Drug screening chip based on pcg10 protein, method and use thereof

Abstract

The application discloses a drug screening chip based on Pcg10 protein, a method and application thereof, and belongs to the field of biotechnology and pesticide screening. The chip comprises a solid phase carrier and Pcg10 protein, a variant, an ortholog or a functionally active fragment thereof fixed on the surface of the solid phase carrier. The application also discloses a method for screening small-molecule compounds against plant pathogenic fungi (such as Magnaporthe oryzae) by using the above protein or chip, and the method involves technical means such as surface plasmon resonance (SPR), DNA-encoded compound library (DEL) screening, affinity mass spectrometry or virtual docking. The application can screen aryl ether oxazole compounds MC07 which have physical interaction with Pcg10 by detecting the binding of candidate compounds with Pcg10, and it is determined that MC07 has high activity by measuring the appressorium formation rate and inoculating barley.

Description

Technical Field

[0001] This invention belongs to the field of plant protection and biotechnology. Specifically, this invention relates to a novel drug target for screening resistance to plant fungal diseases (especially rice blast), and a method, chip, reagent kit, and system for screening active small molecule compounds based on this target. Background Technology

[0002] Rice blast is caused by the rice blast fungus (Bacillus oryzae). Magnaporthe oryzae Rice blast is a major fungal disease of rice, and one of the most serious diseases affecting rice production worldwide, particularly in major rice-growing areas of Asia and Africa, severely impacting rice yield and food security. Current control measures for rice blast mainly include agricultural control, chemical control, and biological control. Among these, chemical control remains the most common and effective means of control in production due to its rapid effectiveness, ease of application, and stable efficacy.

[0003] Currently, chemical fungicides used to control rice blast mainly include methoxyacrylates (QoIs), ergosterol biosynthesis inhibitors (EBIs), and melanin biosynthesis inhibitors. However, most of the highly effective fungicides relied upon for rice blast control in my country are developed by foreign companies with core intellectual property rights, while domestically developed original fungicides are relatively scarce. Furthermore, the long-term use of chemical fungicides has led to increasing resistance in rice blast fungi, and the ecological safety and environmental risks of some agents are also receiving increasing attention.

[0004] Therefore, targeting key proteins essential for pathogenic processes as novel molecular targets and screening and optimizing the structure of lead compounds is an important research direction for the creation of green and efficient fungicides, and a key technological problem that urgently needs to be solved in my country's pesticide innovation field. However, in the discovery and validation of original molecular targets, there are still bottlenecks such as low efficiency in effective target screening and insufficient target function validation systems. Therefore, systematically constructing a database of potential drug targets for pathogens and developing a common technology system for the targeted validation of potential fungicide targets is of great significance for promoting the research and development of original green fungicides. Summary of the Invention

[0005] This invention proposes a protein chip for screening highly active small molecule compounds. Based on the potential target identification technology of pathogenic essential proteins combined with small molecule compounds with bactericidal activity, a pathogenic essential protein Pcg10 of rice blast fungus was first identified, and the highly active small molecule MC07 was screened through the compound library created in our laboratory.

[0006] This invention first provides the use of protein Pcg10, its variants, its orthologs, or its functionally active fragments in screening small molecule compounds that resist plant pathogenic fungi (preferably rice blast fungus or Fusarium wilt). The amino acid sequence of protein Pcg10 is shown in SEQ ID NO: 1. The variants are proteins that have at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% sequence identity with SEQ ID NO: 1 and retain the ability to bind to small molecule ligands. The functionally active fragments are polypeptide fragments containing the small molecule ligand-binding domain of protein Pcg10.

[0007] In an optional embodiment, the ortholog is derived from filamentous fungi (such as *Fusarium graminearum* and *Aspergillus nidus*); preferably, the ortholog is selected from *Fusarium graminearum* FgPCG10 (gene ID: FG05_01051, ...). Fusarium graminearum ) and Aspergillus nidulans AnPCG10 (GenBank No.: XP_658019.2, Aspergillus nidulans )).

[0008] In an optional embodiment, the functionally active fragment includes the Myosin-binding domain of protein Pcg10, preferably a fragment corresponding to arginine (R200) ​​to glutamic acid (E397) at position 200 in the amino acid sequence (SEQ ID NO: 1), or a functionally equivalent variant thereof.

[0009] In an optional embodiment, the protein Pcg10, its variants, its orthologs, or its functionally active fragments may be modified, for example, by inserting a short peptide sequence at the N-terminus, C-terminus, or internal portion of the protein Pcg10, its variants, its orthologs, or its functionally active fragments. For example, this could include (E / A)AAK, KL(A / E)AA, or similar repeating units. Further, the short peptide sequence could be KLAEAAAKEAAAKEAAAKAAA, used to improve protein solubility.

[0010] In an optional embodiment, the small molecule compound is used to inhibit the growth, reproduction, or pathogenicity of plant pathogenic fungi, including slowing down the mycelial growth rate, slowing down colony growth, inhibiting conidial germination, causing abnormal appressorium formation, reducing sporulation, or causing loss of pathogenicity to the host; the fungus includes *Magnaporthe oryzae* (rice blast fungus). Magnaporthe oryzae Fusarium graminearum ( ), Fusarium graminearum ) or other plant pathogenic fungi.

[0011] In an alternative embodiment, the small molecule compound targets a homologous conserved region of protein Pcg10, differentiating it functionally from its homologous protein in mammals or yeast.

[0012] The present invention also provides a method for screening candidate compounds that resist plant pathogenic fungi (such as rice blast fungus), the method comprising the following steps: 1) Provide protein Pcg10, its variants, its orthologs, or its functionally active fragments; 2) Under conditions that allow protein-compound interactions, contact the candidate compound with the protein from step 1; 3) Detect whether the candidate compound binds to the protein, or detect the regulatory effect of the candidate compound on the activity of the protein; 4) Select compounds that can bind to or regulate the activity of the protein as lead compounds or candidate compounds for resistance to plant pathogenic fungi.

[0013] In optional implementations, the method for detecting binding or modulating effects is based on physical affinity detection techniques, including but not limited to: surface plasmon resonance (SPR), biomembrane interference (BLI), isothermal titration microcalorimetry (ITC), microscale thermophoresis (MST), fluorescence thermal migration (TSA / DSF), or fluorescence polarization (FP).

[0014] In an optional implementation, the method for detecting binding is based on surface plasmon resonance (SPR), which includes immobilizing the protein Pcg10 on the surface of an SPR chip, bringing the candidate compound into contact with the immobilized protein Pcg10, and determining whether binding occurs between the candidate compound and the protein Pcg10 by detecting changes in the SPR response signal.

[0015] In an optional implementation, the detection binding method is based on affinity mass spectrometry (AS-MS), which includes incubating the candidate compound with protein Pcg10 and then using mass spectrometry to detect the presence of the protein-ligand complex or the presence of the ligand after dissociation.

