Method for improving cowpea seedling by using LED red and blue light
Patent Information
- Application Number
- CN202610544600.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-23
- Publication Date
- 2026-08-21
AI Technical Summary
如今由于环境污染导致极端天气增加了温室透光率降低的风险,在冬春季节温室内照明不足时容易出现幼苗伸长、植株弱势等问题,从而对后期栽培和产量造成负面影响,因此,一种利用LED红蓝光提高豇豆壮苗的方法亟待提出
[0031] This invention treats cowpea crops with red and blue light, comprehensively reflecting the internal condition of the crop through leaf photosynthetic characteristics detection, leaf chlorophyll fluorescence characteristics detection, leaf photosynthetic pigment detection, botanical trait detection, leaf carbohydrate detection, leaf photosynthetic enzyme activity detection, and leaf gene expression level detection. It also accurately measures the photosynthetic products of crop photosynthesis. By analyzing the photosynthetic products under red and blue light conditions, the optimal red and blue light ratio can be accurately and effectively determined, thereby improving seedling vigor and photosynthetic characteristics of crops through red and blue light irradiation.
Smart Images

Figure CN122603746A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a method for improving the vigorous growth of cowpea seedlings using LED red and blue light. Background Technology
[0002] Cowpea (Vigna unguiculata (L.) Walp.) is an annual plant belonging to the genus Vigna in the legume family. As an important legume vegetable crop, it has a long growing season and a short growth cycle. Cowpea is also one of the legumes with significant economic value. Light is the energy source for plant photosynthesis and a crucial environmental factor for plant growth and development. Altering the properties of light can significantly affect plant physiological processes, morphogenesis, and growth, and this effect varies among different plant species. Compared to other light wavelengths, red and blue light are more effectively absorbed by plant pigments. Currently, environmental pollution leading to extreme weather increases the risk of reduced light transmittance in greenhouses. Insufficient lighting in greenhouses during winter and spring can easily cause problems such as seedling elongation and weak plants, negatively impacting later cultivation and yield. Therefore, a method using LED red and blue light to improve cowpea seedling vigor is urgently needed. Summary of the Invention
[0003] To address the shortcomings of existing technologies, this invention provides a method for improving the vigorous growth of cowpea seedlings using LED red and blue light.
[0004] To solve the above-mentioned technical problems, the present invention provides the following technical solution:
[0005] This invention provides a method for improving the vigorous growth of cowpea seedlings using LED red and blue light, comprising the following steps:
[0006] S1. Cowpea crops were treated with red and blue light in different ratios, where R represents red light and B represents blue light. The red and blue light ratios were: R:B=7:3, R:B=4:1, R:B=10:1, R:B=12:1, and R:B=14:1. The red and blue light illumination time was from 6:00 am to 20:00 pm, resulting in cowpea crops after red and blue light treatment.
[0007] S2. Cowpea crops were treated without red and blue light, with a light exposure time of 6:00 am to 20:00 pm, to obtain the control group of cowpea crops;
[0008] S3. Leaf testing was performed on the cowpea crops treated in steps S1 and S2, and seedlings were cultured in Hoagland nutrient solution at an incubator temperature of 16℃-25℃ to obtain multiple sets of test data. The leaf testing included detection of leaf photosynthetic characteristics, leaf chlorophyll fluorescence characteristics, leaf photosynthetic pigments, botanical traits, leaf carbohydrates, leaf photosynthetic enzyme activity, and leaf gene expression levels.
[0009] S4. Based on the changes in data on photosynthetic characteristics, chlorophyll fluorescence characteristics, leaf photosynthetic pigment detection, botanical trait detection, leaf carbohydrate detection, leaf photosynthetic enzyme activity detection, and leaf gene expression level detection, determine whether different ratios of red and blue light treatment have an effect on improving seedling vigor in cowpea crops, and thus determine the optimal red and blue light ratio.
[0010] Preferably, the red and blue light processing time is 5 days.
[0011] Preferably, the leaf photosynthetic characteristic detection includes the following steps:
[0012] On a sunny day from 9:00 am to 12:00 am, the photosynthetic rate (Pn), transpiration rate (Tr), stomatal conductance (Gs), intercellular CO2 concentration (Ci), water use efficiency (WUE), and CO2 use efficiency (CUE) of each cowpea variety were measured.
[0013] Preferably, the detection of leaf chlorophyll fluorescence characteristics includes the following steps:
[0014] Leaves were marked sequentially between 9:00 am and 12:00 am. After 30 minutes of dark adaptation, the chlorophyll fluorescence parameters excited by laser were measured using a multi-channel continuous monitoring-PAM fluorescence spectrometer. The measured parameters included actual photosynthetic efficiency Y(II), photochemical quenching qP, non-photochemical quenching coefficient qN, non-photochemical quenching NPQ, and PSII maximum photosynthetic efficiency Fv / Fm.
[0015] Preferably, the leaf photosynthetic pigment detection includes the following steps:
[0016] Cut the leaves into small pieces and place 0.1 g of the leaves into 10 ml of a mixed extract of 95% ethanol:acetone:water = 4.5:4.5:1. Soak overnight in the dark until the leaves turn completely white. Using the extract as a control, measure the absorbance of the extract at 440, 645, and 663 nm using an ELISA reader. Calculate chlorophyll a (Chl a), chlorophyll b (Chlb), carotenoids (Car), chlorophyll a / b (Chl a / b), and total chlorophyll content (Total Chl a+b).
[0017] Preferably, the botanical trait detection includes the following steps:
[0018] Select 3 healthy plants, measure the length and width of the leaves, plant height and root length with a ruler, measure the stem diameter with a vernier caliper, and calculate the seedling vigor coefficient = (stem diameter / plant height + dry weight of underground part / dry weight of above-ground part) × total dry weight of plant.
[0019] Preferably, the leaf carbohydrate detection includes the following steps:
[0020] Take the leaves and dry them in an oven (105℃ for 30 min, 80℃ for 3~10 h), grind them into powder, and use them to determine the content of soluble sugar, sucrose and starch, which is determined by the anthrone colorimetric method.
[0021] Preferably, the leaf photosynthetic enzyme activity detection includes the following steps:
[0022] The Rubisco activity assay procedure should be performed according to the Solarbio Rubisco Activity Assay Kit instructions.
