A single-chain DNA aptamer targeting B7-H3 and a screening method thereof
Patent Information
- Application Number
- CN202610790326.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-03
- Publication Date
- 2026-08-18
AI Technical Summary
[0011]本发明的目的在于针对现有技术中B7-H3的核酸适配体靶标筛选流程繁琐、特异性与亲和力不足等问题,提供一组靶向B7-H3的单链DNA适配体
本发明提供了一种靶向B7-H3的单链DNA适配体,其亲和力为20.6pM,可特异性结合B7-H3阳性SK-N-AS细胞。本发明为B7-H3相关生物分子识别研究提供了新的候选识别分子;所述适配体对B7-H3具有良好的亲和力和一定的细胞识别能力。
Smart Images

Figure CN122588090A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biomolecular recognition and tumor molecular imaging technology, specifically to a set of single-stranded DNA aptamers targeting B7-H3 and their screening methods. Background Technology
[0002] B7-H3 (B7 homolog 3), also known as CD276 (differentiation cluster 276), is an important member of the B7 family and belongs to the category of immune regulation-related molecules. In recent years, B7-H3 has received widespread attention due to its abnormal expression in various malignant tumors and its close association with tumor immune escape, invasion and metastasis, and poor prognosis. Especially in the field of neuroblastoma, B7-H3 is considered to have outstanding research value. In 2004, Castriconi et al. first identified 4Ig-B7-H3 as a neuroblastoma-related molecule and pointed out that its expression on the surface of neuroblastoma cells can participate to some extent in the escape process of tumor cells from NK cell-mediated killing (Proceedings of the National Academy of Sciences, 2004, 101(34), 12640-12645). Subsequent studies have further demonstrated that B7-H3 still exhibits high expression levels in high-risk neuroblastomas and GD2-negative or low-expression variants, making it a promising diagnostic and therapeutic target (Journal for ImmunoTherapy of Cancer, 2021, 9(4), e002293). Therefore, constructing highly specific recognition molecules around B7-H3 is not only significant for basic research related to neuroblastoma, but also provides a crucial molecular basis for tumor cell recognition, molecular subtyping analysis, and the development of molecular imaging probes.
[0003] Currently, the recognition and detection of B7-H3 mainly rely on antibody molecules, which have been widely used in flow cytometry, immunohistochemistry, immunofluorescence, and related targeted research. As mature biorecognition elements, antibodies usually have high affinity and good target specificity, but they still have shortcomings such as complex preparation processes, long production cycles, high costs, large batch-to-batch variations, and high requirements for storage and transportation conditions. In addition, antibodies have large molecular weights and complex structures, which are not conducive to rapid tissue penetration and flexible chemical modification in some application scenarios. Especially in the process of constructing molecular imaging probes, the molecular size of the recognition element, the controllability of modification sites, coupling efficiency, and in vivo stability all significantly affect the preparation efficiency and imaging performance of the probe. Previous studies have reported molecular imaging probes based on anti-B7-H3 antibodies and verified the target effectiveness of B7-H (Theranostics, 2018, 8(15), 4199), which also shows that the development of new B7-H3 recognition molecules has clear scientific significance and application potential.
[0004] Nucleic acid aptamers are single-stranded nucleic acid molecules obtained from random nucleic acid libraries through in vitro screening techniques. They bind to targets with high specificity based on their specific spatial conformation. Compared to antibodies, nucleic acid aptamers offer advantages such as convenient chemical synthesis, smaller molecular weight, greater structural designability, ease of end modification and functionalization labeling, higher batch-to-batch consistency, and better thermal stability. They show promising prospects in biomolecular recognition, disease biomarker detection, cell targeting, and the construction of molecular imaging probes. Single-stranded DNA aptamers, in particular, offer relatively mild screening conditions, lower preparation costs, and chemical stability. They are also easier to conjugate with fluorescent groups, radionuclides, nanomaterials, or other functional molecules, thus possessing unique advantages in tumor-targeting recognition and imaging probe design.
[0005] Despite this, research on nucleic acid aptamers targeting B7-H3 remains relatively limited. Existing literature has reported obtaining ssDNA aptamers targeting B7-H3 using the hybrid-SELEX method (Scientific Reports, 2024, 14(1), 13552), and verifying their feasibility in flow cytometry, dot-blot, and immunohistochemistry experiments. These studies demonstrate that developing nucleic acid aptamers targeting B7-H3 is technically feasible and provides a preliminary foundation for the development of B7-H3 recognition molecules. However, from the perspective of existing technologies as a whole, the resources of aptamer sequences targeting B7-H3 are still relatively limited, and the number of recognition molecules available for different application scenarios remains insufficient. In particular, for neuroblastoma cell recognition and subsequent molecular imaging probe construction, it is still necessary to obtain new aptamer sequences with good binding performance and cell recognition capabilities to meet more refined and diversified research needs.
[0006] Therefore, it is still necessary to develop a new set of single-stranded DNA aptamers targeting B7-H3 and establish corresponding screening methods to obtain nucleic acid molecules that can specifically recognize B7-H3 and have good cell binding ability, so as to provide new candidate recognition elements and molecular tools for B7-H3-related biomolecular recognition research, neuroblastoma targeting analysis, and further development of molecular imaging probes.
[0007] Existing technology 1: Currently, the protein-SELEX method based on recombinant proteins can be used to screen B7-H3 nucleic acid aptamers. This type of method usually uses purified B7-H3 recombinant protein as the positive screening target, and obtains candidate aptamer sequences through target immobilization, random nucleic acid library incubation, elution, amplification, and multiple rounds of enrichment. Existing literature reports (ScientificReports, 2024, 14(1), 13552) that a screening strategy containing protein-SELEX steps was used in the screening of B7-H3 aptamers, that is, positive screening was performed using immobilized recombinant B7-H3 protein, and reverse screening was performed using a blank vector. Although the screening conditions of the protein-SELEX method based on recombinant proteins are relatively controllable, the recombinant proteins used usually need to be immobilized, which may differ from the native state of B7-H3 on the cell membrane surface in terms of spatial conformation or local microenvironment, resulting in insufficient recognition ability of the obtained aptamers for native B7-H3 conformation. In addition, non-specific adsorption may be introduced on the surface of immobilized carriers or magnetic beads, affecting screening efficiency and the specificity of candidate sequences.
