A set of lamp primers for detecting bovine-derived f. necrophorum and a method thereof

Abstract

This invention discloses a LAMP primer set and method for detecting *Cryptobacter pyogenes* of bovine origin, belonging to the field of microbial detection technology. The LAMP primer set of this invention is: PLO-F3: GCCGGTTACCAAGGATCAG, PLO-B3: GACATTTGCGGAGCACG, PLO-FIP: CGCAGAGATGTCCGAACGCAAACTCAAGGACGGCACCTACA, PLO-BIP: GCGAACAACGCCCACGTCTACGATCGA AGTCGGACTACCT, with a target fragment of 204 bp. The detection method includes (1) extracting DNA from the sample to be tested; (2) using the DNA of the sample to be tested as a template, performing a LAMP amplification reaction using the specific primer set of this invention; and (3) determining the amplification results. The optimal reaction temperature of this invention is 63 ℃, the reaction time is 44 minutes, and the detection sensitivity reaches 220 copies / ul. The detection method has the advantages of short reaction time, high efficiency, strong specificity, high sensitivity, good repeatability, and high accuracy.

Description

Technical Field

[0001] This invention relates to the field of microbial detection technology, specifically to a LAMP primer set and method for *Cryptobacter pyogenes* of bovine origin. Background Technology

[0002] Trueperella pyogenes is a Gram-positive opportunistic pathogen that colonizes the mucous membranes of the respiratory, digestive, and urogenital tracts of animals. When the host's immunity is weakened, it can cause purulent infections such as mastitis, pneumonia, and foot rot. The lesions involve multiple tissues, causing huge losses to the livestock industry.

[0003] Simple and rapid detection techniques are crucial for the monitoring and prevention of Cryptococcus pyogenes. Currently established diagnostic techniques for Cryptococcus pyogenes include bacterial isolation and identification, serological tests (ELISA), and molecular biological detection techniques (PCR, qPCR). These detection methods require specialized instruments and equipment and highly skilled laboratory personnel. They are complex, cumbersome, and time-consuming, making them unsuitable for multi-scenario applications.

[0004] Loop-mediated isothermal amplification (LAMP) is a novel isothermal nucleic acid detection technology characterized by high efficiency, speed, and simplicity, and is widely used in pathogen detection and gene diagnosis. Its technical principle involves the action of Bst DNA polymerase via strand substitution, using 4-6 specific primers to recognize and continuously replace the target gene, achieving highly efficient nucleic acid amplification in just 30-60 minutes. Compared to traditional detection methods such as PCR and ELISA, LAMP offers advantages such as high sensitivity, high amplification efficiency, and good specificity. It is not only simple to operate, requiring no complex and sophisticated instruments, but also saves labor costs and detection time, making it highly practical and suitable for rapid on-site diagnosis at the grassroots level. Currently, LAMP technology is widely used for rapid identification in multiple fields, including pathogen detection and identification of components in traditional Chinese medicine, and has broad application prospects in the field of point-of-care diagnosis of clinical diseases. The ability to achieve rapid and accurate detection of Cryptobacterium pyogenes using LAMP technology will be of great significance to the stable development of the aquaculture industry. Summary of the Invention

[0005] The purpose of this invention is to provide a LAMP primer set and method for detecting *Cryptobacter pyogenes* of bovine origin. Specific primers were designed based on the highly conserved region of the PLO gene. Optimal reaction conditions were determined through optimization, resulting in an optimal reaction temperature of 63 °C and a reaction time of 44 minutes, achieving a detection sensitivity of 220 copies / µl. Furthermore, the detection method is time-efficient, highly specific, sensitive, reproducible, and widely applicable.

[0006] This invention is achieved through the following technical solution: A LAMP primer set for detecting *Cryptobacter pyogenes* of bovine origin is as follows: PLO-F3: GCCGGTTACCAAGGATCAG, PLO-B3: GACAGTTTGCGGAGCACG, PLO-FIP: CGCAGAGATGTCCGAACGCAAACTCAAGGACGGCACCTACA, PLO-BIP: GCGAACAACGCCCACGTCTACGATCGAAGTCGGACTACCT.

