A fertility-related protein taRfd1 dependent on cytoplasm of aegilops tauschii and application thereof

Abstract

This invention discloses a fertility-related protein, TaRfd1, that is dependent on the cytoplasm of *Aegilops spp.* and its applications. This invention utilizes CRISPR / Cas9 technology to construct... TaRfd1 Genetically edited wheat, and through experiments, it was found that wheat lacking the cytoplasm of *Aegilops spp.* TaRfd1 Gene-edited wheat exhibits fertility; while introducing gene-edited wheat into the cytoplasm of *Aegilops spp.* TaRfd1 Gene-edited wheat with a background of Aegilops cytoplasm TaRfd1 Gene-edited plants exhibited sterility. This invention is the first to verify the role of TaRfd1 in male sterility and discover that it depends on the cytoplasm of *Aegilops spp.* to affect fertility restoration ability, clarifying its molecular mechanism in male sterility restoration. This not only provides direct evidence for theoretical research on the wheat CMS / Rf system but also opens up new avenues for creating novel wheat male-sterile lines and restorer lines, and accelerating the process of wheat hybridization breeding.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a fertility-related protein TaRfd1 that depends on the cytoplasm of Aegilops spp. and its applications. Background Technology

[0002] Heterosis utilization is a crucial pathway to improving wheat yield and quality, and cytoplasmic male sterility (CMS) is a core genetic tool for achieving this. As a self-pollinating crop, wheat hybrid production has long been hampered by technical bottlenecks such as the difficulty in breeding sterile lines and the low efficiency of restorer line screening. Therefore, elucidating the molecular mechanism of fertility restoration in wheat CMS and identifying key restorer genes has significant theoretical and practical value for promoting the industrial application of hybrid wheat.

[0003] Currently, various types of cytoplasmic male sterile lines have been reported in wheat, including T-type, K-type, V-type, and AL-type. These sterile lines are usually caused by abnormal pollen development due to chimeric genes in the mitochondrial genome, and fertility restoration depends on restorer-of-fertility (Rf) genes in nuclear loci. For example, in the K-type CMS system, the fertility restorer gene Rfk1 is located on chromosome 1BS; in the T-type CMS, the fertility restorer genes Rf1 and Rf3 restore fertility by inhibiting the T-CMS system.

[0004] Pectin esterases are key enzymes involved in the modification of cell wall pectin, playing an important role in pollen development, pollen wall formation, and pollen tube elongation. TaRfd1 protein is a pectin esterase highly expressed in fertile anthers. However, current functional studies of TaRfd1 protein remain at the level of expression analysis and genetic localization; no studies have reported on the functional analysis of TaRfd1 protein.

[0005] CRISPR / Cas9 gene editing technology, as a reverse genetics research tool that has emerged in recent years, can achieve precise knockout at specific genomic sites, providing an efficient and reliable technical means for gene function analysis. Summary of the Invention

[0006] One object of the present invention is to provide a method for preparing a male-sterile wheat line.

[0007] The method for preparing a male-sterile wheat line provided by this invention includes the following steps: knocking out male-sterile lines in wheat. TaRfd1 Genes, obtained TaRfd1 Gene knockout wheat, then with the described TaRfd1Gene knockout wheat was used as the male parent, and Aegilops cytoplasmic male-sterile wheat was used as the female parent in a hybridization process, allowing Aegilops cytoplasm to be introduced into the aforementioned... TaRfd1 In gene-knockout wheat, hybrid F1 plants with a *Aegilops pekinensis* cytoplasmic background were obtained; these hybrid F1 plants are male-sterile wheat lines. TaRfd1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0008] In the above method, the male-sterile wheat containing Aegilops cytoplasm is male-sterile wheat.

[0009] In some embodiments, the Aegilops cytoplasmic male sterile wheat is Aegilops cytoplasmic male sterile wheat Ju706A.

[0010] In the above method, the TaRfd1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0011] In the above method, the TaRfd1 The method for preparing gene knockout wheat includes the following steps: [The text abruptly shifts to a different topic] ...in the wheat genome... TaRfd1 Gene editing to make the wheat genome TaRfd1 Gene mutations lead to loss of function of the TaRfd1 protein.

