Method for constructing heart failure model by knocking down cardiogenic clu protein and application thereof

Abstract

The application provides a method for constructing a heart failure model by knocking down cardiogenic Clu protein and application thereof, and comprises the following steps: knocking down a Clu protein gene of an animal model by using an RNAi carrier with an interference sequence, wherein the interference sequence is shown as SEQ ID NO. 1. An RNAi carrier for the target Clu protein is synthesized, a recombinant plasmid is constructed according to the RNAi carrier, and the recombinant plasmid is packaged in a virus. The virus is introduced into the animal model through tail vein injection, and after normal feeding, a heart failure model of the animal is obtained by successfully inducing heart failure. According to the method, the heart failure phenotype can be induced without high-intensity stimulation (such as long-term ischemia or high-dose drugs), and the acute mortality rate is reduced.

Description

Technical Field

[0001] This invention relates to the field of animal model technology, specifically to a method for constructing a heart failure model by knocking down cardiac-derived Clu protein and its application. Background Technology

[0002] Heart failure (HF) is the end stage of various cardiac diseases, characterized by impaired systolic and / or diastolic function, leading to the heart's inability to meet the body's metabolic demands. Constructing HF models can help study the pathogenesis of HF, screen potential therapeutic drugs, and evaluate the effectiveness of treatments. Currently, the core methods for constructing HF models can be divided into four main categories: surgical induction, drug induction, gene editing, and combined models. Each method has its own advantages and disadvantages. While these methods are effective in simulating the pathological process of HF, they also have drawbacks. In particular, many methods are highly stimulating to animals, easily causing acute death. Therefore, a gentler model construction method is needed to reduce acute mortality. Summary of the Invention

[0003] The purpose of this invention is to provide a method for constructing a heart failure model by knocking down cardiogenic Clu protein and its application, in order to improve the aforementioned problems. To achieve the above objective, the technical solution adopted by this invention is as follows:

[0004] In one aspect, this application provides a method for constructing a heart failure model by knocking down cardiac-derived Clu protein, comprising: knocking down the cardiac-derived Clu protein gene in an animal model.

[0005] Optionally, gene knockdown may be performed using an RNAi vector with an interfering sequence, as shown in SEQ ID NO.1.

[0006] Optionally, this includes: synthesizing an RNAi vector targeting the Clu protein, constructing a recombinant plasmid based on the RNAi vector, and packaging the recombinant plasmid into a virus.

[0007] Optionally, the sequence of the recombinant plasmid is shown in SEQ ID NO.2.

[0008] Optionally, this includes: introducing the packaged virus into an animal model via tail vein injection, feeding the animal model for more than 35 days to obtain an animal heart failure model.

[0009] Optionally, the virus is an AAV virus.

[0010] Optionally, the recombinant plasmid is packaged within the virus, including:

[0011] The recombinant plasmid, along with pHelper and pAAV-RC, was co-transfected into AAV-293 cells, and the packaged AAV virus particles were collected from the infected AAV-293 cells.

[0012] Secondly, this application provides an application of the animal heart failure model constructed by the above method in screening heart failure drugs for the treatment of myocardial fibrosis.

[0013] Secondly, this application provides an application of the heart failure animal model constructed by the above-mentioned construction method in screening drugs for treating heart failure caused by circadian rhythm disorders.

[0014] Secondly, this application provides an application of the heart failure animal model constructed by the above-mentioned construction method in screening the timing of heart failure drug administration.

[0015] The beneficial effects of this invention are as follows:

[0016] This invention synthesizes a disruptive sequence targeting the cardiogenic Clusterin protein. The disruptive sequence is constructed into a plasmid and packaged into a virus. The specific virus is then injected into mice via tail vein injection to locally knock down the Clusterin protein gene sequence. Evaluation using echocardiography shows that Clusterin knockdown can establish a mouse model of heart failure. This method induces the heart failure phenotype without requiring high-intensity stimulation (such as surgery, prolonged ischemia, or high-dose drugs), thus reducing acute mortality.

[0017] Other features and advantages of the invention will be set forth in the description which follows, and will be apparent in part from the description, or may be learned by practicing embodiments of the invention. Attached Figure Description

[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a plasmid map of the recombinant plasmid (pAAV2-hEF1a-DIO-MasterRNAi155(mClu)-eGFP-WPRE-pA) from the embodiments of this application;

[0020] Figure 2 The ultrasound results of cardiac function in the model group and control group mice in the embodiments of this application;

[0021] Figure 3The results of ELISA detection of Clusterin protein content in the blood of mice in the model group and control group in the embodiments of this application are shown.