[0007] Furthermore, the primer set was designed based on the PLO virulence gene sequence, and the amplified target fragment was 204 bp in length.

[0008] A kit for detecting Cryptorchidism pyogenes from bovine origin, comprising the LAMP primer set of Cryptorchidism pyogenes from bovine origin of the present invention.

[0009] Furthermore, the kit for detecting *Cryptospirae pyogenes* of the present invention comprises the following components: the LAMP primer set for *Cryptospirae pyogenes* of claim 1 or 2, DNA template, 2× reaction buffer, Bst DNA polymerase, and water.

[0010] The method for detecting *Cryptospirae pyogenes* of bovine origin for non-disease diagnostic purposes according to this invention uses the LAMP primer set for detecting *Cryptospirae pyogenes* of bovine origin according to this invention.

[0011] A method for detecting *Cryptospirae* of bovine origin for non-disease diagnostic purposes includes the following steps: (4) Extract DNA from the sample to be tested; (5) Using the DNA of the sample to be tested as a template, perform LAMP amplification reaction using the LAMP primer set for detecting bovine Cryptococcus pyogenes as described in claim 1 or 2; (6) Determination of amplification results.

[0012] Furthermore, the LAMP reaction system in step (2) is calculated per 25 μl volume: .

[0013] Furthermore, the concentrations of PLO-F3, PLO-B3, PLO-FIP, and PLO-BIP are all 10 μmol / L, 20 μmol / L, and 20 μmol / L, respectively.

[0014] Furthermore, the amplification reaction conditions are 63 °C for 44-60 min.

[0015] The method of this invention has a minimum detection limit of 2.2 × 10⁻⁶ for *Cryptobacter pyogenes* of bovine origin. 1 copies / μL.

[0016] The beneficial effects of this invention are: (1) The LAMP primer set for detecting bovine Cryptococcus pyogenes screened by this invention has the characteristics of high specificity, high sensitivity and good repeatability, and the results are reliable and stable. At the same time, it is easy to operate, has low requirements for instruments and equipment, and the detection is fast and time-saving. It has broad application prospects in practical applications.

[0017] (2) In the sensitivity test, the lowest detectable concentration of *Cryptobacter pyogenes* using the LAMP method of this invention is 220 copies / μL, while the lowest detectable concentration of conventional PCR is 1.45 × 10⁻⁶. 4 The copies / μL indicates that the detection sensitivity of the method of the present invention is superior to that of the conventional PCR method.

[0018] (3) In the repeatability test, the intra-batch coefficient of variation (CV) of the present invention was 1.33% to 6.49%, and the inter-batch coefficient of variation (CV) was 1.26% to 5.57%, both less than 10%, indicating that the method of the present invention has good repeatability.

[0019] (4) In the process of applying the method, 49 samples were tested. The LAMP method of the present invention detected 21 positive samples, with a positive rate of 42.85%; while conventional PCR detected 5 positive samples, with a positive rate of 10.20%. The positive concordance rate of the two was 100%, indicating that the method of the present invention has a higher detection accuracy. Attached Figure Description

[0020] Figure 1 This is a graph showing the LAMP primer screening results; Figure 2These are amplification diagrams of recombinant plasmid PCR results; where A: amplification diagram of pMD19-T-204 PCR results; M: DNAMarker DL2000; 1: positive control; 2: negative control; B: amplification diagram of pMD19-T-927 PCR results; M: DNAMarker DL2000; 1: positive control; 2: negative control.

[0021] Figure 3 This is a comparison of LAMP amplification reaction curves, where AE represents the LAMP reaction temperatures of 60 ℃, 61 ℃, 62 ℃, 63 ℃, and 64 ℃, respectively.

[0022] Figure 4 These are LAMP amplification reaction curves under different ratios of inner and outer primer concentrations.