[0012] Furthermore, the CRISPR / Cas9 system was used to analyze the wheat genome. TaRfd1 Gene editing; the CRISPR / Cas9 system includes targeted... TaRfd1 The gene's sgRNA and Cas9 protein.

[0013] Furthermore, the target sequence of the sgRNA is shown in SEQ ID NO.3.

[0014] Furthermore, the aforementioned TaRfd1 The gene mutation occurs in any of the following ways: M1) TaRfd1 A gene segment is deleted, and the deleted segment is located at positions 119-141 of SEQ ID NO.1; M2) TaRfd1 The gene has a base deletion, and the deleted base is located at position 137 of SEQ ID NO.1; M3) TaRfd1 The gene undergoes an insertion of base A, with the insertion position of base A located between positions 136 and 137 of SEQ ID NO.1.

[0015] In some implementations, the TaRfd1 The gene undergoes a homozygous mutation.

[0016] In some implementations, the use of the CRISPR / Cas9 system to analyze wheat genome... TaRfd1 The gene editing method involves introducing a CRISPR / Cas9 gene editing vector containing a DNA molecule that transcribes the sgRNA and the gene encoding the Cas9 protein into wheat.

[0017] In some preferred embodiments, the CRISPR / Cas9 gene editing vector containing the DNA molecule that transcribes the sgRNA and the gene encoding the Cas9 protein is the pWMB110-SpCas9-TaRfd1 recombinant plasmid described in the examples below.

[0018] In the above method, the hybrid F1 generation plants exhibit any of the following characteristics: m1) The ear cannot produce grains; m2) The anthers are small and do not dehisce; (m3) The anthers could not be completely stained by I2-KI; m4) The anther epidermis is disordered and irregular; m5) The Ubsites in the inner epidermis of the anthers are sparsely arranged; (m6) Mature pollen grains are small and wrinkled.

[0019] In the above method, the wheat includes any type containing TaRfd1 Wheat germplasm resources, varieties, strains, or individual plants containing genes.

[0020] In some implementations, the wheat variety is Fielder.

[0021] Another object of the present invention is to provide any of the following applications: N1) Knockout TaRfd1 Application of genetic material and Aegilops cytoplasmic male-sterile wheat in the breeding of male-sterile wheat lines; N2) Knockout TaRfd1 Application of genetic material and male-sterile wheat cytoplasm from Aegilops pekinensis in the preparation of products for breeding male-sterile wheat lines; N3) Knockout TaRfd1 Application of genetic material and male-sterile wheat cytoplasm from Aegilops pekinensis in wheat hybridization breeding; N4) Knockout TaRfd1 Application of genetic material and male-sterile wheat cytoplasm from Aegilops pekinensis in the preparation of wheat hybrid breeding products; N5) The application of the above-mentioned method for preparing male-sterile wheat lines in wheat hybridization breeding.

[0022] In the above applications, the knockout TaRfd1Genetic material can be produced in any way that prevents the host cell from producing it. TaRfd1 Functional protein products of genes can be produced by means of removing all or part of the coding gene sequence, introducing mutations to prevent the production of functional proteins, removing or altering regulatory components (e.g., promoter editing) to prevent the coding gene sequence from being transcribed, or preventing translation by binding to mRNA.

[0023] In some implementations, the knockout TaRfd1 Gene material can be knocked out TaRfd1 A CRISPR / Cas9 gene editing vector. The CRISPR / Cas9 gene editing vector expresses targeted genes. TaRfd1 The gene's sgRNA and Cas9 protein.

[0024] In some preferred embodiments, the target sequence of the sgRNA is shown in SEQ ID NO.3.

[0025] In the above application, the male-sterile wheat containing Aegilops cytoplasm is male-sterile wheat.

[0026] In some embodiments, the Aegilops cytoplasmic male sterile wheat is Aegilops cytoplasmic male sterile wheat Ju706A.

[0027] The final objective of this invention is to provide a method for wheat hybridization breeding.

[0028] The wheat hybridization breeding method provided by the present invention includes the step of hybridization using a male-sterile wheat line prepared according to the above method as the female parent.