[0008] Existing technology 2: For screening nucleic acid aptamers targeting cell surface proteins, a live-cell-based cell-SELEX method can also be used. This method typically uses target-positive cells as the positive screening target and negative or control cells as the negative screening target. It preserves the spatial conformation and membrane surface microenvironment of the target protein under conditions closer to its natural physiological state, thereby screening for candidate sequences capable of recognizing the natural target on the cell surface. For B7-H3, previous literature has disclosed attempts to perform cell-SELEX on B7-H3 transduced cells. While this live-cell-based cell-SELEX method is beneficial for preserving the native conformation of the target protein, the complex composition of the cell surface, including numerous other membrane proteins and surface molecules besides the target protein, easily leads to the enrichment of nucleic acid sequences that non-specifically bind to other cell surface components during the screening process, resulting in insufficient target specificity of the selected candidate molecules. Literature reports that non-selective binding still occurred after cell-SELEX on B7-H3 transduced cells, failing to obtain ideal B7H3-specific aptamers.
[0009] Existing technology 3: Previous studies have used the hybrid-SELEX method, which combines protein-SELEX and cell-SELEX, to screen B7-H3 nucleic acid aptamers. Maradani et al. (Scientific Reports, 2024, 14(1), 13552) used a pre-screened CSEP-15 enriched library as the starting library, combined one round of protein-SELEX and one round of cell-SELEX into one round, and performed a total of 9 rounds of screening. Subsequently, they combined high-throughput sequencing to obtain 5 candidate ssDNA aptamers. The results showed that the binding rate of these five aptamers to Weri-RB1 cells was approximately 90%–97%, with a KD of approximately 32.12±4.70 nM to 51.40±5.68 nM on Weri-RB1 cells and a KD of approximately 19.24±4.40 nM to 32.72±4.56 nM on recombinant B7-H3 protein. They can be used for experiments such as flow cytometry, dot-blot, western blot, and immunohistochemistry.
[0010] While the hybrid-SELEX method described above can obtain nucleic acid aptamers with good binding ability to B7-H3, it still requires alternating protein-SELEX and cell-SELEX, combined with high-throughput sequencing and various subsequent experimental verifications, making the screening process quite complex. In addition, this method involves a total of 9 rounds of screening, which is still too many rounds, and it also inherits some limitations of immobilized protein screening and live cell screening, such as non-specific binding on the vector surface and complex cell backgrounds. Summary of the Invention
[0011] The purpose of this invention is to address the problems of cumbersome screening process, insufficient specificity and affinity of nucleic acid aptamer targets for B7-H3 in the existing technology, and to provide a set of single-stranded DNA aptamers targeting B7-H3.
[0012] The second objective of this invention is to provide a method for screening single-stranded DNA aptamers that target B7-H3.
[0013] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: A single-stranded DNA aptamer targeting B7-H3, the nucleotide sequence of which is shown in SEQ ID NO.1; SEQ ID NO.1: 5'-AGCAGCAGGTCAGATGTGTGCGCGTCATCCGAACACCGCTGCGACCCTATGCGGTGAA-3'.
[0014] A method for screening single-stranded DNA aptamers targeting B7-H3, comprising the following steps: S1. Mix the fluorescently labeled initial random oligodeoxynucleotide library solution with B7-H3 protein in equal volume and incubate together. Separate and analyze the mixture by capillary electrophoresis (CE) and collect the ssDNA-B7-H3 complex. S2. Design upstream and downstream primers for PCR amplification of the ssDNA sequence in the complex. Use the ssDNA-B7-H3 complex collected in step S1 as a template for symmetrical PCR. Collect the PCR products and detect their length and purity by agarose gel electrophoresis, and then perform gel extraction and recovery. Perform asymmetric PCR on the gel-recovered products. The asymmetric PCR amplification is the same as that of symmetrical PCR, except that the upstream primer is replaced with a fluorescently labeled upstream primer and the downstream primer is replaced with the same volume of sterile water for PCR amplification. Perform gel extraction and recovery to obtain the products, which are the secondary library for the next round of screening. S3. The first round of screening used an initial 400 nM random oligodeoxynucleotide library (initial library) and B7-H3 samples. After incubation under the same conditions as in step S1, they were separated by capillary electrophoresis and the complex was collected. The complex was then amplified and purified by PCR in step S2 and used for the second and third rounds of screening. During the second and third rounds of screening, the concentration of B7-H3 was gradually reduced to implement a progressive convergent screening strategy. The third round of ssDNA-B7-H3 protein complex was collected and subjected to symmetric and asymmetric PCR, alcohol precipitation, and gel extraction to obtain the secondary library for the fourth round of screening. S4. The affinity of the initial random oligodeoxynucleotide library and the secondary libraries from the second to fourth rounds was measured with B7-H3. The screening was then determined based on the affinity results. The final results showed that after three rounds of screening, the affinity of the fourth-round secondary library with B7-H3 no longer decreased, indicating that the screening had essentially reached enrichment equilibrium. Further screening was unlikely to obtain aptamer sequences with higher affinities, therefore subsequent screening was stopped. The products collected in the third round were amplified by symmetrical PCR and then subjected to high-throughput sequencing. MEME analysis was performed on the sequencing results to obtain significantly enriched motifs. Based on the significance level of each sequence matching the corresponding motif, two representative single-stranded DNA sequences with smaller p values were selected from each motif as candidate aptamer sequences. S5. Affinity determination of candidate aptamer sequences; sequence optimization and truncation of candidate aptamer sequences with better affinity; selection of sequences with better affinity as single-stranded DNA aptamers targeting B7-H3.