[0023] Preferably, the leaf gene expression level detection includes the following steps:
[0024] RNA extraction was performed according to the Solarbio Polysaccharide and Polyphenol Plant RNA Extraction Kit instructions. cDNA was then synthesized via reverse transcription using the HiScript® Q RT SuperMix for qPCR (+gDNA wiper) kit from Yisheng Biotechnology. Known cowpea rbcS (NCBI accession number NC_040282.1) and Rca gene sequences (NCBI accession number NC_040279.1) were searched on NBCI, and primers were designed as follows:
[0025] The primer RbcS-F sequence is shown in SEQ ID NO: 1: CAGCAGAACAACAAGTGATTCAGAAG;
[0026] The primer RbcS-R sequence is shown in SEQ ID NO: 2: TGA ACGGAGCCACCATGCC;
[0027] The primer Rca-F sequence is shown in SEQ ID NO: 3: CCAGAGTGTATGATGATGAAGTGAGG;
[0028] The primer Rca-R sequence is shown in SEQ ID NO: 4: GGCTGTTCAAAGGTTGGAGGTC;
[0029] Real-time quantitative PCR was performed using a real-time quantitative PCR instrument (Jena, Germany). The reaction program was as follows: 94℃, 10 s; 94℃, 20 s; 60℃, 20 s (40 cycles in total). Three replicates were performed. Gene expression levels were measured using relative quantitative PCR. -ΔΔCt Calculation by method.
[0030] Compared with the prior art, the present invention has the following beneficial effects:
[0031] This invention treats cowpea crops with red and blue light, comprehensively reflecting the internal condition of the crop through leaf photosynthetic characteristics detection, leaf chlorophyll fluorescence characteristics detection, leaf photosynthetic pigment detection, botanical trait detection, leaf carbohydrate detection, leaf photosynthetic enzyme activity detection, and leaf gene expression level detection. It also accurately measures the photosynthetic products of crop photosynthesis. By analyzing the photosynthetic products under red and blue light conditions, the optimal red and blue light ratio can be accurately and effectively determined, thereby improving seedling vigor and photosynthetic characteristics of crops through red and blue light irradiation. Attached Figure Description
[0032] Figure 1 This invention relates to the effect of different ratios of red and blue light on the net photosynthetic rate of cowpeas.
[0033] Figure 2 This invention relates to the effect of different proportions of red and blue light on the stomatal conductance of cowpeas.
[0034] Figure 3 This invention relates to the effect of different ratios of red and blue light on the intercellular carbon dioxide concentration in cowpeas.
[0035] Figure 4 This invention relates to the effect of different proportions of red and blue light on the transpiration rate of cowpeas.
[0036] Figure 5 This invention relates to the effect of different ratios of red and blue light on the water use efficiency of cowpeas.
[0037] Figure 6 This invention relates to the effect of different ratios of red and blue light on the apparent carbon dioxide utilization efficiency of cowpeas.
[0038] Figure 7 This invention relates to the effect of different ratios of red and blue light on the chlorophyll a content of cowpea leaves.
[0039] Figure 8 This invention relates to the effect of different ratios of red and blue light on the chlorophyll b content of cowpea leaves.
[0040] Figure 9 This invention relates to the effect of different ratios of red and blue light on the carotene content of cowpeas.
[0041] Figure 10 This invention relates to the effect of different ratios of red and blue light on the chlorophyll a / b ratio in cowpea leaves.
[0042] Figure 11 This invention relates to the effect of different ratios of red and blue light on the total chlorophyll content of cowpeas.
[0043] Figure 12 This invention relates to the effect of different ratios of red and blue light on the actual photosynthetic efficiency (Y(Ⅱ)) of cowpea;
[0044] Figure 13 This invention relates to the effect of different ratios of red and blue light on the maximum photosynthetic efficiency (Fv / Fm) of cowpea PSⅡ.
[0045] Figure 14 This invention relates to the effect of different ratios of red and blue light on the photochemical quenching (qP) of cowpeas.
[0046] Figure 15 This invention relates to the effect of different ratios of red and blue light on non-photochemical quenching (NPQ) of cowpeas;
[0047] Figure 16 This invention relates to the effect of different ratios of red and blue light on the non-photochemical quenching coefficient (qN) of cowpeas;
[0048] Figure 17 This invention relates to the effect of different ratios of red and blue light on cowpea leaf length.
[0049] Figure 18 This invention relates to the effect of different ratios of red and blue light on the width of cowpea leaves.
[0050] Figure 19 This invention relates to the effect of different ratios of red and blue light on cowpea plant height.
[0051] Figure 20 This invention relates to the effect of different ratios of red and blue light on the root length of cowpeas.
[0052] Figure 21 This invention relates to the effect of different ratios of red and blue light on the stem diameter of cowpeas.
[0053] Figure 22 This invention relates to the effect of different ratios of red and blue light on the seedling vigor coefficient of cowpeas.
[0054] Figure 23 This invention relates to the effect of different ratios of red and blue light on the soluble sugar content of cowpeas.
[0055] Figure 24 This invention relates to the effect of different ratios of red and blue light on the sucrose content of cowpeas.
[0056] Figure 25 This invention relates to the effect of different ratios of red and blue light on the starch content of cowpeas.
[0057] Figure 26 This invention relates to the effect of different ratios of red and blue light on the Rubisco activity of cowpeas;
[0058] Figure 27 This invention relates to the effect of different ratios of red and blue light on the gene expression level of the small subunit of Rubisco in cowpea.
[0059] Figure 28 This invention relates to the effect of different ratios of red and blue light on the expression level of the Rubiscoactive gene in cowpea.
[0060] Figure 29 This is a flowchart of a method for improving the vigorous growth of cowpea seedlings using LED red and blue light, according to the present invention. Detailed Implementation
[0061] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.
[0062] The inventive concept of this application is as follows: net photosynthetic rate is the most direct indicator of photosynthesis in plants; transpiration rate is an important way for plants to lose water, which can promote the conduction of water in plants and accelerate the transport of minerals. During transpiration, carbon dioxide molecules enter the plant through stomata, thus affecting the photosynthetic rate; leaf stomatal conductance, stomata are the gateways for water vapor and carbon dioxide to enter and exit, and they simultaneously control the photosynthesis and transpiration of plants.
[0063] This embodiment provides a method for improving the vigorous growth of cowpea seedlings using LED red and blue light, including the following steps ( Figure 29 ):
[0064] S1. Cowpea crops were treated with red and blue light in different ratios, where R represents red light and B represents blue light. The red and blue light ratios were: R:B=7:3, R:B=4:1, R:B=10:1, R:B=12:1, and R:B=14:1. The red and blue light illumination time was from 6:00 am to 20:00 pm, resulting in cowpea crops after red and blue light treatment.
[0065] S2. Cowpea crops were treated without red and blue light, with a light exposure time of 6:00 am to 20:00 pm, to obtain the control group of cowpea crops;
[0066] S3. Leaf testing was performed on the cowpea crops treated in steps S1 and S2, and seedlings were cultured in Hoagland nutrient solution at an incubator temperature of 16℃-25℃ to obtain multiple sets of test data. The leaf testing included detection of leaf photosynthetic characteristics, leaf chlorophyll fluorescence characteristics, leaf photosynthetic pigments, botanical traits, leaf carbohydrates, leaf photosynthetic enzyme activity, and leaf gene expression levels.