[0016] In an optional implementation, the detection binding method is based on DNA-encoded compound library (DEL) screening technology, which includes contacting a candidate compound library linked with DNA tags with an immobilized protein Pcg10, eluting unbound compounds, and identifying compounds that bind to protein Pcg10 by amplifying and sequencing the DNA tags.

[0017] In an optional implementation, the method further includes a high-throughput screening step, wherein the candidate compounds are selected from a natural product library, a synthetic compound library, a fragment library, or a virtual screening pre-selection library; and optional subsequent steps, such as in vitro cell-level validation (e.g., fungal growth inhibition assay) or in vivo plant model validation (e.g., barley leaf spraying experiment).

[0018] The present invention also provides a chip or biosensor for screening small molecule compounds that resist plant pathogenic fungi, the chip or biosensor comprising a solid support and protein Pcg10, its variants, its orthologs or functionally active fragments thereof immobilized on the surface of the solid support.

[0019] In a preferred embodiment, the chip is a surface plasmon resonance (SPR) chip, and the protein Pcg10 is immobilized on the dextran matrix or other modified layers on the chip surface by physical adsorption, covalent coupling (such as amino coupling, thiol coupling) or affinity capture (such as biotin-streptavidin, His-tag-nickel ion, Fc-tag-Protein G).

[0020] This invention also provides a kit for screening small molecule compounds that resist plant pathogenic fungi, the kit comprising: 1) Protein Pcg10, its variants, its orthologs, or its functionally active fragments; 2) Buffers used to maintain protein activity; such as pH adjusters, salts, stabilizers (such as glycerol or BSA) and detergents (such as Tween-20). Optionally; a positive control compound capable of binding to protein Pcg10; Optionally; detection reagents for labeling proteins or compounds, such as fluorescent dyes, enzyme-linked substrates, radioisotopes, or nanoparticle tags.

[0021] In an optional implementation, the protein is present in solution or lyophilized powder form, or pre-coated on a solid support.

[0022] In an optional implementation, the kit is a kit for fluorescence polarization (FP) screening containing a fluorescently labeled tracer; or a kit for AlphaScreen screening containing donor microbeads and acceptor microbeads.

[0023] In optional implementations, a negative control, a standard curve reagent, and a multi-well plate (such as a 96-well or 384-well plate) may be further included.

[0024] The present invention also provides a computer-aided virtual screening method, which includes performing molecular docking (Docking) between the three-dimensional structure of candidate small molecules and the crystal structure or homology modeling structure of protein Pcg10, calculating the binding free energy, thereby predicting compounds with potential activity.

[0025] This invention also provides the use of the Pcg10 gene or protein Pcg10, its variants, its orthologs or functionally active fragments thereof as targets in inhibiting the growth, reproduction or pathogenicity of plant pathogenic fungi.

[0026] The present invention also provides a method for inhibiting plant pathogenic fungi, the method comprising inhibiting the expression or activity of the Pcg10 gene or Pcg10 protein, its variants, its orthologs or their functionally active fragments.

[0027] The present invention also provides the use of inhibitors of the Pcg10 gene or protein Pcg10, its variants, its orthologs or their functionally active fragments in the inhibition of plant pathogenic fungi, wherein the inhibitors can inhibit the expression or activity of the Pcg10 gene or Pcg10 protein, its variants, its orthologs or their functionally active fragments.

[0028] In optional embodiments, the inhibitor includes small molecule compounds; peptides or proteins; nucleic acid molecules; antibodies or antibody fragments; and RNA interference molecules. In optional embodiments, the inhibitor is MC07, with the chemical structure shown below. Figure 11 As shown.

[0029] In an optional embodiment, the inhibitor includes a Pcg10 gene knockout vector, which knocks out the Pcg10 gene through homologous recombination technology.

[0030] In an optional embodiment, the inhibitor can suppress the growth, reproduction, or pathogenicity of plant pathogens, including slowing mycelial growth rate, slowing colony growth, inhibiting conidial germination, abnormal appressorium formation, reducing sporulation, or causing loss of pathogenicity to the host; the fungus includes *Magnaporthe oryzae* (…). Magnaporthe oryzae Fusarium graminearum ( ), Fusarium graminearum ) or other plant pathogenic fungi.

[0031] In an optional embodiment, the inhibitor is used to prepare a pesticide composition for controlling plant fungal diseases.

[0032] In an alternative embodiment, the pesticide composition is applied to the plant by spraying, seed soaking, soil treatment, or foliar treatment.

[0033] Beneficial technical effects This invention effectively overcomes the cross-resistance problem of existing fungicides by establishing the novel membrane protein Pcg10 and its conserved homologs as drug targets, and has the potential to develop broad-spectrum fungicides against various pathogenic fungi such as rice blast fungus and Fusarium. Combined with targeted screening technologies such as SPR chips, this invention achieves rapid, accurate and high-throughput detection of compound affinity, significantly shortens the research and development cycle, clarifies the mechanism of action, and provides strong technical support for the creation of new green pesticides. Attached Figure Description

[0034] Figure 1Comparison of Pcg10 with homologous protein domains from other species. Illustration: Protein used in the protein domain comparison analysis: Pcg10 ( Pyricularia oryzae ), FG05_01051 ( Fusarium graminearum ), XP_658019.2 ( Aspergillus nidulans ), KZV09010.1 ( Saccharomyces cerevisiae ), NP_060069.3 ( Homo sapiens ).

[0035] Figure 2 Pcg10 is functionally conserved in filamentous fungi. A: Comparison of colony growth of P131, k10, RP27Vezatin, RP27Inp2, RP27FgPcg10, RP27VeZA, and RP27ck10. B: Comparison of conidial germination of P131, k10, RP27Vezatin, RP27Inp2, RP27FgPcg10, RP27VeZA, and RP27ck10. C: Comparison of appressorium formation of P131, k10, RP27Vezatin, RP27Inp2, RP27FgPcg10, RP27VeZA, and RP27ck10. D: Comparison of rice leaf inoculation with P131, k10, RP27Vezatin, RP27Inp2, RP27FgPcg10, RP27VeZA, and RP27ck10.

[0036] Figure 3 . Gene PCG10 Knockout. A: Gene. PCG10 A schematic diagram of the vector construction strategy, utilizing hygromycin HPH gene replacement. PCG10 Genes. B: PCG10 Southern blot analysis showed that a 4.5 kb target band appeared in lane P131 of the wild-type transformant, while a 16.0 kb target band appeared in lane K10 of the knockout transformant.

[0037] Figure 4 Five days after inoculation, the colony size and morphology of wild-type strain P131, knockout strain k10, and complement strain ck10 on OTA culture plates were compared.

[0038] Figure 5 Wild-type strain P131, knockout strain k10, and complement strain ck10 were inoculated onto ordinary coverslips and placed under dark and humid conditions for 2 hours. The germination of the spores of the three strains was compared.