[0022] Figure 4 The results of Western blot analysis of Clusterin protein in the model group and control group mice in this application are shown. Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are some embodiments of the present invention, but not all embodiments.

[0024] In this application, numerical ranges are referred to as continuous unless otherwise specified, and include the minimum and maximum values ​​of the range, as well as every value between the minimum and maximum values. Furthermore, when the range refers to integers, it includes every integer between the minimum and maximum values ​​of the range. Additionally, when multiple ranges are provided to describe a feature or characteristic, the ranges may be merged. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are incorporated.

[0025] To knock down the Clusterin protein, the present invention designed a sequence as shown in SEQ ID NO.1;

[0026] SEQ ID NO.1: cctgtaaactgttgaaaggacttgtcagtcagtggccaaaacaagtccttgctcaacagtttac;

[0027] The sequence shown in SEQ ID NO.1 was inserted into the vector to construct a recombinant plasmid named pAAV2-hEF1a-DIO-MasterRNAi155(mClu)-eGFP-WPRE-pA. Figure 1 As shown, the sequence of the recombinant plasmid is shown in SEQ ID NO.2;

[0028] SEQ ID NO.2:

[0029] ttccatgtgagtgctgataaagggccttgtgtcctgtaaactgttgaaaggacttgtcagtcagtggccaaaacaagtccttgctcaacagtttacagcatacagcccaaagcaagcctccagtcg;

[0030] hEF1a is the human extension factor 1α promoter;

[0031] DIO (Double-floxed Inverse Orientation) is the core control element;

[0032] MasterRNAi155(mClu) is a functional gene, which is an interference sequence;

[0033] eGFP (enhanced green fluorescent protein) is used as a tracer label;

[0034] WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element) is a posttranscriptional regulatory element of woodchuck hepatitis virus.

[0035] pA (polyadenylation signal) is the termination signal.

[0036] Example 1:

[0037] A method for constructing a heart failure model by knocking down cardiac-derived Clu protein, comprising: knocking down the cardiac-derived Clu protein gene in an animal model.

[0038] Specifically, gene knockdown is performed using an RNAi vector with an interfering sequence, as shown in SEQ ID NO. 1.

[0039] Specifically, this includes: synthesizing an RNAi vector targeting the Clu protein, and constructing a recombinant plasmid based on the RNAi vector;

[0040] After constructing the recombinant plasmid, enzyme digestion and sequencing were performed. Then, the recombinant plasmid was packaged into a virus. The RNAi vector included MasterRNAi155.

[0041] The packaged virus was injected into an animal model via tail vein. The animal model was then fed for more than 40 days to obtain an animal heart failure model.

[0042] Optionally, the virus used is an AAV virus (adeno-associated virus).

[0043] Optionally, the recombinant plasmid is packaged within the virus, including:

[0044] The recombinant plasmid, along with pHelperr (carrying genes from adenovirus) and pAAV-RCC (carrying genes for AAV replication and capsid), was co-transfected into AAV-293 cells (providing trans-acting factors required for AAV replication and packaging). Packaged AAV virus particles were then collected from the infected AAV-293 cells.

[0045] AAV particles typically accumulate in packaging cells, so collecting the cells and then lysing them to release the AAV particles into the supernatant allows for the recovery of most of the AAV particles.

[0046] The viral supernatant from the third step is concentrated and purified. The original supernatant contains many cell protein molecules and fragments. Most of the cell proteins and residual CsCl ions can be removed by two CsCl density gradient centrifugations and one ultrafiltration.

[0047] The packaged virus was introduced into an animal model via tail vein injection. In this application, mice were used, and the mice were fed for more than 35 days to obtain an animal heart failure model.

[0048] Example 2:

[0049] Wt1-CreERT2 mice from Nanmo Biotechnology (catalog number NM-KI-200127) were selected.

[0050] Mice were housed in an SPF-grade animal room with a temperature of 22-25℃ and a humidity of 50%-60%. A 12-hour light / 12-hour dark circadian rhythm was adopted, and mice were given free access to standard feed and water. After one week of acclimatization, the experiment began. During this period, the mice's mental state, diet, and activity were observed daily, and healthy or abnormal individuals were excluded.