[0015] In the screening method described above, preferably, in step S1, the sequence of the random oligodeoxynucleotide library solution is as shown in SEQ ID NO.2 (5'-FAM-AGCAGCACAGAGGTCAGATG-(N40)-CCTATGCGTGCTACCGTGAA-3'), where N40 is a random sequence region composed of 40 random deoxynucleotides (A, T, C, G), with each base position randomly distributed to construct the diversity of the library.
[0016] In the screening method described above, preferably, in step S1, the buffer used for the random oligodeoxynucleotide library solution and the B7-H3 protein is a Tris-HCl buffer with a pH of 7.5 and a concentration of 10 mM, the concentration of the random oligodeoxynucleotide library solution is 400 nM ssDNA, and the concentration of the B7-H3 protein solution is 2.0 μM; the incubation temperature is 37°C, and the incubation time is 10 min.
[0017] In the screening method described above, preferably, in step S1, the capillary electrophoresis is performed with a pressure injection of 0.5 psi for 8 s, and CE separation analysis is carried out under the conditions of a high voltage of 20 kV and a temperature of 25 °C in the fused silica capillary.
[0018] In the screening method described above, preferably, in step S2, the upstream primer used in the symmetrical PCR amplification reaction system is as shown in SEQ ID NO.3 (AGCAGCACAGAGGTCAGATG), and the downstream primer is as shown in SEQ ID NO.4 (TTCACGGTAGCACGCATAGG); the symmetrical PCR amplification system consists of 264.0 µL ddH2O, 132.0 µL 30.0 µM upstream primer, 132.0 µL 30.0 µM downstream primer, and 550.0 µL PCR Mix enzyme; 2.0 µL ssDNA-B7-H3 complex and 48.0 µL of the above mixture are mixed for amplification; the amplification reaction program is 94 °C for 1 min; 94 °C for 30 s, 59 °C for 30 s, and 72 °C for 30 s for 20 cycles; the asymmetric PCR steps are the same as symmetrical PCR, the upstream primer is FAM-labeled, and the sequence is the same as symmetrical PCR; the downstream primer is replaced with the same volume of sterile water, the template is the above symmetrical PCR product, and 28 amplification cycles are performed.
[0019] In the screening method described above, preferably, in step S3, the concentration of B7-H3 used in the second round of screening is 2.0 μM, and the concentration of B7-H3 used in the third round of screening is 1.0 μM.
[0020] In the screening method described above, preferably, in step S4, the formula for calculating affinity is: Where A1 is the peak area of free ssDNA, A2 is the peak area of the B7-H3-ssDNA complex, A3 is the peak area of the dissociation region between the two, and [P]0 and [ssDNA]0 represent the final concentrations of the target protein B7-H3 and the ssDNA library, respectively. The peak areas are obtained by integrating the electrophoretic patterns using capillary electrophoresis analysis software.
[0021] As described above, preferably, in step S4, the MEME analysis uses an online tool: meme-suite.org.
[0022] In the screening method described above, preferably, in step S5, the affinity determination is performed using the surface plasmon resonance method.
[0023] In the screening method described above, preferably, in step S5, sequence optimization and truncation are performed by analyzing the binding sites of aptamer candidate sequences and B7-H3 through molecular docking. Based on the interaction results between the aptamer candidate sequences and B7-H3 in the molecular docking results, redundant sequences are truncated without changing the secondary structure of the aptamer to obtain truncated sequences. The affinity is determined by the surface plasmon resonance method, and aptamer sequences with higher affinity are selected.
[0024] Furthermore, molecular docking analysis was performed using the HDOCK online molecular docking platform, available at: http: / / hdock.phys.hust.edu.cn / ; aptamer secondary structure prediction was performed using the mFold online analysis tool, available at: http: / / www.unafold.org / mfold / applications / dna-folding-form.php.
[0025] The beneficial effects of this invention are as follows: This invention provides a single-stranded DNA aptamer targeting B7-H3 with an affinity of 20.6 pM, capable of specifically binding to B7-H3-positive SK-N-AS cells. This invention provides a novel candidate recognition molecule for research on B7-H3-related biomolecular recognition; the aptamer exhibits good affinity for B7-H3 and a certain degree of cell recognition ability.
[0026] This invention also provides a method for screening single-stranded DNA aptamers targeting B7-H3. Using capillary electrophoresis screening technology, with B7-H3 recombinant protein as the target, candidate aptamer sequences are obtained through three rounds of progressive convergent screening. Then, through affinity determination, sequence truncation optimization, and cell binding verification, highly specific and high-affinity single-stranded DNA aptamers targeting B7-H3 are obtained. The screening process of this invention is simple and efficient, requiring only three rounds to complete sequence enrichment. The optimal truncated aptamer, Apt645-Truc2, has an affinity of 20.6 pM for B7-H3 and can specifically bind to B7-H3-positive SK-N-AS cells. This aptamer can serve as a novel recognition element for applications in B7-H3-related molecular detection, neuroblastoma targeting analysis, and molecular imaging probe construction, demonstrating significant research and clinical translational value.
[0027] The screening method provided by this invention is simple and efficient, and the resulting aptamers have small molecular weights, are easy to modify, and have good stability. They can be used for B7-H3 molecular detection, neuroblastoma targeted recognition, and molecular imaging probe construction, providing novel and efficient recognition elements. Attached Figure Description
[0028] Figure 1 The results show the optimized interaction conditions between ssDNA N40 and B7-H3 in Example 1.