[0039] Figure 6Wild-type strain P131, knockout strain K10, and complement strain CK10 were inoculated onto hydrophobic glass slides. After being placed under dark and humid conditions for 12 h, the appressorium formation of the three strains was compared.

[0040] Figure 7 . Gene PCG10 Influenced on the sporulation yield of rice blast fungus. Wild-type strain P131, knockout strain k10 and complementary strain ck10 were sporulated using 6 cm petri dishes according to the method of smear sporulation. The mycelium was counted 48 h after smearing.

[0041] Figure 8 Missing PCG10 Genes cause the loss of pathogenicity of rice blast fungus to host plants. A: Rice seedlings are sprayed with conidia of P131, k10, and ck10. B: Barley seedlings are sprayed with a suspension of conidia of P131, k10, and ck10. C: Rice leaves are inoculated by scratching with conidia of P131, k10, and ck10.

[0042] Figure 9 Affinity chromatography images of the Pcg10 core region Pcg10-MBD (myosin-binding domain) protein obtained from prokaryotic expression and purification. The target protein size is 25 kDa.

[0043] Figure 10 There is a physical interaction between Pcg10-MBD and MC07, and the KD value of their SPR experiment is 127 μM.

[0044] Figure 11 The chemical structural formula of MC07, a small molecule compound of aryl ether oxazole.

[0045] Figure 12 MC07 exhibits fungicidal activity against rice blast fungus. AB: 12.5 ppm MC07 completely inhibits the germination of rice blast fungus conidia and the formation of appressoriums. CD: Application of 50 ppm MC07 to detached barley leaves provides good preventative effect against rice blast. Detailed Implementation

[0046] The purpose of this invention is to propose a protein chip for screening highly active small molecule compounds, based on a targeted identification technique that uses pathogenic proteins essential for pathogenicity to bind to small molecule compounds with bactericidal activity as potential targets. Through knockout verification and homology analysis, novel pathogenic genes specific to filamentous fungi were identified. PCG10 Key functional domain proteins were purified using a eukaryotic expression system, and small molecule compounds that physically interact with them were further screened using SPR technology. The activity of the compounds was determined by measuring their phenotypes.

[0047] To verify the feasibility and accuracy of this technology, and the value of Pcg10 as a drug target for re-screening, the technical solution adopted in this invention is as follows: 1. Identification of novel genes essential for pathogenicity specific to filamentous fungi Knockout and complement strains were obtained through gene knockout and complementation. Using the wild-type strain as a control, the differences among the three strains in growth rate, sporulation, appressorium formation rate, mycelial expansion, and pathogenicity were determined to confirm their respective characteristics. PCG10 It is an essential gene for the pathogenicity of rice blast fungus. Further analysis and comparison of the amino acid sequence and tertiary structure of Pcg10 and its homologs emphasized the conservation of Pcg10 in filamentous fungi.

[0048] 2. Screening of small molecule compounds based on SPR technology Our laboratory previously created a library of oxazole small molecule compounds (Chinese Patent Publication No. CN202411873152.2, Substituted Oxazole Compounds and Their Preparation Methods and Uses in the Control of Plant Diseases). Using SPR technology, the protein Pcg10-MBD was immobilized on a chip, and small molecules from the compound library were circulated in batches. We screened for MC07, an aryl ether oxazole small molecule compound with a KD of 127 μM, which can bind to the protein.

[0049] 3. Activity verification of MC07 Using the wild-type strain P131 of rice blast fungus as the test object, the MIC of MC07 inhibiting the formation of P131 appressorium was determined to be 25 ppm. Applying 50 ppm of MC07 to detached barley leaves can produce a good preventive effect against rice blast, indicating that the aryl ether oxazole small molecule compound MC07 screened by Pcg10 has high activity in the prevention of rice blast.

[0050] Example 1: Functional conservation of Pcg10 and homologous proteins in other species The amino acid sequence of the rice blast fungus protein Pcg10 was compared with that of NCBI (http: / / www.ncbi.nlm.nih.gov / ) to identify its homologous analogs in different species: FG05_01051 ( Fusarium graminearum ), XP_658019.2 ( Aspergillus nidulans ), KZV09010.1 ( Saccharomyces cerevisiae ), NP_060069.3 ( Homo sapiens Currently, several proteins with sequence homology and similar domain composition to Pcg10 have been reported in mammals, yeast, and Aspergillus nidulans. However, no homologous proteins of Pcg10 have been found in Arabidopsis thaliana and rice, such as... Figure 1 As shown.

[0051] To verify whether Pcg10 also possesses functions similar to homologous proteins in mammals and yeast, corresponding genes were amplified using cDNA from humans, *Saccharomyces cerevisiae*, *Fusarium*, and *Aspergillus nidus*, respectively. The RP27 promoter-driven gene was then constructed. Vezatin , Inp2 , FgPcg10 and VezA Expression vector and transformation PCG10 Protoplasts of the knockout strain K10 were obtained through resistance selection. PCG10 Heterologous complementary strains were identified, and their biological phenotypes were analyzed, such as... Figure 2 As shown.

[0052] 1. Determination of the growth rate of rice blast fungus (1) Take rice blast fungus that has grown on OTA for 5 days, and punch out 3 circular fungal blocks of the same diameter around the colony using a puncher that has been sterilized by alcohol heating.

[0053] (2) Carefully pick up the mycelium block with a toothpick and place it in the center of the OTA plate with the mycelium facing downwards. Invert the OTA plate and place it in a 28℃ light incubator for 5 days.

[0054] (3) Remove the OTA plate from the inoculated culture and take photos according to the colony number. Use a scalpel blade to trace along the edge of the colony. Mark the tangent line. Measure and record the colony diameter; for strains with the same number, take the average of three measurements.

[0055] Experimental results are as follows Figure 2 As shown in Figure A, after 5 days of growth on OTA medium via punching holes, the colony sizes of human gene heterologous complementary strain RP27Vezatin and Saccharomyces cerevisiae gene heterologous complementary strain RP27Inp2 were similar to... PCG10 Knockout individuals are identical to k10 and cannot complement each other. PCG10 The growth phenotype after deletion. The colony size of Fusarium graminearum gene heterologous complementary strain RP27FgPcg10 and Aspergillus nidulans gene heterologous complementary strain RP27VeZA is consistent with that of wild-type strain P131 and complementary strain RP27ck10.

[0056] 2. Determination of the germination rate of rice blast fungus conidia (1) Take a colony of *Blastomyces oryzae* that has grown for about 5 days, add 1 ml of sterile water, use a spreader to break the hyphae, and filter and elute into a 1.5 ml centrifuge tube. Use a hemocytometer to count the conidia in 400 small squares, and adjust the spore concentration to 10 conidia per 400 small squares. Take 7 μL of spore solution and spot it onto a regular coverslip, place it in a moist, dark inoculation box, and incubate it in a 28°C light incubator for 2 h.