[0051] Based on the CDS sequence of the target Clu protein, a specific interfering sequence (SEQ ID NO.1) and its complementary strand were synthesized, with restriction enzyme sites corresponding to the MasterRNAi155 vector added to both ends. The synthesized single-stranded oligonucleotides were annealed to form a double-stranded interfering sequence (dsRNA). The specific steps were as follows: the positive and negative strands of oligonucleotides were dissolved in annealing buffer to a concentration of 100 μmol / L, and equal volumes were mixed. The mixture was heated at 95°C for 5 min, and then naturally cooled to room temperature to obtain the double-stranded interfering sequence, which was stored at -20°C for later use.

[0052] Take the MasterRNAi155 vector plasmid, add restriction endonucleases, buffer, and RNase, and digest in a 37°C water bath for 4 hours. The digestion system (50 μL) consists of: 10 μL vector plasmid, 2 μL each of the two restriction endonucleases, 5 μL 10× digestion buffer, 1 μL RNase, and 20 μL sterile water. After digestion, perform agarose gel electrophoresis, and recover the digested linear vector fragment using a gel recovery kit. Determine the concentration and verify the integrity to ensure that the vector is not degraded and that the digestion is complete.

[0053] The annealed double-stranded interference sequence was ligated into the linear MasterRNAi155 vector. The ligation system (20 μL) consisted of 5 μL of linear vector, 3 μL of double-stranded interference sequence, 1 μL of T4 DNA ligase, 2 μL of 10× ligation buffer, and 9 μL of sterile water. The ligation was carried out overnight at 16°C.

[0054] The ligation product was transformed into competent Escherichia coli DH5α. The specific steps were as follows: 10 μL of ligation product was added to 100 μL of competent cells, incubated on ice for 30 min, heat-shocked at 42℃ for 90 s, and then quickly incubated on ice for 2 min. 800 μL of antibiotic-free LB medium was added, and the cells were cultured at 37℃ with shaking for 1 h. 200 μL of the bacterial culture was evenly spread on LB solid medium containing ampicillin (100 μg / mL), and incubated upside down at 37℃ overnight to form single colonies.

[0055] Enzyme digestion identification: Single colonies were picked and inoculated into LB liquid medium containing ampicillin and cultured at 37°C with shaking for 12-16 hours. Plasmids were extracted (using a plasmid mini-prep kit). The extracted plasmids were verified by double enzyme digestion. After electrophoresis, the bands were observed. The appearance of linear vector bands and interfering sequence bands indicated that the preliminary construction was successful.

[0056] Sequencing verification: Sequencing was performed using universal sequencing primers corresponding to the MasterRNAi155 vector. The sequencing results were compared with the target interference sequence to confirm that the interference sequence was correctly inserted into the vector without any base mutations, deletions, or reverse insertions. The correct recombinant plasmid was obtained (named pAAV2-hTNNT2-MasterRNAi155(mClu)-eGFP-WPRE-pA), and its plasmid map is shown below. Figure 1 .

[0057] After resuscitation, AAV-293 cells were seeded in DMEM medium containing 10% FBS and 1% penicillin + streptomycin, and cultured at 37°C in a 5% CO2 incubator. When cell confluence reached 80%-90%, they were passaged. One day before virus packaging, cells were seeded into 15cm culture dishes, and the cell density was adjusted to 5 × 10⁶ cells / mL. 6 Cells per dish, cultured for 24 hours to achieve 70%-80% cell confluence (at which point the cells are in optimal condition, which is conducive to plasmid transfection).

[0058] The recombinant plasmid, pHelper plasmid, and pAAV-RCC plasmid were co-transfected into AAV-293 cells at a molar ratio of 1:1:1 using liposome transfection. Specific steps: 500 μL of serum-free DMEM medium was added to a sterile centrifuge tube, along with the three plasmids and liposome reagent in the corresponding proportions (liposome to plasmid mass ratio 3:1). The mixture was gently mixed and incubated at room temperature for 20 min to form a liposome-plasmid complex. The complex was then slowly added dropwise to a culture dish, gently shaken to ensure even distribution, and cultured for 6 h. The culture medium was then replaced with DMEM containing 10% FBS and cultured for another 72 h.