[0029] Figure 2 Capillary electrophoresis images and library affinity determination for the first to third rounds of screening of B7-H3 nucleic acid aptamers.
[0030] Figure 3 Motif analysis of high-throughput sequencing results and p-values and frequencies of candidate sequences.
[0031] Figure 4 The results show the affinity determination of six aptamer candidate sequences.
[0032] Figure 5 This document presents schematic diagrams of the secondary structures of Apt2 and its truncated sequence, SPR affinity assays, and visualization of the CE complex.
[0033] Figure 6 Schematic diagram of the secondary structure of Apt645 and its truncated sequence, SPR affinity determination, and visualization of the CE complex.
[0034] Figure 7 Fluorescence microscopy results after incubation of B7-H3 aptamers with SK-N-AS cells. Detailed Implementation
[0035] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.
[0036] Unless otherwise specified, the techniques used in the examples are conventional techniques well known to those skilled in the art; the experimental methods and conditions involved can be specifically operated by referring to relevant experimental manuals, publicly available literature, or product instructions provided by reagent manufacturers. Unless otherwise specified, the raw materials used in the examples can be commercially available products, such as B7-H3 protein purchased from Beijing Yiqiao Shenzhou Technology Co., Ltd.; SK-N-AS cells purchased from Beyotime Biotechnology Co., Ltd.; fused silica capillary tubes purchased from Hebei Handan Development Zone Aotai Biotechnology Co., Ltd.; the fluorescently labeled ssDNA40N and nucleic acid sequences used in the examples were synthesized by Sangon Biotech Co., Ltd.; and the high-throughput sequencing of the conventional PCR products in Example 2 was performed by Sangon Biotech Co., Ltd.
[0037] Example 1
[0038] A method for screening single-stranded DNA aptamers targeting B7-H3, comprising the following steps: 1. Nucleic acid aptamer screening: (1) Fluorescently labeled random oligodeoxynucleotide library solution (ssDNA, 5'-FAM-AGCAGCACAGAGGTCAGATG-(N40)-CCTATGCGTGCTACCGTGAA-3', where N40 is a random sequence region composed of 40 random deoxynucleotides (A, T, C, G), with each base randomly distributed to construct the diversity of the library) was mixed with B7-H3 protein in equal volume and incubated together. The mixture was then subjected to capillary zone electrophoresis. The capillary electrophoresis (CE) pressure was set to 0.5 psi for 8 s, and CE separation analysis was performed under high voltage (20 kV for fused silica capillary) and temperature of 25 °C. During the electrophoresis process, the migration rates of free ssDNA and ssDNA-B7-H3 protein complex in the capillary were different, and they passed through the detection window at the end of the capillary in sequence. The ssDNA-B7-H3 complex was collected.
[0039] To obtain the optimal experimental conditions for the formation of a stable complex between ssDNA and B7-H3, and to provide experimental basis for subsequent capillary electrophoresis screening, this embodiment uses the change in the peak area of the complex in the capillary electrophoresis pattern as an evaluation index to optimize the experimental conditions for the interaction between ssDNA and B7-H3. The optimized parameters include B7-H3 protein concentration, type of incubation buffer, incubation time, and incubation temperature.
[0040] Before the experiment, a solution of ssDNA N40 at a certain concentration was prepared. The ssDNA N40 was centrifuged at 3000 rpm for 5 min, and then diluted with pure water to prepare a 10 μM stock solution of raw ssDNA N40. This stock solution was then incubated in a 94℃ metal bath for 5 min, cooled on ice, and stored at -20℃. The raw ssDNA N40 stock solution was diluted with PBS to obtain a 400 nM ssDNA N40 sample solution.
[0041] The capillary used in capillary electrophoresis was a fused silica capillary with a total length of 50.2 cm, an effective length of 40 cm, and an inner diameter of 75 μm. The mixture was injected into a Beckman P / ACE MDQ capillary electrophoresis system for electrophoresis. The electrophoresis buffer was a borate-borax solution prepared by mixing 50 mM borax solution and 20 mM boric acid solution at a volume ratio of 3:2, with a pH of 8.7. Injection conditions: 0.5 psi, 8 s; Electrophoresis analysis conditions: 10 min, 20 kV, 25 °C; the capillary outlet was the negative electrode, and the inlet was the positive electrode. During electrophoresis, free ssDNA and the ssDNA-KIM-1 complex migrated at different rates in the capillary, passing sequentially through the detection window at the capillary end, allowing for the detection and separation of the peaks of free ssDNA and the ssDNA-B7-H3 complex. The capillary online reaction was detected using laser-induced fluorescence (CE-LIF) under the following conditions: excitation wavelength 488 nm and emission wavelength 520 nm.
[0042] (1) Confirmation of the B7-H3 complex with ssDNA
[0043] To confirm the formation of a complex between ssDNA and B7-H3, ssDNA was first incubated with 1.0 μM B7-H3 protein, and the results were detected by capillary electrophoresis. The results showed that compared to free ssDNA, a new peak appeared at 4.4 min on the electrophoretic pattern after incubation, and the ssDNA peak was significantly reduced, indicating the formation of a complex between ssDNA and B7-H3, thus confirming their interaction. Figure 1 A). Building upon the above, different concentration gradients of B7-H3 protein (0.5 μM, 1.0 μM, and 2.0 μM) were further set up and incubated with 200 nM ssDNA under the same conditions before capillary electrophoresis detection. The results showed that as the concentration of B7-H3 protein increased, the complex peak in the electrophoretic pattern also gradually increased, further verifying that this peak was the complex peak formed by B7-H3 and ssDNA. Figure 1 The region marked in B is the peak of the B7-H3-ssDNA complex.