[0029] This invention utilizes CRISPR / Cas9 technology to construct TaRfd1 Gene-edited wheat, through experiments, revealed that it lacks the cytoplasm of *Aegilops pekinensis*. TaRfd1 Gene-edited wheat ears all produced normal grains and were completely stained with I2-KI, indicating fertility; while... TaRfd1Gene-edited wheat was crossed with the Aegilops cytoplasmic male sterile line Ju706A. Gene-edited plants with an Aegilops cytoplasm background, resulting from the introduction of Aegilops cytoplasm into TaRfd1-Fielder-KO, all lost fertility, specifically exhibiting inability to set seeds, failure of anther dehiscence, and incomplete staining by I2-KI. This invention is the first to verify the role of the TaRfd1 protein in male sterility and reveals that it affects fertility restoration capacity in dependence on Aegilops cytoplasm, clarifying its molecular mechanism in male sterility restoration. This not only provides direct evidence for theoretical research on the wheat CMS / Rf system but also opens new avenues for creating novel wheat male sterile lines and restorer lines, accelerating the process of wheat hybrid breeding, and possesses significant scientific value and application prospects.

[0030] The beneficial effects of this invention are: 1. This invention provides a method for preparing a male-sterile wheat line. Given the high seed production costs associated with wheat as an allohexaploid and its self-pollination, this invention will have a wide range of applications: 1) It eliminates the need for emasculation, solving the problems of high cost and long cycle associated with traditional cytoplasmic male-sterile systems, shortening the breeding time from many years to less than one year. 2) Utilizing male-sterile mutants for breeding completely avoids the problem of self-crossing from the maternal parent introducing hybrids, significantly improving the genetic purity of hybrids. 3) Gene-edited male-sterile mutant technology, as a core component of third-generation hybrid breeding, helps accelerate the selection and application of superior hybrid varieties, enhancing the core competitiveness of China's seed industry.

[0031] 2. This invention is the first to utilize CRISPR / Cas9 gene editing technology to... TaRfd1 Functional analysis of the gene with and without the presence of Aegilops cytoplasm overcomes the limitation of traditional genetic mapping studies in providing direct functional evidence, offering the most direct genetic evidence to confirm TaRfd1 as a key gene for restoring cytoplasmic male sterility in Aegilops cytoplasm. This invention provides core theoretical guidance and important genetic tools for the optimization and upgrading of the three-line hybrid wheat breeding system. By achieving precise design and efficient breeding of restorer lines, the breeding cycle can be significantly shortened, the breeding efficiency of hybrid wheat varieties can be improved, and substantial scientific and technological contributions can be made to the sustainable development of my country's wheat industry and the implementation of the national food security strategy. Attached Figure Description

[0032] Figure 1 for TaRfd1 Gene-edited wheat lines TaRfd1-Fielder-KO-1, TaRfd1-Fielder-KO-2, and TaRfd1-Fielder-KO-3 TaRfd1 The status of gene editing.

[0033] Figure 2 for TaRfd1 Fertility phenotype observation of gene-edited wheat lines TaRfd1-Fielder-KO-1, TaRfd1-Fielder-KO-2, and TaRfd1-Fielder-KO-3. AD represents spikelet grain filling; EH represents I2-KI staining of pollen. WT represents the control wheat variety Fielder, and #1 indicates... TaRfd1 Gene-edited wheat line TaRfd1-Fielder-KO-1, #2 indicates TaRfd1 Gene-edited wheat line TaRfd1-Fielder-KO-2, #3 indicates TaRfd1 Gene-edited wheat line TaRfd1-Fielder-KO-3.

[0034] Figure 3 Fertility phenotype observation of TaRfd1-Ju / Fd-KO edited plants. AD represents spikelet setting; EH represents florets; IL represents I2-KI staining of pollen. WT represents control plants produced by crossing the wheat variety Fielder with the cytoplasmic male-sterile wheat Ju706A (Aegilops spp.), and #1 indicates... TaRfd1 TaRfd1-Ju / Fd-KO plants were produced by crossing the gene-edited wheat line TaRfd1-Fielder-KO-1 with the Aegilops cytoplasmic male sterile line Ju706A. #2 indicates TaRfd1 The TaRfd1-Ju / Fd-KO plant, produced by crossing the gene-edited wheat line TaRfd1-Fielder-KO-2 with the Aegilops cytoplasmic male sterile line Ju706A, is indicated by #3. TaRfd1 TaRfd1-Ju / Fd-KO plants were produced by crossing the gene-edited wheat line TaRfd1-Fielder-KO-3 with the cytoplasmic male sterile line Ju706A of Aegilops spp.