[0067] S4. Based on the changes in data on photosynthetic characteristics, chlorophyll fluorescence characteristics, botanical traits, leaf carbohydrates, leaf photosynthetic enzyme activity, and leaf gene expression, determine whether different ratios of red and blue light treatments have an impact on cowpea crops, and thus determine the optimal red-blue light ratio.
[0068] Specific red-blue light treatments included red-blue light ratios of 7:3, 4:1, 10:1, 12:1, and 14:1, with cowpea seedlings exposed to light for 5 days. Maintaining consistency in all conditions except for the red-blue light intensity ensured that the red and blue light effectively acted on the cowpea crop, thus improving its photosynthetic efficiency and guaranteeing the accuracy of subsequent experiments.
[0069] In this embodiment of the application, by limiting the processing of red and blue light in different proportions, it is possible to accurately determine whether different proportions of red and blue light have an impact on experimental crops.
[0070] Example 1
[0071] The materials consisted of six cowpea varieties, all provided by the Hubei Provincial Engineering Technology Research Center for Legumes (Vegetables) (see Table 1). The experiment was conducted from March to July 2024 in an LED four-color incubator at the Hubei Provincial Engineering Technology Research Center for Legumes (Vegetables). Plump cowpea seeds of uniform size were selected, soaked, and then sown.
[0072] Table 1. Cowpea Varieties
[0073]
[0074] First, the photosynthetic parameters were measured.
[0075] Five days after red and blue light treatment, from 9:00 am to 12:00 am, the light intensity was set to 1200 μmol / (m²). 2 With a CO2 volume fraction of 0.04% and a temperature of 25℃, the photosynthetic rate (Pn, μmol·m⁻¹) of functional leaves of various cowpea varieties was measured using a LI-6400 portable plant photosynthesis system between 9:00 am and 12:00 am on a sunny day. -2 s -1 ), transpiration rate (Tr, mmol·m -2 s -1 ), porosity (Gs, mol·m) -2 s -1 ), intercellular CO2 concentration (Ci, μmol·mol) -1 Water use efficiency (WUE, μmol·mmol) and CO2 use efficiency (CUE, mol·mmol)-2 ·s -1 ) and other parameters.
[0076] Second, chlorophyll fluorescence parameters were measured.
[0077] Three representative leaves were selected and labeled sequentially between 9:00 am and 12:00 pm. After 30 minutes of dark adaptation, the chlorophyll fluorescence parameters of the plant leaves were measured using a multi-channel continuous monitoring-PAM fluorescence spectrometer (WALZ, Germany). The measured parameters included actual photosynthetic efficiency Y(II), photochemical quenching qP, non-photochemical quenching coefficient qN, non-photochemical quenching NPQ, and PSII maximum photosynthetic efficiency Fv / Fm.
[0078] Third, the determination of photosynthetic pigments.
[0079] Photosynthetic pigment content determination: Cut the leaves into small pieces, and put 0.1 g of the leaves into 10 ml of a mixed extract of ethanol:acetone:water = 4.5:4.5:1. Soak overnight in the dark until the leaves turn completely white. Using the extract as a control, use an enzyme-linked immunosorbent assay (ELISA) reader to measure the absorbance of the extract at 440, 645, and 663 nm. Calculate the content of chlorophyll a (Chla), chlorophyll b (Chl b), carotenoids (Car), chlorophyll a / b (Chl a / b), and total chlorophyll (Total Chl a+b).
[0080] Fourth, determination of botanical traits.
[0081] Select 3 healthy plants, measure the length and width of the leaves, plant height and root length with a ruler, measure the stem diameter with a vernier caliper, and calculate the seedling vigor coefficient = (stem diameter / plant height + dry weight of underground part / dry weight of above-ground part) × total dry weight of plant.
[0082] Fifth, determination of carbohydrate content in leaves.
[0083] Take the leaves and dry them in an oven (105℃ for 30 min, 80℃ for 3~10 h), grind them into powder, and use them to determine the content of soluble sugar, sucrose and starch, which is determined by the anthrone colorimetric method.
[0084] Sixth, determination of photosynthetic enzyme activity in leaves.
[0085] The Rubisco activity assay procedure should be performed according to the Solarbio Rubisco Activity Assay Kit instructions.
[0086] Seventh, gene expression level measurement.
[0087] RNA extraction was performed according to the Solarbio Polysaccharide and Polyphenol Plant RNA Extraction Kit instructions. cDNA was then synthesized via reverse transcription using the HiScript® Q RT SuperMix for qPCR (+gDNA wiper) kit from Yisheng Biotechnology. Known cowpea rbcS (NCBI accession number NC_040282.1) and Rca gene sequences (NCBI accession number NC_040279.1) were searched on NBCI. Primers were designed by Wuhan Bioengineering Co., Ltd. (Table 2). Real-time quantitative PCR was performed using a real-time fluorescence quantitative PCR instrument (Jena, Germany). The reaction program was as follows: 94℃, 10 s; 94℃, 20 s; 60℃, 20 s (40 cycles in total). Three replicates were performed. Gene expression levels were measured using relative quantitative PCR. -ΔΔCt Calculation by method.
[0088] Table 2
[0089]
[0090] Eighth, Results and Analysis.
[0091] All experimental data were tested in triplicate. Data were compiled using Office Excel 2024 and analyzed using IBM SPSS Statistics 26.
[0092] 1. Effects of different ratios of red and blue light on photosynthetic parameters of cowpea leaves.
[0093] Photosynthetic parameters can effectively assess the growth and development status, production potential, and response to environmental changes of plants such as cowpea. Figure 1-6 It can be seen that, compared with the control group without red and blue light, the red and blue light treatment groups significantly improved the photosynthetic efficiency of the six cowpea varieties.
[0094] Depend on Figure 1It was found that, under the red-blue light (R:B=7:3) treatment, the net photosynthetic rate (Pn) of cowpea varieties JD10 and JD11 increased by 12.51% and 12.8% respectively compared with the control group (CK), with significant differences; JD7 decreased by 1.84%, with a significant difference; JD4, JD12, and JD13 showed no significant differences. Under the R:B=4:1 treatment, the Pn of cowpea varieties JD4, JD10, JD11, and JD12 increased by 23.9%, 50.38%, 17.14%, and 20.73% respectively compared with the control group (CK), with significant differences; JD7 and JD13 showed no significant differences. Under the R:B=10:1 treatment, the Pn values of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 38.92%, 22.86%, 69.25%, 38.21%, 40.94%, and 26.21% respectively compared to the control (CK), showing significant differences. Under the R:B=12:1 treatment, the Pn values of cowpea varieties JD10, JD11, JD12, and JD13 increased by 31.98%, 21.24%, 36.8%, and 21.12% respectively compared to the control (CK), showing significant differences; however, there was no significant difference between JD4 and JD7. Under the R:B=14:1 treatment, the Pn values of cowpea varieties JD7, JD10, JD11, JD12, and JD13 increased by 8%, 37.38%, 19.99%, 30.57%, and 17.5% respectively compared to the control (CK), showing significant differences; JD4 showed no significant difference. The Pn responses of different cowpea varieties to different red-blue light ratios showed significant differences, with R:B=10:1 showing the most significant effect on increasing Pn in cowpea varieties.