[0057] (2) Place a small amount of water on the slide, slowly invert the coverslip onto the slide, use absorbent paper to dry the water that overflows after the coverslip is placed on, observe the germination of conidia on the hydrophobic slide under a microscope, record the data and take pictures of typical parts for preservation.

[0058] like Figure 2 As shown in Figure B, the conidia of RP27Vezatin and RP27Inp2 are similar to those of k10, exhibiting malformation. Two hours after inoculation, the conidia of RP27Vezatin and RP27Inp2 failed to germinate normally. In contrast, the conidia of RP27FgPcg10 and RP27VeZA recovered to normal morphology, similar to wild-type strain P131 and its complement RP27ck10, and all germinated normally.

[0059] 3. Determination of rice blast fungus appressorium formation rate (1) Take a colony of *Blastomyces oryzae* that has grown for about 5 days, add 1 ml of sterile water, use a spreader to break the hyphae, and filter and elute into a 1.5 ml centrifuge tube. Use a hemocytometer to count the conidia in 400 small squares, and adjust the spore concentration to 10 conidia per 400 small squares. Take 7 μL of spore solution and spot it onto a hydrophobic glass slide, place it in a moist and dark inoculation box, and incubate it in a 28℃ light incubator for 8 h.

[0060] (2) Place a small amount of water on the slide, slowly invert the hydrophobic slide onto the slide, use absorbent paper to dry the water that overflows after the coverslip is placed on, observe the formation of appressorium by conidia on the hydrophobic slide under a microscope, record the data and take pictures of typical parts for preservation.

[0061] Observation 12 hours after inoculation onto hydrophobic slides revealed that conidia of RP27FgPcg10 and RP27VeZA could form appressoria normally, while conidia of RP27Vezatin and RP27Inp2 could not form appressoria on the hydrophobic slides. Figure 2 As shown in C.

[0062] 4. Pathogenicity test of rice blast fungus (inoculation by gravid inoculation) (1) Take the middle part of the rice leaf at the four-leaf stage and gently scratch it with a sterilized needle, but do not break it. Use absorbent paper to fix the two ends of the leaf.

[0063] (2) Take colonies that have grown for about 5 days, cut them into small pieces with a sterile blade, with the mycelial side facing the leaf. Inoculate 2-3 mycelial pieces on one leaf, or use 0.25‰ Tween-20 sterile water to wash away conidia from the sporulation plate and adjust the conidia concentration to 1×10⁻⁶. 5Inoculate with 7 μL of spore solution at a concentration of 1 spore / ml. After inoculation, spray the leaves evenly with 0.25‰ Tween-20. Incubate the inoculated leaves in the dark at 28°C for 36 hours under moist conditions, followed by 4 days of light incubation. Measure the length of the lesions and photograph them.

[0064] like Figure 2 As shown in Figure D, the conidial solutions of RP27FgPcg10 and RP27VeZA can normally infect rice leaves, while the conidial solutions of RP27Vezatin and RP27Inp2 cannot. These results indicate that the Pcg10 homologs Vezatin and Inp2 in humans and Saccharomyces cerevisiae have different functions than Pcg10 in *Bacillus oryzae*; while the Pcg10 homologs FgPcg10 and VeZA in the filamentous fungi *Fusarium graminearum* and *Aspergillus nidus* have similar functions to Pcg10. This demonstrates that the functions of Pcg10 and its homologs in filamentous fungi differ from those in mammals and yeast.

[0065] Example 2 Gene PCG10 Evidence of slowing down the mycelial growth rate of rice blast fungus This invention employs gene knockout and gene complementation experiments to demonstrate the role of Pcg10 in the colony growth of *Magnaporum oryzae*. This part includes the construction of knockout and complementation vectors, transformation of *Magnaporum oryzae* protoplasts, obtaining the corresponding transformants, and observing their colony size and morphology.

[0066] 1. Construction of the knockout vector PCR reactions amplify separately PCG10 The upstream 0.85kb fragment and the downstream 0.9kb fragment of the gene were amplified, and the resulting upstream and downstream fragments were digested with BamHI / EcoRI and SalI / KpnI, respectively, and then ligated into the knockout vector pKOV21, which was digested with the same enzymes, to obtain... PCG10 The gene knockout vector pKOP10 and the NotI linearized vector are awaiting transformation. A schematic diagram of the knockout vector construction strategy is shown below. Figure 3 As shown in Figure A.

[0067] Upstream fragment primer UPF: CATGGTACCCGGTCACACGTGAAAG (SEQ ID No: 2) Upstream primer (UPR): CATGTCGACCTGCCATGAAGGGAAG (SEQ ID No: 3) Downstream primer downf: CATGAATTCCCGAGACCTCGCCTAC (SEQ ID No: 4) Downstream primer: CATACTAGTCAGCCCGCCTCAAC (SEQ ID No: 5) 2. Preparation and transformation of protoplasts Mycelia of wild-type P131 rice blast fungus were scraped with a toothpick and crushed. They were then cultured in CM medium (0.6% yeast extract, 0.03% enzymatically hydrolyzed casein, 0.03% acid-hydrolyzed casein, 1% sucrose) at 28°C and 180 rpm / min for 36 hours. The mycelia were then collected in 50 mL centrifuge tubes. Enzyme permeation buffer (containing 20 mg / mL cytotoxic enzyme, prepared with 0.7 M sodium chloride) was added to the centrifuge tubes. The tubes were incubated at 28°C and 180 rpm / min for 3-4 hours. The mycelia were then filtered off using a funnel. The tubes were centrifuged at 4,000 rpm / min for 15 minutes. The supernatant was discarded. The precipitate was washed twice with 25 mL of STC (1.2 M sorbitol, 10 mM Tris, pH 7.5, 50 mM calcium chloride). The protoplast concentration was then adjusted to 1 × 10⁻⁶ using STC. 8 Prepare protoplasts per ml. Aliquot protoplasts into sterile 50mL centrifuge tubes (300μL per tube), add approximately 2μg of knockout vector plasmid to each tube, incubate on ice for 20min, and then add dropwise 2mL / tube of PTC solution (60% polyethylene glycol 3350, 10mM Tris-500). The solution is prepared by incubating at pH 7.5 (50 mM calcium chloride) on ice for 20 min, adding 25 mL of pre-chilled STC per tube, mixing well, centrifuging at 4000 rpm / min and 4°C for 15 min, discarding the supernatant, adding 3 mL of LR medium (0.1% yeast extract, 0.1% enzymatically hydrolyzed casein, 1 M sucrose) to each tube, and incubating at 28°C for 12-18 h. The solution is then transferred to a petri dish, and 15 mL of SR (LR + 1.6% agar) cooled to approximately 50°C is added, mixed well, and allowed to solidify. Then, 15 mL of 0.7% agar containing 400 μg / mL hygromycin (Roche, USA) is spread on top. The solution is incubated at 28°C for 4-6 days. The resulting transformants are then transferred to solid CM medium containing 400 μg / mL neomycin (Roche, USA). The neomycin-resistant transformants are then transferred to oat-tomato agar medium.