[0023] Figure 5 This is a specificity test for the LAMP method of the present invention, wherein 1: negative control; 2: positive control; 3: bovine mycoplasma; 4: bovine nodular dermatitis virus; 5: bovine infectious rhinotracheitis virus; 6: Klebsiella pneumoniae; 7: Bacillus subtilis; 8: Staphylococcus aureus; 9: Corynebacterium; 10: hemolytic Mansonia.

[0024] Figure 6 This is a sensitivity comparison diagram between the LAMP method and the PCR method of this invention. In the diagram, A represents the PCR method, and M represents DNA Marker DL 2000, 1-10: 1.45 × 10⁻⁶. 9 -1.45 copies / μL; B represents the LAMP method; 1 in the figure: negative; 2-11: 2.2 × 10 9 -2.2 copies / μL. Detailed Implementation

[0025] The present invention is illustrated by the following embodiments, but these are not intended to limit the scope of the invention.

[0026] Example 1. Main strains and bacteria used The bovine mycoplasma, bovine nodular dermatitis virus, bovine infectious rhinotracheitis virus, Klebsiella pneumoniae, Bacillus, Staphylococcus aureus, Corynebacterium, and hemolytic Mange bacteria used in the study, as well as 49 other samples, were all preserved in the applicant's laboratory.

[0027] 2. Main reagents Loop-mediated isothermal DNA amplification kit.

[0028] 3. Main Instruments LAMP real-time turbidity analyzer.

[0029] 4. Primer design Primers were designed based on the highly conserved sequence of the PLO virulence gene of the isolate. Five sets of primers were designed, each set containing an inner primer FIP / BIP and an outer primer F3 / B3, as shown in Table 1.

[0030] To screen for LAMP primers with good amplification performance and improve the specificity and accuracy of the reaction, the five sets of outer primers F3 and B3 in Table 1 were diluted to a concentration of 10 μM, and the inner primers FIP and BIP were diluted to a concentration of 20 μM. Loop-mediated isothermal amplification was performed using Cryptococcus pyogenes positive nucleic acid as a template. The quality of the primers was determined based on the results of a real-time LAMP turbidity analyzer, and the primers were evaluated.

[0031] Table 1. Information on the 5 sets of primer sequences designed

[0032] After primer screening, it was found that (e.g.) Figure 1 As shown in Table 2, among the five sets of LAMP primers designed for Cryptococcus pyogenes, only the PLO-12 primer set produced amplification results. Therefore, the PLO-12 primer set was selected as the amplification primer set for subsequent experiments. The selected PLO-12 primer set sequences are shown in Table 2.

[0033] Table 2. Screened LAMP-specific primer sets for *Cryptobacter pyogenes* from bovine origin

[0034] 5. Preparation of recombinant plasmid standards for Cryptococcus pyogenes Using *Cryptobacillus pyogenes* genomic DNA as a template, PCR amplification was performed using the outer primers F3 / B3 of the optimal LAMP primer set selected above. The PCR products were detected by 1% agarose gel electrophoresis. The target gene fragment gel block was excised and purified using a gel extraction kit according to the manufacturer's instructions. The recovered product was ligated into the PMD19-T vector and transformed into *E. coli* competent cells. After amplification on a shaker at 37 ℃ for 1 h, 100 μL of the bacterial culture was plated on an LA culture plate containing ampicillin and incubated overnight at 37 ℃. Single colonies were inoculated into 5 mL of LB medium containing ampicillin and amplified for 12 h. The bacterial culture was then identified by PCR using the outer primers PLO-F3 / PLO-B3 from the LAMP primer set of this invention. Plasmids were extracted from positive bacterial cultures using a plasmid extraction kit, and the concentration was measured. The samples were simultaneously sent to a biotechnology company for sequencing.

[0035] Using the outer primers PLO-F3 / PLO-B3 from the LAMP primer set of this invention, PCR amplification was performed with the extracted plasmid as a template. A 204 bp band was obtained by gel electrophoresis, consistent with expectations, indicating that the target fragment had been successfully inserted into the pMD19-T vector. The plasmid was named pMD19-T-204, and the concentration of the constructed positive recombinant plasmid was measured to be 69.869 ng / μL using a microplate reader. The calculated copy number was 2.2 × 10⁻⁶. 10 copies / uL.