[0095] Depend on Figure 2It was found that, under the red-blue light (R:B=7:3) treatment, the stomatal conductance (Gs) of cowpea varieties JD4, JD12, and JD13 increased by 50.45%, 80.56%, and 78.43% respectively compared to the control group (CK), showing significant differences; while the differences for JD7, JD10, and JD11 were not significant. Under the R:B=4:1 treatment, the Gs of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 75.51%, 71.99%, 89.11%, 189.66%, and 141.64% respectively compared to the control group (CK), showing significant differences. Under the R:B=10:1 treatment, compared with the control (CK), the glycemic index (Gs) of cowpea varieties JD4, JD10, JD12, and JD13 increased by 61.61%, 24.11%, 99.93%, and 280.62%, respectively, with significant differences; JD7 and JD11 showed no significant difference. Under the R:B=12:1 treatment, compared with the CK, the Gs of cowpea varieties JD10, JD12, and JD13 increased by 96.56%, 92.77%, and 232.94%, respectively, with significant differences; JD4, JD7, and JD11 showed no significant difference. Under the R:B=14:1 treatment, compared with the CK, the Gs of the six cowpea varieties did not differ significantly. The Gs of different cowpea varieties showed significant differences in response to different ratios of red and blue light. Among them, R:B=4:1 and R:B=10:1 had the most significant effect on improving stomatal conductance of cowpea varieties, while R:B=14:1 had no significant effect on stomatal conductance of cowpea.
[0096] Depend on Figure 3It was found that, under the red-blue light (R:B) ratio of 7:3, the intercellular carbon dioxide concentration (Ci) of cowpea varieties JD4, JD11, JD12, and JD13 increased by 11.99%, 5.47%, 23.26%, and 24.23% respectively compared to the control group (CK), with significant differences; while JD7 and JD10 showed no significant difference. Under the R:B ratio of 4:1, compared to the control group (CK), the Ci concentration of cowpea varieties JD4, JD7, JD12, and JD13 increased by 12.47%, 11.91%, 31.71%, and 29.43% respectively, with significant differences; JD11 decreased by 2.76%, with a significant difference; while JD10 showed no significant difference. Under the R:B=10:1 treatment, compared with the control (CK), the Ci (ci) of cowpea varieties JD12 and JD13 increased by 13.86% and 35.33%, respectively, with significant differences; JD10 and JD11 decreased by 9.28% and 3.40%, respectively, with significant differences; JD4 and JD7 showed no significant difference. Under the R:B=12:1 treatment, compared with the control (CK), the Ci of cowpea varieties JD10, JD12, and JD13 increased by 9.04%, 13.51%, and 31.73%, respectively, with significant differences; JD11 decreased by 3.16%, with a significant difference; JD4 and JD7 showed no significant difference. Under the R:B=14:1 treatment, the Ci (Ci) concentration in cowpea varieties JD12 and JD13 increased by 10.18% and 21.39% respectively compared to the control (CK), showing significant differences. Conversely, it decreased by 7.90%, 10.43%, 16.20%, and 10.57% for JD4, JD7, JD10, and JD11, also showing significant differences. The Ci responses of different cowpea varieties to different red-blue light ratios showed significant differences. R:B=7:3 and R:B=4:1 had the most significant effects on increasing the intercellular carbon dioxide concentration in cowpea varieties, while R:B=14:1 significantly decreased the intercellular carbon dioxide concentration.
[0097] Depend on Figure 4The results showed that under the red-blue light (R:B = 7:3) treatment, the transpiration rate (Tr) of cowpea varieties JD11 and JD12 increased by 48.35% and 47.53% respectively compared to the control group (CK), with significant differences; while JD4, JD7, JD10, and JD13 showed no significant differences. Under the R:B = 4:1 treatment, the Tr of cowpea varieties JD7, JD10, JD12, and JD13 increased by 34.16%, 38.96%, 77.52%, and 48.28% respectively compared to the control group (CK), with significant differences; while JD4 and JD11 showed no significant differences. Under the R:B = 10:1 treatment, the Tr of cowpea varieties JD13 increased by 38.19% compared to the control group (CK), with significant differences; while JD4, JD7, JD10, JD11, and JD12 showed no significant differences. Under the R:B=12:1 treatment, the transpiration rate (Tr) of cowpea varieties JD12 and JD13 increased by 18.37% and 47.15% respectively compared to the control (CK), showing significant differences; JD4, JD7, JD10, and JD11 showed no significant differences. Under the R:B=14:1 treatment, the Tr of cowpea varieties JD12 increased by 28.52% compared to the CK, showing a significant difference; JD10 decreased by 35.54%, showing a significant difference; JD4, JD7, JD11, and JD13 showed no significant differences. The Tr responses of different cowpea varieties to different red-blue light ratios showed significant differences, with R:B=4:1 showing the most significant increase in transpiration rate, followed by R:B=10:1.
[0098] Depend on Figure 5It was found that, under the red-blue light (R:B = 7:3) treatment, the water use efficiency (WUE) of cowpea varieties was significantly lower in variety JD11 compared to the control group (CK) by 24.88%; the differences were not significant for JD4, JD7, JD10, JD12, and JD13. Under the R:B = 4:1 treatment, the WUE of cowpea varieties was significantly higher in variety JD13 compared to the control group (CK) by 27.57%; the differences were not significant for JD4, JD7, JD10, JD11, and JD12. Under the R:B = 10:1 treatment, the WUE of cowpea varieties was significantly higher in varieties JD10 and JD12 compared to the control group (CK) by 38.77% and 46.53%, respectively; the differences were not significant for JD4, JD7, JD11, and JD13. Under the R:B=12:1 treatment, the water use efficiency (WUE) of cowpea varieties JD10 increased by 28.36% compared to the control (CK), a significant difference; JD4, JD7, JD11, JD12, and JD13 showed no significant difference. Under the R:B=14:1 treatment, the WUE of cowpea varieties JD4, JD10, JD11, and JD13 increased by 43.04%, 104.15%, 60.82%, and 25.54% respectively compared to the control (CK), a significant difference; JD7 and JD12 showed no significant difference. The response of different cowpea varieties to different ratios of red and blue light showed significant differences, with R:B=14:1 showing the most significant improvement in water use efficiency for cowpea varieties.