[0044] (2) Optimization of incubation buffer
[0045] After confirming the formation of the complex, the types of incubation buffers were further optimized. Water, pH 7.4 PBS buffer, pH 7.5 10mM Tris-HCl buffer (containing 2.7mM KCl and 1.0mM MgCl2), pH 7.5 10mM Tris-HCl buffer, and DPBS buffer (0.9mM CaCl2, 2.685mM KCl, 1.47mM KH2PO4, 0.49mM MgCl2, 137mM NaCl, 8.1mM Na2HPO4, pH 7.5) were used as incubation buffers. 400nM ssDNA and 2.0μM B7-H3 were prepared using these buffers, mixed and incubated, and then detected by capillary electrophoresis. The peak area of the complex under different buffer conditions was compared. The results showed that the complex formed by ssDNA and B7-H3 had the largest peak area under pH 7.5 and 10mM Tris-HCl buffer conditions. Figure 1 (C) indicates that the buffer system is more conducive to the binding between the two, therefore, pH 7.5, 10mM Tris-HCl buffer was determined as the incubation buffer used in subsequent experiments.
[0046] (3) Optimization of incubation time
[0047] Under optimal buffer conditions, the effect of incubation time on the interaction between ssDNA and B7-H3 was further investigated. 400 nM ssDNA and 2.0 μM B7-H3 were mixed in equal volumes in 10 mM Tris-HCl buffer at pH 7.5, and incubated for 0 min, 10 min, 20 min, 30 min, and 60 min, respectively, followed by capillary electrophoresis detection. The results were analyzed based on the changes in the peak area of the complex (…). Figure 1 (D) Within 10 minutes, the peak area of the complex increased significantly. Further increasing the incubation time resulted in a significant decrease in the peak area, and peak tailing occurred at 30 and 60 minutes. Therefore, 10 minutes was determined to be the optimal incubation time for subsequent experiments.
[0048] (4) Optimization of incubation temperature
[0049] Under optimal buffer and incubation time conditions, the effect of incubation temperature on the binding of ssDNA to B7-H3 was further investigated. 400 nM ssDNA and 2.0 μM B7-H3 were mixed in equal volumes in 10 mM Tris-HCl buffer at pH 7.5, and incubated at 4 °C, 25 °C, and 37 °C for 10 min, respectively, before capillary electrophoresis detection. The results showed that ( Figure 1(E) As the temperature gradually increases, the peak area of the complex gradually increases. The peak area of the complex is the largest and the repeatability is good at 37℃, indicating that this temperature is more conducive to the formation of a stable complex between ssDNA and B7-H3. Therefore, 37℃ was determined to be the optimal incubation temperature for subsequent screening experiments.
[0050] Example 2
[0051] This embodiment is based on Example 1. (1) Under optimal experimental conditions: 400 nM ssDNA and 4.0 μM B7-H3 were placed in pH=7.5 and 10 mM Tris-HCl buffer, respectively, and then mixed in equal volumes. After incubation at 37°C for 10 min, capillary electrophoresis was performed to detect the first round of screening, and the ssDNA-B7-H3 complex was directly collected. Figure 2 A).
[0052] The aforementioned complex region was subjected to conventional symmetrical PCR amplification. An upstream primer such as SEQ ID NO.3 (AGCAGCACAGAGGTCAGATG) and a downstream primer such as SEQ ID NO.4 (TTCACGGTAGCACGCATAGG) were used. The symmetrical PCR amplification system consisted of 264.0 µL ddH2O, 132.0 µL 30.0 µM upstream primer, 132.0 µL 30.0 µM downstream primer, and 550.0 µL PCRMix enzyme. 2.0 µL of the target-nucleic acid complex (i.e., the ssDNA-B7-H3 complex) and 48.0 µL of the above mixture were mixed for amplification. The amplification conditions were: 94℃, 1 min; 94℃, 30 s; 59℃, 30 s; 72℃, 30 s; 20 cycles. DNase / RNase-free deionized water and 2×TaqPCRMastermix were purchased from Tiangen Biotech Co., Ltd. The agarose gel electrophoresis conditions were as follows: 30 mL of 0.5×TBE buffer and 0.6 g of agarose were used to prepare a 2% agarose gel, and the gel was electrophoresed at 90 V for 30 min using a Bio-Rad electrophoresis apparatus. Agarose, GeneGreen nucleic acid dye, 6×DNA Loading Buffer, and 50 bp DNA Ladder were purchased from Tiangen Biotech Co., Ltd.
[0053] (2) Alcohol precipitation and gel extraction: Collect the PCR product in two 1.5 mL centrifuge tubes (400 μL each), add 900 μL of pre-cooled anhydrous ethanol, centrifuge at 4 °C and 13000 rpm for 15 min, and discard the supernatant; add 250 μL of 70% pre-cooled anhydrous ethanol, mix well, centrifuge at 4 °C and 13000 rpm for 5 min, discard the supernatant, repeat this operation, dry the bottom precipitate, and redissolve it in 20.0 μL ddH2O. The ethanol precipitation product was subjected to agarose gel electrophoresis. The band between 50-100 bp was excised, crushed, and 500.0 μL ddH2O was added. The mixture was vortexed, followed by 500.0 μL Tris-saturated phenol. The mixture was then vortexed and centrifuged at 4°C and 13000 rpm for 15 min. The supernatant was then added to chloroform:isoamyl alcohol (24:1), vortexed, and centrifuged at 4°C and 13000 rpm for 5 min. The supernatant was then added to 20.0 μL 3M sodium acetate and 900 μL pre-cooled anhydrous ethanol and incubated overnight at -20°C. The mixture was then centrifuged at 4°C and 13000 rpm for 15 min. The precipitate was dried and reconstituted in 20.0 μL ddH2O for the next step of asymmetric PCR.