[0036] Using the primers for detecting Cryptococcus pyogenes in our laboratory (F: GGGGCTTTTTGTTTTGGTGG; R: TCTCTGGCACATCGCAGTGTAT; Target fragment: 927 bp), a recombinant plasmid was constructed according to the above steps and named pMD19-T-927. The concentration of the constructed positive recombinant plasmid was measured to be 56.78 ng / μL using an ELISA reader, and its copy number was calculated to be 1.45 × 10⁻⁶. 10 copies / uL. The recombinant plasmid construction results are as follows: Figure 2 As shown.

[0037] 6. Establishment of the LAMP reaction system and optimization of reaction conditions This invention uses a 25 μL LAMP reaction system, as detailed in Table 3.

[0038] Table 3 LAMP reaction system

[0039] (1) Optimization of LAMP amplification temperature The reaction temperature of Bst DNA polymerase is 60–65 °C. Therefore, five isothermal amplification temperature gradients were set: 60 °C, 61 °C, 62 °C, 63 °C, and 64 °C. Using *Cryptospirae* genomic DNA as a template and ddH2O as a negative control, the LAMP system was prepared according to Table 3. Amplification was performed at the preset temperature gradients for 1 hour, followed by inactivation at 85 °C for 5 minutes. Turbidity was monitored using a real-time turbidimeter. The results are shown below. Figure 3 As shown. Figure 3 The AE values ​​correspond to amplification temperatures of 60 ℃, 61 ℃, 62 ℃, 63 ℃, and 64 ℃, respectively.

[0040] The LAMP amplification reaction efficiency is highest at an amplification temperature of 63℃. Therefore, the optimal amplification temperature is determined to be 63℃.

[0041] (2) Optimization of LAMP primer concentration ratio Six primer concentrations were set, with the outer primer volume fixed at 0.5 μL. The optimal primer-to-outer primer ratios were 1:1, 2:1, 4:1, 8:1, and 10:1. The extracted positive plasmid DNA was used as a template, and a system using double-distilled water as a template was set up as a blank control. Amplification was performed according to the LAMP reaction system and the selected optimal temperature (63℃). Amplification lasted for 1 hour, followed by inactivation at 85℃ for 5 minutes. Turbidity was monitored using a real-time turbidimeter. The results are as follows: Figure 4 As shown. By Figure 3 It can be seen that, The LAMP amplification reaction efficiency is highest when the ratio of inner to outer primer concentration is 8:1. Therefore, the optimal ratio of inner to outer primer concentration is determined to be 8:1.

[0042] 7. Specificity test Nucleic acid samples from pathogens such as Mycoplasma bovis, bovine nodular dermatitis virus, bovine infectious rhinotracheitis virus, Klebsiella pneumoniae, Bacillus subtilis, Staphylococcus aureus, Corynebacterium, and hemolytic Mansonia were extracted using a nucleic acid extraction kit. Genomic DNA of Cryptococcus pyogenes and ddH2O were used as positive and negative controls, respectively, and the LAMP detection method established and optimized in point 6 above was used for detection.

[0043] The results are as follows Figure 5 As shown, only the genomic DNA of Cryptococcus pyogenes showed amplification turbidity, indicating that the LAMP method established in this study has good specificity.

[0044] 8. Sensitivity Experiment The two recombinant plasmids were serially diluted 10-fold using ddH2O (10 1 ~10 10 Using plasmids of various concentrations as templates, amplification was performed using the LAMP method optimized in point 6 above, followed by PCR amplification using laboratory detection primers. The sensitivity of the two methods was compared. Each reaction was performed in triplicate. The sensitivity of the established LAMP method was evaluated by monitoring the results using a real-time turbidimeter. The results are shown below. Figure 6 As shown.

[0045] Depend on Figure 6 It can be seen that the lowest detection limit using the PCR method is 1.45 × 10⁻⁶. 4 The minimum detection limit using the method of this invention is 220 copies / μL; while the LAMP method of this invention has high sensitivity.