[0099] Depend on Figure 6It can be seen that, under the red-blue light (R:B) ratio of 7:3, compared with the control group (CK), the apparent carbon dioxide use efficiency (CUE) of cowpea varieties was significantly higher at 17.94% for variety JD10 and significantly lower at 18.92% for JD13; while there were no significant differences for JD4, JD7, JD11, and JD12. Under the R:B ratio of 4:1, compared with the control group (CK), the apparent CUE of cowpea varieties was significantly higher at 44.49% for JD10 and 20.51% for JD11; significantly lower at 16.93% for JD13; while there were no significant differences for JD4, JD7, and JD12. Under the R:B=10:1 treatment, compared with the control (CK), the CUE of cowpea varieties JD4, JD7, JD10, JD11, and JD12 increased by 27.64%, 35.03%, 86.39%, 42.91%, and 24.11%, respectively, with significant differences; JD13 showed no significant difference. Under the R:B=12:1 treatment, compared with the control (CK), the CUE of cowpea varieties JD10, JD11, and JD12 increased by 20.86%, 25.08%, and 19.44%, respectively, with significant differences; JD4, JD7, JD12, and JD13 showed no significant difference. Under the R:B=14:1 treatment, the CUE of cowpea varieties JD4, JD7, JD10, JD11, and JD13 increased by 33.28%, 34.42%, 63.66%, 60.07%, and 24.97% respectively compared to the control (CK), showing significant differences; JD12 showed no significant difference. The CUE responses of different cowpea varieties to different red-blue light ratios showed significant differences, with R:B=10:1 and R:B=14:1 showing the most significant improvements in apparent carbon dioxide use efficiency.
[0100] 2. Effects of different ratios of red and blue light on chlorophyll fluorescence parameters of cowpea leaves.
[0101] Depend on Figure 12It can be seen that, under the red-blue light R:B=7:3 treatment, the actual photosynthetic efficiency (Y(II)) of cowpea varieties JD12 and JD13 increased by 56.78% and 13.23% respectively compared with the control group CK, with significant differences; JD4, JD7, JD10, and JD11 showed no significant differences. Under the R:B=4:1 treatment, the Y(II) of cowpea varieties JD11, JD12, and JD13 increased by 6.26%, 66.28%, and 22.16% respectively compared with CK, with significant differences; JD4, JD7, and JD10 showed no significant differences. Under the R:B=10:1 treatment, compared with the control (CK), the Y(II) of cowpea varieties JD4, JD10, JD11, JD12, and JD13 increased by 6.13%, 8.50%, 8.19%, 64.97%, and 23.19%, respectively, with significant differences; JD7 showed no significant difference. Under the R:B=12:1 treatment, compared with the control (CK), the Y(II) of cowpea varieties JD11, JD12, and JD13 increased by 6.19%, 73.89%, and 27.23%, respectively, with significant differences; JD4, JD7, and JD10 showed no significant differences. Under the R:B=14:1 treatment, compared with the CK, the Y(Ⅱ) of cowpea varieties JD12 and JD13 increased by 38.39% and 13.03% respectively, with significant differences; JD11 decreased by 5.87%, with significant differences; JD4, JD7 and JD10 showed no significant differences.
[0102] Depend on Figure 13It was found that, under the red-blue light (R:B) ratio of 7:3, the maximum photosynthetic efficiency (Fv / Fm) of cowpea varieties under PSII was significantly increased by 3.12%, 52.31%, and 10.64% for varieties JD7, JD12, and JD13 compared to the control group (CK); however, the differences were not significant for JD4, JD10, and JD11. Under the R:B ratio of 4:1, the Fv / Fm of cowpea varieties under the R:B ratio was significantly increased by 3.35%, 3.82%, 64.40%, and 16.53% for varieties JD7, JD11, JD12, and JD3 compared to the control group (CK); however, the differences were not significant for JD4 and JD10. Under the R:B=10:1 treatment, the Fv / Fm ratios of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 7.36%, 7.79%, 8.04%, 8.62%, 63.74%, and 18.39% respectively compared to the control (CK), showing significant differences. Under the R:B=12:1 treatment, the Fv / Fm ratios of cowpea varieties JD7, JD11, JD12, and JD13 increased by 6.46%, 4.94%, 68.72%, and 22.47% respectively compared to the control (CK), showing significant differences; however, there was no significant difference between JD4 and JD10. Under the R:B=14:1 treatment, the Fv / Fm ratio of cowpea varieties JD4, JD12, and JD13 increased by 4.18%, 63.59%, and 16.84% respectively compared with the CK, with significant differences; while JD7, JD10, and JD11 showed no significant difference.
[0103] Depend on Figure 14 The results showed that under the red-blue light R:B=7:3 treatment, the photochemical quenching (qP) of cowpea varieties was significantly increased by 3.15% in variety JD13 compared to the control group (CK); the differences were not significant for JD4, JD7, JD10, JD11, and JD12. Under the R:B=4:1 treatment, the qP of cowpea varieties was significantly increased by 5.20% in variety JD13 compared to the control group (CK); the differences were not significant for JD4, JD7, JD10, JD11, and JD12. Under the R:B=10:1 treatment, the qP of cowpea varieties was significantly increased by 4.02% in variety JD13 compared to the control group (CK); the differences were not significant for JD4, JD7, JD10, JD11, and JD12. Under the R:B=12:1 treatment, compared with the control (CK), the qP (quantitative percentage point) of cowpea varieties JD13 increased by 3.73%, a significant difference; JD10 decreased by 10.08%, a significant difference; JD4, JD7, JD11, and JD12 showed no significant differences. Under the R:B=14:1 treatment, compared with the control (CK), the qP of cowpea varieties JD4, JD11, and JD12 decreased by 6.03%, 9.22%, and 15.38%, respectively, a significant difference; JD7, JD10, and JD13 showed no significant differences.
[0104] Depend on Figure 15It was found that, under the red-blue light R:B=7:3 treatment, the non-photochemical quenching (NPQ) of cowpea varieties was significantly increased by 317.89% in variety JD12 compared to the control group (CK), while it was significantly decreased by 59.40% in variety JD10. No significant differences were observed in varieties JD4, JD7, JD11, and JD13. Under the R:B=4:1 treatment, the qP of cowpea varieties was significantly decreased by 76.01% in variety JD10 compared to the control group (CK), while no significant differences were observed in varieties JD4, JD7, JD11, JD12, and JD13. Under the R:B=10:1 treatment, compared to the control (CK), variety JD12 showed a 73.17% increase in qP (quantitative probability), which was statistically significant; while JD4, JD7, JD10, and JD11 showed decreases of 57.79%, 71.08%, 83.14%, and 62.36%, respectively, which were statistically significant; JD13 showed no significant difference. Under the R:B=12:1 treatment, compared to the control (CK), variety JD12 showed an 88.62% increase in qP, which was statistically significant; while JD4, JD7, JD10, and JD11 showed decreases of 63.57%, 52.55%, 61.61%, and 49.65%, respectively, which were statistically significant; JD13 showed no significant difference. Under the R:B=14:1 treatment, the qP of cowpea varieties JD12 increased by 100.81% compared to the CK, which was significant; JD4, JD7, and JD10 decreased by 49.75%, 61.10%, and 66.93% respectively, which were also significant; JD11 and JD13 did not show significant differences.