[0054] Asymmetric PCR: The procedure is the same as symmetric PCR, except that the upstream primer is replaced with a fluorescent primer (sequence identical to SEQ ID NO. 3, AGCAGCACAGAGGTCAGATG, 5' end FAM label), and the downstream primer is replaced with the same volume of ddH2O. The template is the precipitate solution obtained above. Amplification is performed for 28 rounds. Subsequent alcohol precipitation and gel extraction are the same as above; the resulting product is the secondary library for the next round of screening.
[0055] (3) 2.0 μM B7-H3 was mixed with an equal volume of the second-round secondary library solution and incubated together in a metal bath at 37 ℃ for 10 min. After incubation, the mixture contained free ssDNA that was not bound to B7-H3 and ssDNA-B7-H3 complexes that were bound to B7-H3. These were separated and analyzed by capillary electrophoresis. The results are as follows: Figure 2 As shown in B. The ssDNA-B7-H3 complex was collected and subjected to symmetrical PCR, alcohol precipitation and gel extraction, as well as asymmetric PCR, alcohol precipitation and gel extraction to obtain the secondary library for the third round of screening.
[0056] Repeat the same steps as in the second round, mixing 1.0 μM B7-H3 with an equal volume of the third round secondary library solution, and incubating together in a metal bath at 37 ℃ for 10 min. Capillary electrophoresis separation and analysis were then performed, and the results are as follows: Figure 2As shown in C. The ssDNA-B7-H3 complex was collected and subjected to symmetrical PCR, alcohol precipitation and gel extraction, as well as asymmetric PCR, alcohol precipitation and gel extraction to obtain the fourth round of screening secondary library.
[0057] (4) Determine the affinity of the initial random oligodeoxynucleotide library solution of ssDNA with the secondary library of rounds 2-4 and B7-H3, and determine whether to continue screening based on the trend of affinity change.
[0058] The affinity between B7-H3 and different secondary libraries was calculated using the NECEEM model. After mixing the fluorescently labeled ssDNA library with B7-H3, three characteristic regions were observed in the electrophoresis pattern: the peak area of free ssDNA (A1), the peak area of the B7-H3-ssDNA complex (A2), and the peak area of the dissociation region between the two (A3). The peak areas of these three regions on the electrophoresis pattern were substituted into Formula 1 using capillary electrophoresis analysis software to calculate the affinity. (Formula 1)
[0059] Wherein, [P]0 and [ssDNA]0 represent the initial concentrations of the target protein and ssDNA library, respectively.
[0060] Experimental results are as follows Figure 2 As shown in Figure D, the affinity between ssDNA and B7-H3 gradually decreased in the first to third rounds of screening, indicating that the binding between the two gradually increased as screening progressed. However, in the fourth round, the affinity did not decrease but instead increased, indicating that the sequence had been sufficiently enriched after three rounds of screening. Therefore, screening was terminated in the third round, and no further rounds of screening were conducted.
[0061] (5) The products collected in the third round were subjected to symmetrical PCR and then high-throughput sequencing.
[0062] (6) MEME (online tool: meme-suite.org) analysis was performed on the sequencing results to obtain 3 significantly enriched motifs. Considering that different motifs may correspond to different potential binding modes or structural features, in order to balance the diversity and representativeness of candidate sequences, the significance level of each sequence matching the corresponding motif was used as the screening criterion. Two representative single-stranded DNA sequences with smaller p values were selected from each motif, and finally 6 candidate aptamer sequences were determined. Figure 3 ), namely Apt2, Apt3, Apt4, Apt6, Apt631, and Apt645, with corresponding sequences as shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, respectively.
[0063] Apt2 (SEQ ID NO.5): 5'-AGCAGCACAGAGGTCAGATGTGTCTGCGCGCGTCATCCGAACACTTACATCGCTGCGACGCCTATGCGTGCTACCGTGAA-3'; Apt3 (SEQ ID NO.6): 5'-AGCAGCACAGAGGTCAGATGCCGCAGGCAGCTGCCATTAGTCTCTATCCGTGACGGTATACCTATGCGTGCTACCGTGAA-3'; Apt4 (SEQ ID NO.7): 5'-AGCAGCACAGAGGTCAGATGACGGGTATCGCGTTCTAGGTAGGCCGTCGACCGGTTATGCCCTATGCGTGCTACCGTGAA-3'; Apt6 (SEQ ID NO.8): 5'-AGCAGCACAGAGGTCAGATGCCGCAGGCAGCTGCCATTAGTCTCTATCCGTGACGGTATGCCTATGCGTGCTACCGTGAA-3'; Apt631 (SEQ ID NO.9): 5'-AGCAGCACAGAGGTCAGATGAATACAGATGCACCCGGGGGATGTTGTGCTCAAGCGTCTCCCTATGCGTGCTACCGTGAA-3'; Apt645 (SEQ ID NO.10): 5'-AGCAGCACAGAGGTCAGATGTGTCTGTGCGCGTCATCCGAACACTTACATCGCTGCGACCCTATGCGTGCTACCGTGAA-3'.
[0064] Example 3
[0065] The affinity of the six aptamer candidate sequences obtained in Example 2 was determined using surface plasmon resonance (SPR). B7-H3 was prepared using sodium acetate solution at pH 4.5. The aptamer candidate sequences were prepared using 1% PBST. B7-H3 was immobilized on the surface of a CM5 chip containing carboxymethyl dextran via amino covalent coupling. The CM5 SPR chip contains four channels, with the fourth channel serving as a reference channel and the other three as detection channels. The target / control protein was immobilized on the detection channels, while the reference channel was activated but not immobilized, and unbound sites were blocked with ethanolamine. The final signal from the detection channels was normalized to the signal from the reference channels. During detection, B7-H3 protein was first injected into the corresponding detection channel at a flow rate of 10 μL / min for 300 seconds to complete fixation. Subsequently, different concentrations of aptamer solutions (0.98 nM, 1.95 nM, 3.91 nM, 7.81 nM, 15.63 nM, 31.25 nM, 62.5 nM, 125 nM, 250 nM, and 500 nM) were injected sequentially at a flow rate of 25 μL / min. SPR signals were acquired in real time, and after fitting with the built-in software, the K0 of each sequence was obtained. D Value. Experimental results are as follows: Figure 4 As shown, the results indicate that Apt2 exhibits good affinity, and its K... D The value is 0.68 nM; Apt645 is next, at 8.9 nM.
