high-protein soybean varieties.

10. A method for increasing the protein content of soybean seeds, characterized in that, Includes the following steps: The soybean plant carries and effectively expresses the GmPC08 gene, and the nucleotide sequence of the soybean GmPC08 gene is shown in SEQ ID NO:4.

Images