[0068] 3. PCR verification of transformants Scrape transformant hyphae cultured to 3-4 cm on an OTA plate into a DNA extraction tube, add small magnetic beads and vortex to disrupt the mycelium. Add 650 μL of CTAB extraction buffer and vortex to mix. Incubate at 65°C for 15 min, inverting occasionally. After cooling to room temperature, add 325 μL of Tris-balanced phenol and 325 μL of chloroform, mix well, and centrifuge at 12000 rpm for 15 min. Transfer 450 μL of the supernatant to a new centrifuge tube, add twice the volume of anhydrous ethanol, precipitate at -20°C for 30 min, centrifuge at 12000 rpm for 15 min, discard the supernatant, wash the precipitate with 70% ethanol, wash the precipitate with anhydrous ethanol, air dry under sterile conditions, dissolve the DNA in 30 μL of double-distilled water or TE buffer, and store at -20°C for later use. Primers for PCR validation: left arm validation primer pair out1 / hu, right arm validation primer pair out2 / hd.

[0069] out1: AGCTGCTGCCGGAAAGGTTG (SEQ ID No: 6) hu: GACAGACGTCGCGGTGAGTT (SEQ ID No: 7) out2: GCCTTGACTCCCAGCAATG (SEQ ID No: 8) hd: GTCCGAGGGCAAAGAAATAG (SEQ ID No: 9) The PCR reaction system is as follows: a 25 μL system contains the following components: 12.5 μL of thermostable polymerase, 1 μL each of two 10 mM up primers (or 1 μL each of two 10 mM down primers), 1 μL of genomic DNA, and 9.5 μL of sterile distilled water. The PCR reaction program is as follows: pre-denaturation stage: 95℃, 3 min; amplification stage: 94℃, 25 s; 52℃, 25 s; 72℃, 1 min, 32 cycles; final extension stage: 72℃, 10 min.

[0070] The PCR products were detected by agarose gel electrophoresis to identify genes for further validation. PCG10 The knockout variant is k10. Further validation was performed using Southern blot. The genomic DNA of wild-type P131 and the knockout variant k10 was completely digested with the restriction endonuclease EcoRV. The left arm was used as a probe, and the probe position is as follows: Figure 3 As shown in Figure A. Using a random primer labeling kit (Takara, Dalian), α-dCT32P isotope labeling was performed. A 4.5 kb target band appeared in lane P131 (wild-type), and a 16.0 kb target band appeared in the knockout transformant k10. This indicates that k10 is a gene... PCG10 A true knockout.

[0071] The hybridization probe primer sequences are as follows: upf: CATGGTACCCGGTCACACGTGAAAG (SEQ ID No.: 2) upr:CATGTCGACCTGCCATGAAGGGAAG (SEQ ID No.: 3) 4. Missing PCG10 The colony growth of strain K10 is slow. a. Gene PCG10 Knockout colony growth rate determination Wild-type strain P131 was activated on OTA culture plates (each liter of culture medium required 40g of cooked oats, 150mL of tomato juice, 0.6g of calcium carbonate, and tap water to a final volume of 1L, dispensed into Erlenmeyer flasks containing 7.5g of agar powder, 400mL per flask). PCG10 Knockout cells, after 4-5 days of growth, were sampled from the edge of the colony using a punch, and the sampled bacterial block was inoculated into the center of a new OTA culture plate. After incubation at 28°C for 120 hours, the colony diameter was measured. The experiment was conducted in triplicate. Results are as follows: Figure 4 As shown, PCG10 The colony diameter of the gene knockout strain k10 was significantly smaller than that of the wild-type strain P131.

[0072] b. Import PCG10 The gene was able to restore the slowed growth rate of its knockout form, k10. Genes PCG10 When introduced into its knockout form k10, it can complement the defects in conidial morphology. The colony growth rate and colony morphology of the complement ck10 are not significantly different from those of the wild-type P131. The complement is obtained by protoplast transformation using a complementation vector.

[0073] 1) Construction of complementary carriers Complementary carriers refer to carriers that contain PCG10 A DNA fragment containing the full-length functional sequence of the gene is ligated into a vector carrying a neomycin resistance gene. The neomycin resistance gene is not a limitation of this invention; other genes that cause antibiotic resistance, i.e., genes that cause fungal resistance other than the neomycin resistance gene, can achieve the same effect.

[0074] First, primers are designed to amplify complete... PCG10The fragment containing the coding sequence was amplified from the wild-type P131 genomic DNA using the forward primer 5'-ATATGGTACCGGTTCATGTTAGTTTTTATTG-3' (SEQ ID No: 12), which has a KpnI restriction site at 5'; and the reverse primer 5'-ATTCTGCAGAGACTAAGAAGTCAG-3' (SEQ ID No: 13), which has a PstI restriction site at 5'. MoPCG10 The nucleotide sequence fragment is 4209 bp, containing a 1500 bp self-promoter and a 500 bp downstream sequence. The target fragment will be digested with the restriction endonuclease SpeI and ligated with a pKN vector digested with both restriction endonucleases KpnI and PstI, ultimately yielding a sequence containing... MoPCG10 And the plasmid vector pKN-PCG10, which selects and labels the neomycin phosphotransferase gene. This vector can be used for gene complementation. PCG10 The knockout body k10.

[0075] The restriction endonucleases, ligases, and Taq enzymes used in the construction process were manufactured by Takara (Dalian) Co., Ltd., and used in accordance with the product instructions.

[0076] 2) Obtaining complementary materials and observing their growth rate The constructed complementary vector pKN-PCG10 was linearized with the restriction endonuclease NotI and then added to the protoplasts of the knockout strain k10. A CaCl2 / PEG-mediated transformation experiment was performed following the protoplast transformation method used in knockout experiments. The upper antibiotic medium was 400 μg / mL neomycin. The complementary strain ck10 was activated on OTA culture plates. After 4-5 days of growth, colony edges were sampled using a punch, and the sampled bacterial blocks were inoculated into the center of a new OTA culture plate. The plates were incubated at 28°C for 120 h, and the colony diameter was measured. The experiment was conducted in triplicate. The results are as follows: Figure 4 As shown, the colony morphology and diameter of complement ck10 were not significantly different from those of wild-type fungus P131. The mycelial growth at the colony edge was sparse, and the colony was dark gray.