[0066] Example 4
[0067] In this embodiment, Apt2 and Apt645, which have good affinity, were selected for sequence optimization and truncation analysis.
[0068] First, the binding mode of Apt2 and B7-H3 proteins was predicted and analyzed using the HDOCK online molecular docking platform (http: / / hdock.phys.hust.edu.cn / ). Specifically, the three-dimensional structure files of B7-H3 and Apt2 were uploaded to the HDOCK server as the receptor and ligand, respectively, and protein-nucleic acid molecular docking calculations were performed according to the server's default parameters. After docking, based on the docking scoring results output by the platform, the complex models with the highest scores and reasonable conformations were selected as candidate binding models. Further analysis was conducted on the interactions between Apt2 and B7-H3, including hydrogen bonds, electrostatic interactions, hydrophobic interactions, and spatially adjacent residues, to determine the predicted binding sites of Apt2 and B7-H3. Figure 5As shown on the left side of A. Based on the molecular docking results of Apt2 and B7-H3, key sequence regions in Apt2 that may participate in B7-H3 binding were identified. Subsequently, the secondary structures of Apt2 and its different truncated sequences were predicted and analyzed using the mFold online software (http: / / www.unafold.org / mfold / applications / dna-folding-form.php). While retaining the original core stem-loop structure of Apt2 and the predicted binding region, redundant base sequences at both ends or in non-critical regions were gradually removed, resulting in the design of multiple truncated aptamer sequences, named Apt2-Truc1, Apt2-Truc2, and Apt2-Truc3, with SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13, respectively.
[0069] Apt2-Truc1 (SEQ ID NO. 11): 5'-AGCAGCACAGAGGTCAGATGTGTCTGCGCGCGTCATCCGAACACTTACATCGCTGCGACGCCTATGCGTGCTAC-3'; Apt2-Truc2 (SEQ ID NO. 12): 5'-AGCAGCACAGAGGTCAGATGTGTCTGCGCGCGTCATCCGAACACTTACATCGCTG-3'; Apt2-Truc3 (SEQ ID NO. 13): 5'-AGCAGCACATGTGTCTGCGCGCGTCATCCGAACACTTACATCGCTG-3'.
[0070] Its secondary structure results are as follows Figure 5 As shown on the right side of A. The affinity of the three truncated sequences for B7-H3 was determined using SPR, and the affinities were: 69.7 pM, 1.1 nM, and 298 nM, respectively. Figure 5 B). The complexes of the three truncated sequences with B7-H3 were characterized by CE. Figure 5 C), where the 5' end of the sequence is marked with FAM during CE analysis.
[0071] Similarly, following the molecular docking analysis and secondary structure prediction methods for Apt2 described above, the binding sites of Apt645 and B7-H3, as well as the core secondary structure of Apt645, were analyzed. Figure 6A). While retaining the predicted binding region and core stem-loop structure of Apt645, redundant base sequences at both ends or in non-critical regions were gradually removed to design truncated aptamers Apt645-Truc1, Apt645-Truc2, and Apt645-Truc3, whose sequences are shown in SEQ ID NO.14, SEQ ID NO.1, and SEQ ID NO.15, respectively.
[0072] Apt645-Truc1 (SEQ ID NO. 14): 5'-AGCAGCACAGAGGTCAGATGTGTCTGTGCGCGTCATCCGAACACCGCTGCGACCCTATGCGGTGAA-3'; Apt645-Truc2 (SEQ ID NO.1): 5'-AGCAGCAGGTCAGATGTGTGCGCGTCATCCGAACACCGCT GCG ACCCTATGCGGTGAA-3'; Apt645-Truc3 (SEQ ID NO. 15): 5'-AGCAGCAGGTCAGATGTGTGCGCGAACACCGCTGCGACCCTATGCGGTGAA-3'.
[0073] The affinity of three truncated sequences for B7-H3 was determined using SPR, and the affinities were: not detected, 20.6 pM, and 0.13 nM, respectively. The results are as follows: Figure 6 B. The complexes of the three truncated sequences with B7-H3 were characterized by CE (e.g., Figure 6 C).
[0074] Apt645-Truc2 (SEQ ID NO.1), which has the best affinity, was selected for subsequent verification.
[0075] Example 5
[0076] Cell binding assays were performed using the aptamer sequence Apt654-Truc2, which exhibited the best affinity. SK-N-AS cells were seeded in glass-bottomed culture dishes or 24-well plates pre-inserted with sterile coverslips and cultured at 37°C in a 5% CO2 incubator until cell adhesion reached 60%–80%. After discarding the culture medium, the cells were washed 2–3 times with PBS buffer and blocked with blocking buffer at room temperature for 30 min. Subsequently, different concentrations of Cy5-labeled aptamer (SEQ ID NO.1): 5'-Cy5-AGCAGCAG GTCAGATGTGTGCGCGTCATCCGAACACCGCTGCGACCCTAT GCGGTGAA-3' (0.31 µM, 0.63 µM, 1.25 µM, 2.5 µM, 5.0 µM) working solution were added, and the cells were incubated with the aptamer at room temperature or 4°C in the dark for 60 min. After incubation, cells were washed three times with PBS buffer to remove unbound aptamers; then fixed with 4% paraformaldehyde for 10 min, and the nuclei were counterstained with DAPI. Finally, the treated cells were observed and images were acquired under a fluorescence microscope. Experimental results ( Figure 7 The results indicate that Apt654-Truc2 possesses stable cell-binding ability and exhibits certain cellular uptake characteristics. This suggests that it can be used for the identification, detection, or imaging of B7-H3 positive cells, and has the potential to be developed into a B7-H3-targeting molecular probe.