[0105] Depend on Figure 16It was found that, under the red-blue light R:B=7:3 treatment, the non-photochemical quenching coefficient (qN) of cowpea varieties increased by 239.25% significantly compared to the control group (CK), while JD10 decreased by 55.92% significantly; the differences for JD4, JD7, JD11, and JD13 were not significant. Under the R:B=4:1 treatment, the qP of cowpea varieties increased by 200.54% significantly compared to the control group (CK), while JD10 decreased by 73.92% significantly; the differences for JD4, JD7, JD11, and JD13 were not significant. Under the R:B=10:1 treatment, the qP of cowpea varieties JD4, JD7, JD10, and JD11 decreased by 56.99%, 71.26%, 82.12%, and 63.03% respectively compared to the control (CK), showing significant differences; while the differences between JD12 and JD13 were not significant. Under the R:B=12:1 treatment, the qP of cowpea varieties JD4, JD7, JD10, and JD11 decreased by 61.72%, 54.25%, 59.57%, and 50.00% respectively compared to the control (CK), showing significant differences; while the differences between JD12 and JD13 were not significant. Under the R:B=14:1 treatment, the qP of cowpea varieties JD4, JD7, and JD10 decreased by 47.74%, 59.52%, and 64.58% respectively compared with the CK, with significant differences; while JD11, JD12, and JD13 did not show significant differences.
[0106] 3. Effects of different ratios of red and blue light on photosynthetic pigments in cowpea leaves.
[0107] Depend on Figure 7-11 It can be seen that, compared with the control group without red and blue light, the red and blue light treatment groups significantly improved the photosynthetic efficiency of the six cowpea varieties.
[0108] Depend on Figure 7It was found that, under the red-blue light (R:B=7:3) treatment, the chlorophyll a (Chl a) of cowpea varieties JD4 and JD10 increased by 50.30% and 113.75% respectively compared to the control group (CK), with significant differences; while JD7, JD11, JD12, and JD13 showed no significant differences. Under the R:B=4:1 treatment, the Chl a of cowpea varieties JD7 and JD10 increased by 66.39% and 31.02% respectively compared to the control group (CK), with significant differences; while JD4, JD11, JD12, and JD13 showed no significant differences. Under the R:B=10:1 treatment, compared with the control (CK), the Chl a content of cowpea varieties JD4, JD7, and JD10 increased by 32.42%, 31.92%, and 31.58%, respectively, with significant differences; while JD11 and JD13 decreased by 15.15% and 9.36%, respectively, with significant differences; JD12 showed no significant difference. Under the R:B=12:1 treatment, compared with the control (CK), the Chl a content of cowpea varieties JD10 increased by 44.68%, with a significant difference; while JD11 and JD13 decreased by 17.56% and 25.42%, respectively, with significant differences; while JD4, JD7, and JD12 showed no significant differences. Under the R:B=14:1 treatment, compared with the control, the Chl a of cowpea varieties JD4, JD7, JD10, and JD11 increased by 55.34%, 73.28%, 49.00%, and 32.86%, respectively, with significant differences; JD13 decreased by 13.55%, with a significant difference; and JD12 showed no significant difference.
[0109] Depend on Figure 8It was found that, under the red-blue light (R:B=7:3) treatment, the chlorophyll b (Chl b) of cowpea varieties JD4 and JD10 increased by 31.09% and 103.36% respectively compared to the control group (CK), with significant differences; while JD7 and JD11 decreased by 23.20% and 19.66% respectively, with significant differences; the differences between JD12 and JD13 were not significant. Under the R:B=4:1 treatment, the Chl b of cowpea varieties JD7 and JD10 increased by 54.69% and 23.12% respectively compared to the control group (CK), with significant differences; the differences between JD4, JD11, JD12, and JD13 were not significant. Under the R:B=10:1 treatment, compared with the control (CK), the Chl b of cowpea varieties JD4, JD7, and JD11 increased by 18.23%, 28.65%, and 19.22%, respectively, with significant differences; JD13 decreased by 14.57%, with a significant difference; and there was no significant difference between JD10 and JD12. Under the R:B=12:1 treatment, compared with the control (CK), the Chl b of cowpea varieties JD10 increased by 29.89%, with a significant difference; JD11, JD12, and JD13 decreased by 27.62%, 13.50%, and 29.95%, respectively, with significant differences; and there was no significant difference between JD4 and JD7. Under the R:B=14:1 treatment, compared with the control, the Chlb of cowpea varieties JD4, JD7, JD10, and JD11 increased by 46.91%, 54.08%, 76.85%, and 23.25%, respectively, with significant differences; JD13 decreased by 11.45%, with a significant difference; and JD12 showed no significant difference.
[0110] Depend on Figure 9It was found that, under the red-blue light (R:B=7:3) treatment, the carotenoid (Car) content of cowpea varieties JD4 and JD10 increased by 62.22% and 120.37% respectively compared to the control group (CK), with significant differences; while the differences were not significant for JD7, JD11, JD12, and JD13. Under the R:B=4:1 treatment, the Car content of cowpea varieties JD4, JD7, and JD10 increased by 22.82%, 73.64%, and 34.88% respectively compared to the control group (CK), with significant differences; while the differences were not significant for JD11, JD12, and JD13. Under the R:B=10:1 treatment, compared with the control (CK), the car (car) of cowpea varieties JD4, JD7, and JD10 increased by 36.41%, 36.73%, and 38.85%, respectively, with significant differences; JD11 and JD13 decreased by 13.39% and 10.85%, respectively, with significant differences; JD12 showed no significant difference. Under the R:B=12:1 treatment, compared with the control (CK), the car (car) of cowpea varieties JD10 increased by 47.52%, with a significant difference; JD11, JD12, and JD13 decreased by 20.16%, 12.30%, and 29.92%, respectively, with significant differences; JD4 and JD7 showed no significant difference. Under the R:B=14:1 treatment, the car of cowpea varieties JD4, JD7, and JD10 increased by 70.95%, 83.19%, and 76.50% respectively compared with the CK, with significant differences; JD13 decreased by 14.75%, with significant differences; JD11 and JD12 showed no significant differences.