[0046] 9. Repeatability Experiments Repeatability tests were conducted using the LAMP method established and optimized in this invention, with the extracted recombinant plasmid pMD19T-204 (diluted 10⁻⁶).3 ~10 5 Using a template of 1000 ppm (x) and ddH2O as a negative control, intra-batch repeatability experiments and inter-batch repeatability tests were performed, repeated three times. The final turbidity value was monitored and read using a real-time turbidimeter, and the intra-batch and inter-batch coefficients of variation (CV = SD / x) were calculated to confirm the accuracy and reliability of the experimental results of the established LAMP method. The results are shown in Table 4.

[0047] Table 4. LAMP Repeatability Test

[0048] As shown in Table 4, the intra-batch coefficient of variation (CV) was 1.33%–6.49%, and the inter-batch coefficient of variation (CV) was 1.26%–5.57%, both less than 10%, indicating that the method has good reproducibility.

[0049] 10. Practical Applications of the LAMP Method Forty-nine pathogen samples were tested using the LAMP detection method established and optimized in this invention and conventional PCR. The LAMP detection results were compared with the PCR amplification results to evaluate the effectiveness of LAMP in detecting Cryptococcus pyogenes.

[0050] The results showed that LAMP detected 21 positive samples, with a positive rate of 42.85%; conventional PCR detected 5 positive samples, with a positive rate of 10.20%. The positive concordance rate between the two methods was 100%, indicating that the method established in this invention can be used for clinical sample testing and is more accurate.

Claims

1. A LAMP primer set for detecting *Cryptobacter pyogenes* of bovine origin, characterized in that, The primer set is as follows: PLO-F3: GCCGGTTACCAAGGATCAG, PLO-B3: GACAGTTTGCGGAGCACG, PLO-FIP: CGCAGAGATGTCCGAACGCAAACTCAAGGACGGCACCTACA, PLO-BIP: GCGAACAACGCCCACGTCTACGATCGAAGTCGGACTACCT.

2. The LAMP primer set for detecting *Cryptobacter pyogenes* of bovine origin according to claim 1, characterized in that, The primer set was designed based on the PLO virulence gene sequence, and the amplified target fragment was 204 bp in length.

3. A kit for detecting *Cryptobacter pyogenes* of bovine origin, characterized in that... The LAMP primer set contains the bovine Cryptorchidica as described in claim 1 or 2.

4. A kit for detecting *Cryptobacter pyogenes* of bovine origin, characterized in that, The kit comprises the following components: LAMP primer set of *Cryptobacillus pyogenes* as described in claim 1 or 2, DNA template, 2× reaction buffer, Bst DNA polymerase, and water.

5. A method for detecting *Cryptospirae* of bovine origin for non-disease diagnostic purposes, characterized in that, The method uses the LAMP primer set for detecting *Cryptospirae* of bovine origin as described in claim 1 or 2.

6. The method for detecting *Cryptospirae* of bovine origin for non-disease diagnostic purposes according to claim 5, characterized in that, Includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the DNA of the sample to be tested as a template, LAMP amplification reaction is performed using the LAMP primer set for detecting bovine Cryptococcus pyogenes as described in claim 1 or 2; (3) Determination of amplification results.

7. The method for detecting *Cryptospirae* of bovine origin for non-disease diagnostic purposes according to claim 6, characterized in that, The LAMP reaction system in step (2) is calculated per 25 μl volume: 。 8. The method for detecting *Cryptospirae* of bovine origin for non-disease diagnostic purposes according to claim 7, characterized in that, The concentrations of PLO-F3, PLO-B3, PLO-FIP, and PLO-BIP are 10 μmol / L, 20 μmol / L, and 20 μmol / L, respectively.

9. The method for detecting *Cryptospirae* of bovine origin for non-disease diagnostic purposes according to claim 6, characterized in that, The amplification reaction conditions are 63 °C for 44-60 min.

10. The method for detecting *Cryptospirae* of bovine origin for non-disease diagnostic purposes according to claim 6, characterized in that, The minimum detection limit for this method of PLO standard plasmids of Cryptorchidica bovis is 220 copies / μL.

Images