[0077] Example 3 PCG10 Affects the germination of conidia and the formation of appressorium of rice blast fungus. Sporulation was performed on wild-type P131, knockout form k10, and complementary form ck10 using the smear method. Conidia were washed with sterile distilled water, filtered through lens paper, and the conidia concentration was adjusted to 1×10⁻⁶. 5 10 μl of spores per mL were pipetted onto a coverslip and incubated at 25°C in the dark for 2 hours. The germination of conidia was then observed using a Nikon Ni 90 microscope. Figure 5 As shown, the results indicated that over 9% of P131 conidia were able to germinate normally, while only about 4% of K10 conidia were able to germinate and produce germ tubes. Similarly, 10 μL of spore suspension was pipetted onto a hydrophobic slide and incubated at 25°C in the dark for 24 hours. Appressorium formation was then observed and photographed using a Nikon Ni 90 microscope. Figure 6 As shown, the few conidia of the K10 strain that were able to germinate were unable to form appressoria normally. In contrast, the conidia of P131 and ck10 were able to form appressoria on hydrophobic surfaces.

[0078] Example 4 PCG10 Affecting the sporulation rate of rice blast fungus Wild-type P131, knockout K10, and complement CK10 were inoculated onto OTA medium and cultured at 28°C for 5-7 days. 1-2 mL of sterile water was added to the colony surface, and the mycelia were broken up using a sterile smear loop. The suspension containing broken mycelia was then evenly spread onto fresh OTA plates. After drying the surface moisture in a laminar flow hood, the plates were incubated at 25°C for 36 hours. New mycelia were broken up using a sterile cotton swab with a small amount of sterile water and rinsed thoroughly with sterile water. The plates were dried in a laminar flow hood, covered with two layers of sterile gauze, and incubated at 28°C for another 48 hours. 30 mL of sterile water was added in batches to the sporulated plates, and the spores were washed off using a smear loop. The spores were then collected, mixed thoroughly, and counted under a microscope using a hemocytometer to calculate the total sporulation per plate. This experiment was repeated three times. PCG10 The sporulation of the knockout form k10 was significantly reduced compared to the wild-type P131 and its complement ck10. For example... Figure 7 As shown in Figure A, very few conidia are produced on the conidiophores of the knockout body k10. After 48 hours of light-induced conidia production on OTA plates, the wild-type P131 produced approximately 3.15 × 10⁻⁶ conidia per plate. 7 The sporulation rate of the knockout strain K10 is only 6 × 10⁶ sporosomes per dish. 4 The yield of K10 conidia was significantly reduced when the number of cells / plate was knocked out, such as... Figure 7 As shown in B.

[0079] Example 5 missing PCG10 The strain K10 completely lost its pathogenicity against the host. 1. Spraying rice seedlings Wild-type P131, knockout form k10, and complement form ck10 were sporulated using the smear method. Conidia were washed off with 0.25% Tween-20 solution, and the mixture of conidia, spores, and hyphae was filtered through lens paper to collect the conidial solution. The conidial concentration was adjusted to 5 × 10⁻⁶ using a hemocytometer. 41 spore / mL was sprayed onto the leaves of 28-day-old Lijiang Xintuan black rice. After 24 hours of dark and humidified culture at 28℃, followed by 5 days of alternating light and dark humidified culture, both wild-type P131 and its complement showed numerous typical rice blast fungus lesions, while the knockout strain K10 showed no lesions. Figure 8 As shown in Figure A.

[0080] 2. Spraying barley seedlings Wild-type P131, knockout form k10, and complement form ck10 were sporulated using the smear method. Conidia were washed off with 0.25% Tween-20 solution, and the mixture of conidia, spores, and hyphae was filtered through lens paper to collect the conidial solution. The conidial concentration was adjusted to 5 × 10⁻⁶ using a hemocytometer. 4 1 spore / mL was sprayed onto the leaves of seedlings of the barley cultivar Emai 9, which is susceptible to blast fungus. After 24 hours of dark and humidified culture at 28℃, followed by alternating light and dark humidified culture for 2-4 days, both wild-type P131 and its complement showed numerous typical blast fungus lesions, while the knockout strain K10 did not show any lesions. Figure 8 As shown in B.

[0081] 3. Scratching the inoculated detached rice leaves Wild-type P131, knockout form k10, and complement form ck10 were sporulated using the smear method. Conidia were washed off with 0.25% Tween-20 solution, and the mixture of conidia, spores, and hyphae was filtered through lens paper to collect the conidial solution. The conidial concentration was adjusted to 5 × 10⁻⁶ using a hemocytometer. 4 One spore / mL was inoculated onto scratched rice leaves. After 24 hours of dark and moist incubation, the leaves were cultured in alternating light and dark conditions for 5 days before photographing. Figure 8 As shown in C, the pathogenicity of the knockout form k10 is significantly lower than that of the wild-type P131, and ck10 can restore pathogenicity to scratched rice leaves.

[0082] Example 6 Prokaryotic expression and purification of Pcg10-MBD Since Pcg10 is a membrane protein with two transmembrane regions, a uniform and stable full-length Pcg10 protein could not be obtained using prokaryotic E. coli expression systems, eukaryotic yeast expression systems, or eukaryotic insect cell expression systems. Therefore, its key structural domain, the Myosin-binding domain (R200-E397), was selected for expression and purification. To improve protein solubility, a rigid region, KLAEAAAKEAAAKEAAAKAAA, was added before the Myosin-binding domain.

[0083] 1. Construction of E. coli protein expression vector: The vector was digested in a 50 μL system for later use. The system included: 2 μg pET28a vector, 2 μL each of restriction endonucleases NcoI and XhoI, 10 μL 5× buffer, and the remaining volume was made up with dd H2O. After digestion at 37℃ for 30 min, gel electrophoresis was performed to ensure that the vector was properly digested, and the vector was recovered using an agarose gel recovery kit.

[0084] Primer amplification sequences were designed based on the vector and the Pcg10 sequence, including: 28a-Pcg10-F:TTAAGAAGGAGATATACCATGAAACTGGCAGAAGCAGCAGCCAAGGAAG (SEQ IDNo: 10) 28a-Pcg10-R: GTGGTGGTGGTGGTGGTGCTCGAGCTCATCCTTCAGGATATC (SEQ ID No: 11) The 50 μL amplification system consisted of: 1 μL template, 2 μL each of 10 μM forward and reverse primers, 25 μL 2× high-fidelity enzyme, and the remaining volume made up with dd H2O. Amplification was performed according to the following PCR program: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 25 s, 58℃ annealing for 25 s, 72℃ extension for 1 min, and 72℃ final extension for 5 min, with 32 cycles of denaturation, annealing, and extension. After gel electrophoresis, the gel was dissected and fragments were recovered using an agarose gel extraction kit, ensuring a fragment concentration higher than 100 ng / μL.

[0085] After obtaining the recovered fragment and the double-digested vector, ligation can be performed using Lamborghini recombinase. A 10 μL recombinant system includes: 300 ng of the recovered fragment, 200 ng of the digested vector, 5 μL of the recombinase mixture, and the remaining volume made up with dd H2O. Ligation is performed at 50°C for 30 min. Trelief™ 5α Chemically Competent Cell competent cells are placed on ice beforehand. After thawing, 10 μL of the ligation product is added to 50 μL of competent cells and mixed well. The mixture is then incubated on ice for 30 min, followed by a 42°C water bath for 45 s, and then on ice for 2 min. 300 μL of antibiotic-free LB liquid medium is added, and the cells are incubated at 37°C with a shaker at 180 rpm for 10 min. After incubation, the cells are transferred to LB solid medium with the corresponding antibiotic, dried in a clean bench, and incubated overnight at 37°C. Single colonies are then picked and cultured, and PCR verification is performed using primers 28a-Pcg10-F and 28a-Pcg10-R. Bacterial cultures amplifying the correct band size are sent for sequencing.