[0035] Figure 4 Scanning electron microscopy observation of plants edited with TaRfd1-Ju / Fd-KO. A and E are anthers; B and F are the outer epidermis of anthers; C and G are the inner epidermis of anthers; D and H are mature pollen grains. Among them, WT is the control plant produced by crossing the wheat variety Fielder with the cytoplasmic male-sterile wheat Ju706A of Aegilops pekinensis. Detailed Implementation

[0036] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0037] Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Unless otherwise specified, the experimental methods in the following embodiments are performed at least three times.

[0038] The pWMB110-SpCas9 vector used in the following examples is described in the literature "Liu H, Wang K, Jia Z, Gong Q, Lin Z, Du L, Pei X, Ye X. Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium-mediated CRISPR system. J Exp Bot. 2020;71(4):1337-1349. doi: 10.1093 / jxb / erz529."

[0039] The wheat Fielder described in the following examples is described in the literature "Sato K, Abe F, Mascher M, Haberer G, Gundlach H, Spannagl M, Shirasawa K, Isobe S. Chromosome-scale genome assembly of the transformation-amenable common wheat cultivar 'Fielder'. DNARes. 2021;28(3):dsab008. doi: 10.1093 / dnares / dsab008.".

[0040] The wheat sterile line Ju706A described in the following examples is described in the literature “Niu F, Bu Y, Yang X, Wu Y, He M, Zhang L, Song X. Rfd1, a restorer to the Aegilops juvenalis cytoplasm,functions in fertility restoration of wheat cytoplasmic male sterility. J ExpBot. 2023;74(5):1432-1447. doi: 10.1093 / jxb / erac484. PMID: 36504346.”

[0041] The Tau3 plasmid in the following examples is described in the literature "Shandong University. Application of wheat TaLNUE protein in regulating plant tolerance to low nitrogen stress: 202511476168.4 [P]. 2025-12-23."

[0042] Experimental Example 1 TaRfd1 Preparation of gene-edited wheat I. Construction of gene editing vectors 1. Targeted TaRfd1 Design of sgRNA in genes Through the website CRISPRdirect (http: / / crispr.dbcls.jp / ) TaRfd1 The coding region of the gene (SEQ ID NO.1) was searched for a suitable target. A 20bp sequence fragment was found before the PAM structure and set as the target sequence. The final selected sgRNA target sequence is as follows: AGCCATCAAGGCAGGTCTCCTGG (SEQ ID NO.3).

[0043] 2. Verification of carrier connection and transformation 1) One round of PCR amplification Using the Tau3 plasmid as a template, a single round of PCR amplification was performed using the specific primer pair F / R and the universal primer pair UF / gR. The primer sequences are as follows: Specific primer F: 5′-AGACGTGGCTCACCTCCGCGCTCACGTACGTTTTAGAGCTAGAAAT-3′.

[0044] Specific primer R: 5′-GAGGCGTCGGTCGTGGTGTTGGCGAGCTTCTTGGTGCCGCGCCTCC-3′.

[0045] Universal primer UF: 5′-CTCCGTTTTACCTGTGGAATCG-3′.

[0046] Universal primer gR: 5′-CGGAGGAAAATTCCATCCAC-3′.

[0047] The total volume of the first-round PCR amplification system is 20 μL, specifically as follows: 10×KOD buffer 2 μL; dNTP 2 μL; MgSO4 1.2 μL; specific primer F 0.5 μL; specific primer R 0.5 μL; universal primer UF 0.5 μL; universal primer gR 0.5 μL; Tau3 plasmid 1 μL; KOD enzyme 0.5 μL; ddH2O 11.3 μL.

[0048] The PCR program settings for one round were as follows: pre-denaturation program was set to 95℃ for 5 min; denaturation program was set to 95℃ for 30 sec; annealing program was set to 60℃ for 30 sec; extension program was set to 72℃ for 1 min; storage was at 4℃.