[0111] Depend on Figure 10It was found that, under the red-blue light (R:B) ratio of 7:3, the chlorophyll a / b ratio of cowpea varieties JD4, JD7, and JD11 increased by 14.62%, 30.61%, and 15.28% respectively compared to the control group (CK), with significant differences; while the differences were not significant for JD10, JD12, and JD13. Under the R:B ratio of 4:1, the chlorophyll a / b ratio of cowpea varieties JD4, JD7, JD10, and JD11 increased by 6.56%, 7.54%, 6.45%, and 7.47% respectively compared to the control group (CK), with significant differences; while the chlorophyll a / b ratio decreased by 4.57% for JD13, with a significant difference; while the difference was not significant for JD12. Under the R:B=10:1 treatment, the Chl a / b ratio of cowpea varieties JD4, JD10, JD11, JD12, and JD13 increased by 12.02%, 10.31%, 20.63%, 10.16%, and 6.18% respectively compared to the control (CK), showing significant differences; JD7 showed no significant difference. Under the R:B=12:1 treatment, the Chl a / b ratio of cowpea varieties JD7, JD10, JD11, JD12, and JD13 increased by 10.60%, 11.42%, 13.93%, 7.47%, and 6.43% respectively compared to the control (CK), showing significant differences; JD4 showed no significant difference. Under the R:B=14:1 treatment, the Chl a / b ratio of cowpea varieties JD4, JD7, JD11, and JD12 increased by 5.75%, 12.35%, 7.94%, and 3.55% respectively compared with the control (CK), showing significant differences; JD10 decreased by 15.33%, showing a significant difference; and JD13 showed no significant difference.
[0112] Depend on Figure 11It was found that, under the red-blue light (R:B=7:3) treatment, the total chlorophyll (Total Chl) of cowpea varieties increased by 44.78% and 110.87% respectively compared to the control group (CK), with significant differences; while JD7 decreased by 6.35%, with significant differences; JD11, JD12, and JD13 showed no significant differences. Under the R:B=4:1 treatment, the total Chl of cowpea varieties increased by 28.83% compared to the control group (CK), with significant differences; while JD4, JD7, JD11, JD12, and JD13 showed no significant differences. Under the R:B=10:1 treatment, compared with the control (CK), the total Chl of cowpea varieties JD4, JD7, and JD10 increased by 28.35%, 31.00%, and 28.15%, respectively, with significant differences; JD11 and JD13 decreased by 19.40% and 10.74%, respectively, with significant differences; JD12 showed no significant difference. Under the R:B=12:1 treatment, compared with the control (CK), the total Chl of cowpea varieties JD10 increased by 40.58%, with a significant difference; JD11 and JD13 decreased by 20.51% and 26.62%, respectively, with significant differences; JD4, JD7, and JD12 showed no significant differences. Under the R:B=14:1 treatment, compared with the CK, the total Chl values of cowpea varieties JD4, JD7, JD10, and JD11 increased by 52.92%, 67.84%, 56.72%, and 30.05%, respectively, with significant differences; JD13 decreased by 13.00%, with a significant difference; and JD12 showed no significant difference.
[0113] 4. Effects of different ratios of red and blue light on botanical traits of cowpea leaves.
[0114] Depend on Figure 17It was found that under the red-blue light (R:B=7:3) treatment, the leaf length of cowpea variety JD12 decreased by 10.76% compared to the control group (CK), a significant difference; the differences for JD4, JD7, JD10, JD11, and JD13 were not significant. Under the R:B=4:1 treatment, the leaf length of cowpea varieties JD4, JD7, JD10, and JD13 increased by 21.69%, 15.81%, 23.03%, and 31.66% respectively compared to the control group (CK), a significant difference; the differences between JD11 and JD13 were not significant. Under the R:B=10:1 treatment, compared with the control (CK), the leaf length of cowpea varieties JD4, JD7, and JD13 increased by 24.34%, 11.16%, and 10.05%, respectively, with significant differences; JD12 decreased by 12.11%, with a significant difference; JD10 and JD11 showed no significant difference. Under the R:B=12:1 treatment, compared with the control (CK), the leaf length of cowpea varieties JD4, JD7, JD11, and JD13 increased by 13.76%, 11.63%, 25.00%, and 7.54%, respectively, with significant differences; JD10 and JD12 showed no significant difference. Under the R:B=14:1 treatment, compared with the control (CK), the leaf length of cowpea varieties JD7 and JD10 increased by 12.09% and 19.66% respectively, with significant differences; JD4 decreased by 19.05%, with significant differences; JD11, JD12, and JD13 showed no significant differences.
[0115] Depend on Figure 18 It was found that under the red-blue light (R:B=7:3) treatment, the leaf width of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 was not significantly different from the control group (CK). Under the R:B=4:1 treatment, the leaf width of cowpea varieties JD10, JD11, JD12, and JD13 increased by 27.10%, 19.51%, 16.07%, and 27.73% respectively compared to the control group (CK), with significant differences; JD4 and JD7 showed no significant difference. Under the R:B=10:1 treatment, the leaf width of cowpea varieties JD4 and JD13 increased by 22.05% and 22.69% respectively compared to the control group (CK), with significant differences; JD7, JD10, JD11, and JD12 showed no significant difference. Under the R:B=12:1 treatment, the leaf width of cowpea variety JD11 increased by 22.76% compared to the control (CK), a significant difference; the differences were not significant for JD4, JD7, JD10, JD12, and JD13. Under the R:B=14:1 treatment, the leaf width of cowpea variety JD4 increased by 20.47% compared to the control (CK), a significant difference; the differences were not significant for JD7, JD10, JD11, JD12, and JD13.
[0116] Depend on Figure 19The results showed that under the red-blue light (R:B=7:3) treatment, the plant height of cowpea variety JD12 decreased by 27.21% compared to the control group (CK), a significant difference; JD4, JD7, JD10, JD11, and JD13 showed no significant differences. Under the R:B=4:1 treatment, the plant height of cowpea varieties JD7, JD10, JD11, and JD13 increased by 25.80%, 27.99%, 29.24%, and 39.18% respectively compared to the control group (CK), a significant difference; JD4 and JD12 showed no significant differences. Under the R:B=10:1 treatment, the plant height of cowpea variety JD13 increased by 24.14% compared to the control group (CK), a significant difference; JD4, JD7, JD10, JD11, and JD12 showed no significant differences. Under the R:B=12:1 treatment, compared with the control (CK), the plant height of cowpea varieties JD4, JD7, JD11, and JD13 increased by 26.93%, 48.67%, 82.77%, and 35.74%, respectively, with significant differences; the difference between JD10 and JD12 was not significant. Under the R:B=14:1 treatment, compared with the control (CK), the plant height of cowpea varieties JD7, JD11, JD12, and JD13 increased by 40.43%, 81.20%, 41.16%, and 39.81%, respectively, with significant differences; the difference between JD4 and JD10 was not significant.