Claims
1. A single-stranded DNA aptamer targeting B7-H3, the nucleotide sequence of which is shown in SEQ ID NO.
1.
2. A method for screening single-stranded DNA aptamers targeting B7-H3, characterized in that, It includes the following steps: S1. Mix the fluorescently labeled initial random oligodeoxynucleotide library solution with B7-H3 protein in equal volume and incubate together. Separate and analyze the mixture by capillary electrophoresis and collect the ssDNA-B7-H3 complex. S2. Design upstream and downstream primers for PCR amplification of the ssDNA sequence in the complex. Use the ssDNA-B7-H3 complex collected in step S1 as a template for symmetrical PCR. Collect the PCR products and detect their length and purity by agarose gel electrophoresis, and then perform gel extraction and recovery. Perform asymmetric PCR on the gel-recovered products. The asymmetric PCR amplification is the same as that of symmetrical PCR, except that the upstream primer is replaced with a fluorescently labeled upstream primer and the downstream primer is replaced with the same volume of sterile water for PCR amplification. Perform gel extraction and recovery to obtain the products, which are the secondary library for the next round of screening. S3. In the first round of screening, the initial 400 nM random oligodeoxynucleotide library and B7-H3 sample were incubated under the same conditions as in step S1 and then separated by capillary electrophoresis, and the complex was collected. The complex was amplified and purified by PCR in step S2 and then used for the second and third rounds of screening. During the second and third rounds of screening, the concentration of B7-H3 was gradually reduced to carry out a progressive convergent screening strategy. The third round of ssDNA-B7-H3 protein complex was collected and subjected to symmetric PCR and asymmetric PCR, alcohol precipitation and gel extraction to obtain the secondary library for the fourth round of screening. S4. The affinity of the initial random oligodeoxynucleotide library and the secondary libraries from the second to fourth rounds was measured with B7-H3. The screening was then determined based on the affinity results. The final results showed that after three rounds of screening, the affinity of the fourth round secondary library with B7-H3 no longer decreased, indicating that the screening had basically reached enrichment equilibrium. Continuing the screening would not be able to obtain aptamer sequences with higher affinity, so subsequent screening was stopped. The products collected in the third round were amplified by symmetric PCR and then subjected to high-throughput sequencing. MEME analysis was performed on the sequencing results to obtain significantly enriched motifs. Based on the significance level of each sequence matching the corresponding motif, two representative single-stranded DNA sequences with smaller p values were selected from each motif as candidate aptamer sequences. S5. Affinity determination of candidate aptamer sequences; sequence optimization and truncation of candidate aptamer sequences with better affinity; selection of sequences with better affinity as single-stranded DNA aptamers targeting B7-H3.
3. The screening method according to claim 2, characterized in that, In step S1, the sequence of the random oligodeoxynucleotide library solution is shown in SEQ ID NO.2: 5'-FAM-AGCAGCACAGAGGTCAGATG-(N40)-CCTATGCGTGCTACCGTGAA-3', where N40 is a random sequence region composed of 40 random deoxynucleotides A, T, C, and G, with each base position randomly distributed to construct the diversity of the library.
4. The screening method according to claim 2, characterized in that, In step S1, the buffer used for the random oligodeoxynucleotide library solution and the B7-H3 protein was a Tris-HCl buffer with a pH of 7.5 and a concentration of 10 mM. The concentration of the random oligodeoxynucleotide library solution was 400 nM ssDNA, and the concentration of the B7-H3 protein solution was 2.0 μM. The incubation temperature was 37°C, and the incubation time was 10 min.
5. The screening method according to claim 2, characterized in that, In step S1, the capillary electrophoresis is performed with a pressure injection of 0.5 psi for 8 s, and CE separation analysis is carried out under the conditions of a high voltage of 20 kV and a temperature of 25 °C in the fused silica capillary.
6. The screening method according to claim 2, characterized in that, In step S2, the primers used in the symmetrical PCR amplification reaction system are shown in SEQ ID NO.3 and SEQ ID NO.4; the amplification reaction program is 94℃ for 1 min; 94℃ for 30 s, 59℃ for 30 s, and 72℃ for 30 s for 20 cycles; the asymmetric PCR steps are the same as symmetrical PCR, the upstream primer is labeled with FAM and the sequence is the same as symmetrical PCR; the downstream primer is replaced with the same volume of sterile water, the template is the above symmetrical PCR product, and 28 cycles of amplification are performed.
7. The screening method according to claim 2, characterized in that, In step S4, the formula for calculating affinity is: Where A1 is the peak area of free ssDNA, A2 is the peak area of the B7-H3-ssDNA complex, A3 is the peak area of the dissociation region between the two, and [P]0 and [ssDNA]0 represent the final concentrations of the target protein B7-H3 and the ssDNA library, respectively. The peak areas are obtained by integrating the electrophoretic patterns using capillary electrophoresis analysis software.
8. The screening method according to claim 2, characterized in that, In step S5, affinity is determined using the surface plasmon resonance method.
9. The screening method according to claim 2, characterized in that, In step S5, sequence optimization and truncation are performed by analyzing the binding sites of aptamer candidate sequences and B7-H3 through molecular docking. Based on the interaction results between the aptamer candidate sequences and B7-H3 in the molecular docking results, redundant sequences are truncated without changing the secondary structure of the aptamer to obtain truncated sequences. The affinity is determined by the surface plasmon resonance method, and aptamer sequences with higher affinity are selected.