[0086] 2. Protein Expression Analysis (1) Transform the correctly sequenced protein expression vector into the target protein by heat shock. E. coliRosetta (DE3) competent cells; (2) Pick 5 single clones and place them in 4 mL of LB medium containing kana resistance. Shake at 37°C for about 4 h until the OD value is 0.6-0.8. Take 2 mL of bacterial culture from each single clone and add IPTG to the single clones at final concentrations of 0 mM, 0.1 mM, 0.2 mM and 0.3 mM respectively. Shake and culture at 18°C ​​for 8 h. Store the remaining single clones in a refrigerator at 4°C. (3) Centrifuge at 12000 rpm for 1 min, discard the supernatant and collect the induced bacterial cells; (4) Add 50 μL of loading buffer (1x) to resuspend the bacterial cells, then place them in a boiling water bath for 10 mins; finally, centrifuge the samples and perform SDS-PAGE electrophoresis to detect the expression of the target protein. 3. Affinity Chromatography (1) Protein expression preparation: Select single clones with high expression levels during induction, and inoculate the remaining bacterial culture into LB medium (20 mL) containing the corresponding resistance, and incubate overnight at 37°C; add kana antibiotic to 1 L of liquid LB medium and mix well, then add 20 mL of bacterial culture, and incubate in a shaker at 37°C and 220 rpm until the bacterial OD value is 0.6-0.8; select the concentration of IPTG that shows significant induction in protein expression analysis, and incubate overnight at 18°C ​​and 180 rpm.

[0087] (2) Resuspending cells: Centrifuge at 8000 rpm at room temperature and collect the induced cells. Resuspend the cells in 50 mL of buffer A (20 mM pH 7.5 Tris-HCl, 500 mM NaCl, pH 7.5).

[0088] (3) Cell disruption: Cell disruption is performed using an ultrasonic disruptor in an ice-water bath. Before ultrasonication, add 1mM PMSF and 10% glycerol. To avoid local temperature rise leading to protein degradation, disrupt for 3 seconds and pause for 3 seconds. Usually, 1L of cells is disrupted for about 20 minutes.

[0089] (4) Transfer the lysed cell solution into an ultracentrifuge tube, fill it completely, and balance it precisely. Centrifuge at 13,000 rpm for 30 min at 4℃, and collect the supernatant protein.

[0090] (5) Nickel column affinity chromatography: Before protein loading, equilibrate the column with 1-2 column volumes (CV) using equilibration buffer A (20mM pH 7.5 Tris-HCl, 500mM NaCl, pH 7.5); after lysing and centrifuging the bacterial culture, incubate the supernatant with the affinity packing material; after all the sample has passed through, wash the column with 3-4 column volumes of equilibration buffer A; use an imidazole concentration gradient (20mM, 40mM, 60mM, 80mM, 100mM, 500mM) to elute the target protein stepwise; use SDS-PAGE to detect the sample state after elution with different concentrations of imidazole, such as... Figure 9 As shown.

[0091] 4. Gel filtration chromatography Using a concentration tube, the affinity-purified protein eluent is concentrated to approximately 8-10 mg / mL. Then, using the ÄKTA protein purification system, contaminating proteins with significantly different molecular weights are separated for further purification. The protein state is determined based on the elution time, and combined with SDS-PAGE gel chromatography, suitable gel chromatography samples are selected for pooling and concentration. After flash freezing in liquid nitrogen, the samples are stored at -80°C.

[0092] Example 7: Batch screening of compounds based on surface plasmon resonance (SPR) technology Using Biacore 8K + The operation of the high-throughput molecular interaction analyzer is as follows: (1) Power on. Rinse the tubing with Buffer A (1×PBS + 0.005% Tween 20), and select the appropriate pH and concentration to immobilize the protein Pcg10-MBD on the chip. (2) Install the chip. Use Buffer B (1×PBS + 0.005% Tween-20 + 5% DMSO) to gradient dilute the small molecules in the compound library. Set the kinetic program, place the small molecule sample holder, and start the program.

[0093] (3) After the program is completed, replace the maintenance chip and remove the small molecule sample holder. Clean the pipeline with ultrapure water. Perform data analysis.

[0094] Pcg10-MBD and MC07 have a KD of 127 μM, and the data results are as follows: Figure 10 As shown. The chemical structural formula of MC07 is as follows. Figure 11 As shown.

[0095] Example 8 Activity determination of MC07, a small molecule compound of aryl ether oxazole 1. Assay for rice blast fungus appressorium formation (1) Activate wild-type strains on OTA plates, and culture them under light for 4-5 days in an incubator at 28℃. Use sterile toothpicks to scrape off the hyphae, shake them thoroughly to break them, add sterile water, spread them evenly on thick OTA plates, dry them in a clean bench, and then culture them in an incubator at 28℃.

[0096] (2) After 2 days, new mycelia can be seen on the surface of the plate. Use a cotton swab to break the mycelia, rinse the surface of the plate with sterile water, dry it, cover the plate with a single layer of gauze, and continue to place it in a 28℃ light incubator for cultivation. After 2 days, a large number of conidia grow on the surface of the plate.

[0097] (3) Wash the conidia off with sterile water, filter them with microscope paper, and dilute the spore suspension to a concentration of 2×10⁻⁶ using a hemocytometer. 5 Quantity / mL, dispensed into multiple portions.

[0098] (4) Add MC07 mother liquor to conidial suspension to prepare working solutions with small molecule final concentrations of 50ppm, 25ppm, 12.5ppm, 6.25ppm and 3.125ppm, with 1% DMSO as control.

[0099] (6) Moisturize the culture dish with a square petri dish, place hydrophobic slides and mark them. Inoculate two hydrophobic slides for each concentration, and inoculate four points on each hydrophobic slide. Moisturize in the dark at 28°C.

[0100] (7) After 12 hours, observe under a microscope. Take three inoculation points on each hydrophobic slide and record the number of appressoriums formed at the center of each inoculation point for 100 conidia. Take the average of 6 data points for each concentration and calculate the appressorium formation rate of wild-type rice blast fungus under each concentration of MC07. The results are as follows: Figure 12 As shown in AB.

[0101] 2. Inoculation of barley with rice blast fungus (1) The preparation method of the spore suspension is the same as steps (1)-(3) in the determination of rice blast fungus appressorium formation, except that Tween-20 is added to make the final concentration 0.025%. The spore concentration is adjusted to 5×10 using a hemocytometer. 4 Quantity / mL, dispensed into multiple portions.