[0049] 2) Second round of PCR amplification Using the first-round PCR product as a template, a second round of PCR amplification was performed using primer pair ZWHind-BU1F / ZWHind-BU1R.

[0050] The total volume of the second-round PCR amplification system is 20 μL, specifically as follows: 10×KOD buffer 2 μL; dNTP 2 μL; MgSO4 1.2 μL; first-round product 2 μL; ZWHind-BU1F 1 μL; ZWHind-BU1R 1 μL; KOD enzyme 0.5 μL; ddH2O 10.3 μL.

[0051] The second-round PCR products were purified and recovered using a DNA purification and concentration kit.

[0052] 3) Connection The recovered second-round PCR products were ligated with the pWMB110-SpCas9 plasmid digested with HindIII, and the ligation product was transformed into DH5α competent cells. After cloning on LB (Kan) plates, single clones were selected for colony identification by PCR and sequencing. The plasmid with correct sequencing was named pWMB110-SpCas9-TaRfd1.

[0053] II. Transformation of gene editing vectors in wheat Fielder Following the method described in the literature "Wang K, Liu H, Du L, Ye X. Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated co-transformation strategy in commercial Chinese wheat varieties. Plant Biotechnol J. 2017;15(5):614-623. doi: 10.1111 / pbi.12660.", the recombinant plasmid pWMB110-SpCas9-TaRfd1 was transferred into wheat Fielder to obtain T0 generation transgenic wheat. The specific steps are as follows: Wheat (Fielder) plants grown in the growth chamber were marked at the flowering stage and harvested 14 days after flowering. Under aseptic conditions, immature wheat grains were carefully collected, then surface-sterilized with 70% ethanol for 1 minute, followed by treatment with 5% sodium hypochlorite for 15 minutes, and finally rinsed 5 times with sterile water. Under aseptic conditions, immature wheat embryos were carefully extracted from sterilized grains under a stereomicroscope and immersed for 5 minutes in WLS-inf medium containing Agrobacterium strain C58C1 with the pWMB110-SpCas9-TaRfd1 plasmid. They were then co-cultured on WLS-AS medium for 2 days, embryo shield side up, at 25°C in the dark. After co-culture, the hypocotyl was removed with a scalpel, and the scutellum was transferred to a culture dish containing WLS-Res medium. Five days later, the tissue was transferred to WLS-P5 callus induction medium. Two weeks later, the callus culture was vertically cut in half and evenly placed on WLS-P10 medium, and cultured in the dark for 3 weeks. Subsequently, the embryogenic callus was placed on LSZ-P5 medium for differentiation at 25°C and 100 μmol / m² / s light. Regenerated seedlings were transferred to cups containing MSF-P5 medium for elongation and root formation. After the seedlings have developed a good root system, they are transplanted into pots and cultured in a growth chamber at 25℃ and 300μmol / m² / s light conditions to obtain T0 generation transgenic wheat.

[0054] three, TaRfd1 Identification and Acquisition of Gene-Edited Wheat 1. Identification of positive transgenic wheat Using the genomic DNA of T0 generation transgenic wheat as a template, PCR identification was performed using specific primers TaU3-F (5′-TATGGAATCGGCAGCAAAGG-3′) and CeHind-R (5′-AAGGCGGGAAACGACAATCTG-3′). T0 generation transgenic wheat with approximately 800 bp amplified by PCR was identified as T0 generation positive transgenic wheat. Self-pollination of the T0 generation positive transgenic wheat yielded T1 generation homozygous positive transgenic wheat.

[0055] 2. TaRfd1 Identification of gene-edited wheat Using genomic DNA from T1 generation homozygous positive transgenic wheat as a template, PCR amplification was performed using specific primers TaRfd1-F (5′-ATGCTCCACTACGCCATCGA-3′) and TaRfd1-R (5′-TCAGTGTGGGCGGCCTGCT-3′), and the amplified products were sequenced to obtain... TaRfd1 Gene-edited wheat homozygous lines. Sequencing yielded three gene-edited homozygous lines with TaRfd1 knockout individually (TaRfd1-Fielder-KO-1, TaRfd1-Fielder-KO-2, and TaRfd1-Fielder-KO-3).