[0059] 72 hours after transfection, the cell state was observed under a microscope. When mild lesions (shrinkage, detachment) appeared, the cells and supernatant in the culture dish were collected, centrifuged at 1000 rpm for 5 min at 4 °C, and the cell pellet was collected. The cells were washed twice with PBS buffer, and cell lysis buffer (5 mL per dish) was added. The cells were incubated on ice for 30 min, with repeated pipetting during this period. The lysis buffer was then frozen at -80 °C for 30 min, thawed in a water bath at 37 °C, and the freeze-thaw cycle was repeated 3 times to fully release the virus particles. The cells were centrifuged at 12000 rpm for 20 min at 4 °C, and the supernatant was collected, which was the crude virus solution. The virus was purified by two CsCl density gradient centrifugations combined with one ultrafiltration to obtain the packaged virus (named AAV-Clu-shRNA virus).

[0060] Mice were randomly divided into a model group (n=9, injected with AAV-Clu-shRNA virus) and a control group (n=6, injected with empty vector AAV virus) after one week of acclimatization. Before injection, the mice were fixed and the tail vein area was wiped with 75% ethanol to promote vasodilation. The virus was injected into the tail vein. One month after the virus was expressed, Tamoxifen (100 mg / kg / day) was injected intraperitoneally for 5 consecutive days before experiments could be conducted.

[0061] Observe the mice's mental state, food intake, water intake, activity level, and weight changes daily, and record the data.

[0062] Echocardiography was used to assess cardiac function in mice. The ultrasound results are shown in [reference needed]. Figure 2 As can be seen, the left ventricular ejection fraction (EF) and left ventricular fractional shortening (FS) were significantly reduced in the model group, and Clusterin knockdown can establish a mouse heart failure model. In the figure, WT represents the control group sample, and CLU(-) represents the model group sample.

[0063] Six mice from the control group and six mice from the model group were randomly selected. Total protein was extracted from heart tissue, and the expression level of Clusterin protein was verified by Western blot. At the same time, blood was extracted, and the content of Clusterin protein in the blood was detected by ELISA.

[0064] ELISA test results as follows Figure 3 Western blot test results are as follows: Figure 4 There is a band near 60kDa and another near 40kDa. The expression of Clusterin protein in the 60kDa band is shown in the left figure, and the expression of Clusterin protein in the 40kDa band is shown in the right figure.

[0065] It is evident that the expression of heart-derived Clusterin protein in the model group was significantly lower than that in the control group, proving that the knockdown was successful.

[0066] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A method for constructing a heart failure model by knocking down cardiogenic Clu protein, characterized in that, include: Knock down the Clu protein gene from the heart in an animal model.

2. The method for constructing a heart failure model by knocking down cardiogenic Clu protein according to claim 1, characterized in that, This includes gene knockdown using an RNAi vector with an interfering sequence, as shown in SEQ ID NO.

1.

3. The method for constructing a heart failure model by knocking down cardiogenic Clu protein according to claim 1, characterized in that, include: An RNAi vector targeting the Clu protein was synthesized, and a recombinant plasmid was constructed based on the RNAi vector. The recombinant plasmid was then packaged into a virus.

4. The method for constructing a heart failure model by knocking down cardiogenic Clu protein according to claim 3, characterized in that, The sequence of the recombinant plasmid is shown in SEQ ID NO.

2.

5. The method for constructing a heart failure model by knocking down cardiogenic Clu protein according to claim 3, characterized in that, include: The packaged virus was injected into an animal model via tail vein. The animal model was then fed for more than 35 days to obtain an animal heart failure model.

6. The method for constructing a heart failure model by knocking down cardiogenic Clu protein according to claim 3, characterized in that, The virus in question is an AAV virus.

7. A method for constructing a heart failure model by knocking down cardiogenic Clu protein according to claim 5, characterized in that, Packaging recombinant plasmids into viruses includes: The recombinant plasmid, along with pHelper and pAAV-RC, was co-transfected into AAV-293 cells, and the packaged AAV virus particles were collected from the infected AAV-293 cells.

8. The application of an animal heart failure model constructed by the method of any one of claims 1-7 in screening heart failure drugs for the treatment of myocardial fibrosis.

9. The use of an animal model of heart failure constructed by the construction method according to any one of claims 1-7 in screening drugs for treating heart failure caused by circadian rhythm disorders.

10. The application of an animal model of heart failure constructed by the construction method according to any one of claims 1-7 in screening the timing of drug administration for heart failure.

Images