[0102] (2) Add MC07 mother liquor to conidial suspension to prepare working solutions with small molecule final concentrations of 50ppm, 25ppm, 12.5ppm, 6.25ppm and 3.125ppm, with 1% DMSO as control.

[0103] (3) Barley leaves that have grown to the point of having one leaf and one bud were cut off, and after being kept moist in a petri dish, the leaves were fixed and sprayed with 0.025% Tween-20 solution to facilitate the inoculation of the conidial suspension. Three drops of the conidial suspension prepared in (2) were evenly placed on each barley leaf, and after 24 hours in the dark at 28°C, the leaves were treated with light for 72 hours. The results are as follows. Figure 12 As shown in C.

[0104] Full-length amino acid sequence of Pcg10 protein (SEQ ID No: 1): .

Claims

1. Use of protein Pcg10, its variants, its orthologs, or its functionally active fragments in screening small molecule compounds for resistance to plant pathogenic fungi (preferably blast fungus or Fusarium wilt), wherein the amino acid sequence of said protein Pcg10 is as shown in SEQ ID NO: 1; said variants are proteins having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% sequence identity with SEQ ID NO: 1 and retaining the ability to bind to small molecule ligands; said functionally active fragments are polypeptide fragments containing the small molecule ligand-binding domain of protein Pcg10.

2. The use according to claim 1, characterized in that, The ortholog is derived from filamentous fungi (such as *Fusarium graminearum* and *Aspergillus nidus*); preferably, the ortholog is selected from *Fusarium graminearum* FgPCG10 (gene ID: FG05_01051, ...). Fusarium graminearum ) and Aspergillus nidulans AnPCG10 (GenBank No.: XP_658019.2, Aspergillus nidulans )); Preferably, the functionally active fragment comprises the Myosin-binding domain of protein Pcg10, and more preferably, the fragment corresponding to arginine (R200) ​​to glutamic acid (E397) at positions 200 to 397 in the amino acid sequence (SEQ ID NO: 1), or a functionally equivalent variant thereof. Preferably, the protein Pcg10, its variants, its orthologs, or its functionally active fragments can be modified.

3. A method for screening candidate compounds against plant pathogenic fungi (such as rice blast fungus), the method comprising the following steps: 1) Provide protein Pcg10, its variants, its orthologs, or its functionally active fragments; 2) Under conditions that allow protein-compound interactions, contact the candidate compound with the protein from step 1; 3) Detect whether the candidate compound binds to the protein, or detect the regulatory effect of the candidate compound on the activity of the protein; 4) Select compounds that can bind to or regulate the activity of the protein as lead compounds or candidate compounds for resistance to plant pathogenic fungi; In preferred step 3), the method for detecting binding or modulating effects is based on physical affinity detection techniques, including but not limited to: surface plasmon resonance (SPR), biomembrane interference (BLI), isothermal titration microcalorimetry (ITC), microscale thermophoresis (MST), fluorescence thermal migration (TSA / DSF), or fluorescence polarization (FP).

4. The method according to claim 3, characterized in that, Further, it includes a high-throughput screening step, wherein the candidate compounds are selected from a natural product library, a synthetic compound library, a fragment library, or a virtual screening pre-selection library; and optional follow-up steps, such as in vitro cell-level validation (e.g., fungal growth inhibition assay) or in vivo plant model validation (e.g., barley leaf spraying experiment).

5. A chip or biosensor for screening small molecule compounds against plant pathogenic fungi, the chip or biosensor comprising a solid support and protein Pcg10, its variants, its orthologs or functionally active fragments thereof immobilized on the surface of the solid support. Preferably, the chip is a surface plasmon resonance (SPR) chip, and the protein Pcg10 is immobilized on the dextran matrix or other modified layers on the chip surface by physical adsorption, covalent coupling (such as amino coupling, thiol coupling) or affinity capture (such as biotin-streptavidin, His tag-nickel ion, Fc tag-Protein G).

6. A kit for screening small molecule compounds against plant pathogenic fungi, the kit comprising: 1) Protein Pcg10, its variants, its orthologs, or its functionally active fragments; 2) Buffers used to maintain protein activity; such as pH adjusters, salts, stabilizers (such as glycerol or BSA) and detergents (such as Tween-20). Optionally, the kit also includes a positive control compound capable of binding to protein Pcg10; Optionally, the kit may also include detection reagents for labeling proteins or compounds, such as fluorescent dyes, enzyme-linked substrates, radioisotopes, or nanoparticle tags. Optionally, the protein exists in solution or lyophilized powder form, or is pre-coated on a solid support. Optionally, the kit is a kit for fluorescence polarization (FP) screening containing a fluorescently labeled tracer; or a kit for AlphaScreen screening containing donor microbeads and acceptor microbeads. Optionally, the kit may further include a negative control, a standard curve reagent, and a multi-well plate (such as a 96-well or 384-well plate).

7. A computer-aided virtual screening method, comprising performing molecular docking (Docking) between the three-dimensional structure of a candidate small molecule and the crystal structure or homology modeling structure of protein Pcg10, calculating the binding free energy, thereby predicting compounds with potential activity.

8. Use of the Pcg10 gene or protein Pcg10, its variants, its orthologs or functionally active fragments as targets in inhibiting the growth, reproduction or pathogenicity of plant pathogenic fungi.

9. A method for inhibiting plant pathogenic fungi, the method comprising inhibiting the expression or activity of the Pcg10 gene or Pcg10 protein, its variants, its orthologs or functionally active fragments thereof.

10. Use of an inhibitor of the Pcg10 gene or protein Pcg10, its variants, its orthologs or its functionally active fragments in the inhibition of plant pathogenic fungi, wherein the inhibitor can inhibit the expression or activity of the Pcg10 gene or Pcg10 protein, its variants, its orthologs or its functionally active fragments. Preferably, the inhibitor comprises a small molecule compound; a polypeptide or protein; a nucleic acid molecule; an antibody or antibody fragment; or an RNA interference molecule; preferably, the inhibitor is MC07, the chemical structure of which is shown in Figure 11. Preferably, the inhibitor includes a Pcg10 gene knockout vector, and the Pcg10 gene is knocked out by homologous recombination technology; Preferably, the inhibitor can suppress the growth, reproduction, or pathogenicity of plant pathogens, including slowing mycelial growth rate, slowing colony growth, inhibiting conidial germination, abnormal appressorium formation, reducing sporulation, or causing loss of pathogenicity to the host; the fungus includes *Magnaporthe oryzae* (…). Magnaporthe oryzae Fusarium graminearum ( ), Fusarium graminearum ) or other plant pathogenic fungi; The inhibitor is preferably used in the preparation of pesticide compositions for the control of plant fungal diseases; Preferably, the pesticide composition is applied to plants by spraying, seed soaking, soil treatment or foliar treatment.

Images