[0056] TaRfd1 The difference between the gene-edited wheat TaRfd1-Fielder-KO-1 and Fielder genome sequences lies in the deletion of a segment in the gene encoding the TaRfd1 protein (Sequence 1). This deleted segment is located at positions 119-141 of Sequence 1, resulting in... TaRfd1 Gene knockout.

[0057] TaRfd1 The difference between the gene-edited wheat TaRfd1-Fielder-KO-2 and Fielder genome sequences lies in the deletion of a base in the gene encoding the TaRfd1 protein (Sequence 1). This deleted base is located at position 137 of Sequence 1, resulting in... TaRfd1 Gene knockout.

[0058] TaRfd1 The difference between the gene-edited wheat TaRfd1-Fielder-KO-3 and Fielder genome sequences lies in the insertion of a base A in the gene encoding the TaRfd1 protein (sequence 1). This insertion occurs between positions 136 and 137 of sequence 1, resulting in... TaRfd1 Gene knockout.

[0059] The above TaRfd1 Gene-edited wheat TaRfd1A diagram illustrating gene editing is shown below. Figure 1 As shown.

[0060] Example 2 TaRfd1 Fertility phenotype detection of gene-edited wheat Each TaRfd1 Gene-edited wheat lines TaRfd1-Fielder-KO-1, TaRfd1-Fielder-KO-2, and TaRfd1-Fielder-KO-3, along with wild-type wheat Fielder (WT), were field-grown, and pollen fertility and seed setting were observed in the absence of Aegilops cytoplasm.

[0061] The results showed that wild-type wheat Fielder (WT) and three varieties lacking Aegilops cytoplasm... TaRfd1 All ears of the gene-edited wheat line TaRfd1-Fielder-KO had normal fertilization. Figure 2 AD) and all of them could be completely stained by I2-KI ( Figure 2 (EH), all showed fertility.

[0062] Experiment Example 3 TaRfd1 Hybridization of gene-edited wheat with the cytoplasmic male sterile line Ju706A of Aegilops spp. and fertility phenotype detection of the hybrid offspring The TaRfd1-Fielder-KO line was crossed with the Aegilops cytoplasmic male sterile line Ju706A, and Aegilops cytoplasm was introduced into TaRfd1-Fielder-KO to produce gene-edited plants with an Aegilops cytoplasmic background (TaRfd1-Ju / Fd-KO). The specific steps are as follows: The Aegilops cytoplasmic male sterile line Ju706A (as the female parent) and the line prepared in Example 1 were... TaRfd1Gene-edited wheat lines TaRfd1-Fielder-KO-1, TaRfd1-Fielder-KO-2, and TaRfd1-Fielder-KO-3 were planted in experimental fields in designated areas. Before heading, individual plants of the *Aegilops pekinensis* cytoplasmic male sterile line Ju706A were self-pollinated in bags to determine the completeness of their sterility; individual plants of the male parent TaRfd1-Fielder-KO were also self-pollinated in bags to ensure homozygosity. At flowering, robust plants of the *Aegilops pekinensis* cytoplasmic male sterile line Ju706A with complete sterility, good stigma exposure, and vigorous growth were selected as female parents. One to three days before flowering, spikelets from the upper part of the female parent's spike were selected, and about one-third of the upper part of the glumes was cut off to expose the stigma, and then the spikelets were re-bagged. Simultaneously, pollen from the newly opened male parent (TaRfd1-Fielder-KO) was collected and transferred to the stigma of the female parent, and then the spikelets were immediately isolated by bagging. After maturity, wheat seeds of the TaRfd1-Ju / Fd-KO variety were obtained. In the autumn of the following year, these seeds were planted in an experimental field to obtain TaRfd1-Ju / Fd-KO plants, which were then subjected to phenotypic identification. Simultaneously, wild-type wheat Fielder was crossed with the cytoplasmic male sterile line Ju706A of Aegilops pekinensis. Plants with a background of Aegilops pekinensis cytoplasm produced by introducing Aegilops pekinensis cytoplasm into wild-type wheat Fielder were used as control plants (WT).

[0063] The results showed that TaRfd1-Ju / Fd-KO plants containing Aegilops cytoplasm all lost their fertility, specifically manifested as the inability of the panicles to set seeds. Figure 3 BD), anthers do not split ( Figure 3 FH) and cannot be completely stained by I2-KI ( Figure 3 JL), while the control plant (WT) had normal ear formation ( Figure 3 A) Anther dehiscent ( Figure 3 E) and can be completely stained by I2-KI ( Figure 3 I). The above results indicate that TaRfd1 Genes exert their fertility regulation function in a way that depends on the cytoplasm of Aegilops pekinensis.

[0064] Example 4: Analysis of anther and pollen development characteristics of TaRfd1-Ju / Fd-KO plants Trinuclear anthers were collected from the control plant (WT) and TaRfd1-Ju / Fd-KO plant prepared in Example 3, and their anther and pollen development characteristics were observed by scanning electron microscopy.

[0065] The results showed that, compared with the control plant (WT), the TaRfd1-Ju / Fd-KO plant had smaller and indehiscent anthers (A, E), disordered and irregular anther epidermis (B, F), sparse arrangement of Ubsite bodies in the anther epidermis (C, G), and small and wrinkled mature pollen grains (D, H), exhibiting typical characteristics of male sterility.

[0066] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A method for preparing a male-sterile wheat line, comprising the following steps: knocking out male-sterile lines in wheat. TaRfd1 Genes, obtained TaRfd1 Gene knockout wheat, then with the described TaRfd1 Gene knockout wheat was used as the male parent, and Aegilops cytoplasmic male-sterile wheat was used as the female parent in a hybridization process, allowing Aegilops cytoplasm to be introduced into the aforementioned... TaRfd1 In gene-knockout wheat, hybrid F1 plants with a *Aegilops pekinensis* cytoplasmic background were obtained; these hybrid F1 plants are male-sterile wheat lines. TaRfd1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

2. The method according to claim 1, characterized in that: The cytoplasmic male sterile wheat variety mentioned is *Aegilops pekinensis* cytoplasmic male sterile wheat Ju706A.

3. The method according to claim 1 or 2, characterized in that: The TaRfd1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. The method according to any one of claims 1-3, characterized in that: The TaRfd1 The method for preparing gene knockout wheat includes the following steps: [The text abruptly shifts to a different topic] ...in the wheat genome... TaRfd1 Gene editing to make the wheat genome TaRfd1 Gene mutations lead to loss of function of the TaRfd1 protein.

5. The method according to any one of claims 1-4, characterized in that: Using the CRISPR / Cas9 system to analyze wheat genome TaRfd1 Gene editing; the CRISPR / Cas9 system includes targeted... TaRfd1 The gene's sgRNA and Cas9 protein.

6. The method according to claim 5, characterized in that: The target sequence of the sgRNA is shown in SEQ ID NO.

3.

7. The method according to any one of claims 1-6, characterized in that: The TaRfd1 The gene mutation occurs in any of the following ways: M1) TaRfd1 A gene segment is deleted, and the deleted segment is located at positions 119-141 of SEQ ID NO.1; M2) TaRfd1 The gene has a base deletion, and the deleted base is located at position 137 of SEQ ID NO.1; M3) TaRfd1 The gene undergoes an insertion of base A, with the insertion position of base A located between positions 136 and 137 of SEQ ID NO.

1.

8. Any of the following applications: N1) Knockout TaRfd1 Application of genetic material and Aegilops cytoplasmic male-sterile wheat in the breeding of male-sterile wheat lines; N2) Knockout TaRfd1 Application of genetic material and male-sterile wheat cytoplasm from Aegilops pekinensis in the preparation of products for breeding male-sterile wheat lines; N3) Knockout TaRfd1 Application of genetic material and male-sterile wheat cytoplasm from Aegilops pekinensis in wheat hybridization breeding; N4) Knockout TaRfd1 Application of genetic material and male-sterile wheat cytoplasm from Aegilops pekinensis in the preparation of wheat hybrid breeding products; N5) The application of the method described in any one of claims 1-7 in wheat hybridization breeding.

9. The application according to claim 8, characterized in that: The cytoplasmic male sterile wheat variety mentioned is *Aegilops pekinensis* cytoplasmic male sterile wheat Ju706A.

10. A method for wheat hybridization breeding, comprising the step of hybridization using a male-sterile wheat line prepared according to any one of claims 1-7 as the female parent.

Images