[0117] Depend on Figure 20 The results showed that under the red-blue light (R:B=7:3) treatment, the root length of cowpea variety JD11 increased by 67.11% compared to the control group (CK), a significant difference; the root lengths of JD4, JD7, JD10, JD12, and JD13 did not show significant differences. Under the R:B=4:1 treatment, the root lengths of cowpea varieties JD7, JD10, and JD11 increased by 42.55%, 43.75%, and 49.47% respectively compared to the control group (CK), a significant difference; the root lengths of JD4, JD12, and JD13 did not show significant differences. Under the R:B=10:1 treatment, the root length of cowpea variety JD13 increased by 20.96% compared to the control group (CK), a significant difference; the root lengths of JD4, JD7, JD10, JD11, and JD12 did not show significant differences. Under the R:B=12:1 treatment, the root length of cowpea variety JD11 increased by 48.68% compared to the control (CK), a significant difference; the root lengths of JD4, JD7, JD10, JD12, and JD13 showed no significant differences. Under the R:B=14:1 treatment, the root length of cowpea variety JD10 increased by 42.93% compared to the control (CK), a significant difference; the root lengths of JD4, JD7, JD11, JD12, and JD13 showed no significant differences.
[0118] Depend on Figure 21It can be seen that, under the red-blue light (R:B=7:3) treatment, the stem diameter of cowpea varieties JD10 increased by 10.43% compared to the control group (CK), with a significant difference; the differences for JD4, JD7, JD11, JD12, and JD13 were not significant. Under the R:B=4:1 treatment, the stem diameter of cowpea varieties JD4, JD7, JD10, JD12, and JD13 increased by 24.43%, 9.50%, 25.57%, 14.16%, and 23.80% respectively compared to the control group (CK), with significant differences; the difference for JD11 was not significant. Under the R:B=10:1 treatment, compared with the control (CK), the stem diameter of cowpea varieties JD4, JD7, JD10, JD12, and JD13 increased by 27.18%, 21.50%, 21.04%, 24.23%, and 26.84%, respectively, with significant differences. Under the R:B=12:1 treatment, compared with the CK, the stem diameter of cowpea varieties JD7 and JD10 increased by 18.17% and 17.04%, respectively, with significant differences; JD4, JD11, JD12, and JD13 showed no significant differences. Under the R:B=14:1 treatment, compared with the CK, the stem diameter of cowpea varieties JD10 and JD12 increased by 18.78% and 21.50%, respectively, with significant differences; JD4 decreased by 16.79%, with significant differences; JD7, JD11, and JD13 showed no significant differences.
[0119] Depend on Figure 22It can be seen that, under the red-blue light (R:B=7:3) treatment, the seedling vigor coefficient of cowpea varieties JD4, JD7, JD10, JD11, and JD13 increased by 107.45%, 118.04%, 174.57%, 139.56%, and 43.54% respectively compared with the control group (CK), with significant differences; while JD12 showed no significant difference. Under the R:B=4:1 treatment, the seedling vigor coefficient of cowpea varieties JD4, JD7, JD10, JD11, and JD13 increased by 134.71%, 134.45%, 168.77%, 149.57%, and 66.73% respectively compared with the control group (CK), with significant differences; while JD12 showed no significant difference. Under the R:B=10:1 treatment, the seedling vigor coefficient of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 140.15%, 215.72%, 158.57%, 161.74%, 36.53%, and 65.24% respectively compared to the control (CK), showing significant differences. Under the R:B=12:1 treatment, the seedling vigor coefficient of cowpea varieties JD7, JD10, and JD11 increased by 99.92%, 138.39%, and 117.41% respectively compared to the control (CK), showing significant differences; while the differences for JD4, JD12, and JD13 were not significant. Under the R:B=14:1 treatment, the seedling vigor coefficient of cowpea varieties JD11 increased by 61.91% compared with CK, which was significant; JD4, JD7, JD10, JD12, and JD13 did not show significant differences.
[0120] 5. Effects of different ratios of red and blue light on carbohydrates in cowpea leaves.
[0121] Depend on Figure 23It was found that, under the red-blue light (R:B=7:3) treatment, the soluble sugar content of cowpea varieties JD4, JD7, JD10, and JD11 increased by 652.60%, 81.41%, 65.19%, and 146.03% respectively compared to the control group (CK), showing significant differences; while the differences between JD12 and JD13 were not significant. Under the R:B=4:1 treatment, the soluble sugar content of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 828.40%, 82.38%, 242.72%, 387.59%, 496.49%, and 248.92% respectively compared to the control group (CK), showing significant differences. Under the R:B=10:1 treatment, the soluble sugar content of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 149.99%, 147.40%, 103.55%, 181.79%, 357.98%, and 178.20% respectively compared to the control (CK), showing significant differences. Under the R:B=12:1 treatment, the soluble sugar content of cowpea varieties JD7, JD10, JD11, JD12, and JD13 increased by 81.78%, 152.22%, 36.12%, 439.63%, and 91.64% respectively compared to the control (CK), showing significant differences; JD4 showed no significant difference. Under the R:B=14:1 treatment, the soluble sugar content of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 360.65%, 72.74%, 247.82%, 178.21%, 300.89%, and 62.57% respectively compared with the control, showing significant differences.
[0122] Depend on Figure 24It was found that, under the red-blue light (R:B=7:3) treatment, the sucrose content of cowpea varieties JD4, JD12, and JD13 increased by 104.29%, 119.17%, and 247.79% respectively compared to the control group (CK), with significant differences; while JD7, JD10, and JD11 showed no significant differences. Under the R:B=4:1 treatment, the sucrose content of cowpea varieties JD4, JD12, and JD13 increased by 233.13%, 212.44%, and 389.38% respectively compared to the control group (CK), with significant differences; while JD7, JD10, and JD11 showed no significant differences. Under the R:B=10:1 treatment, the sucrose content of cowpea varieties JD4, JD7, JD11, JD12, and JD13 increased by 202.45%, 121.39%, 240.60%, 88.08%, and 353.98% respectively compared to the control (CK), showing significant differences; JD10 showed no significant difference. Under the R:B=12:1 treatment, the sucrose content of cowpea varieties JD13 increased by 212.39% compared to the control (CK), showing a significant difference; JD4, JD7, JD10, JD11, and JD12 showed no significant differences. Under the R:B=12:1 treatment, the sucrose content of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 showed no significant differences compared to the control (CK).
[0123] Depend on Figure 25It can be seen that, under the red-blue light (R:B=7:3) treatment, the starch content of cowpea varieties JD4, JD10, JD11, JD12, and JD13 increased by 58.78%, 192.41%, 257.97%, 141.99%, and 137.51% respectively compared to the control group (CK), with significant differences; while JD7 showed no significant difference. Under the R:B=4:1 treatment, the starch content of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 145.50%, 99.08%, 97.06%, 86.75%, 119.49%, and 103.22% respectively compared to the control group (CK), with significant differences. Under the R:B=10:1 treatment, the starch content of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 394.68%, 281.58%, 276.61%, 284.59%, 288.40%, and 246.06% respectively compared to the control (CK), showing significant differences. Under the R:B=12:1 treatment, the starch content of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 652.57%, 418.62%, 470.55%, 356.93%, 279.16%, and 393.31% respectively compared to the control (CK), showing significant differences. Under the R:B=14:1 treatment, the starch content of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 541.09%, 303.97%, 340.97%, 404.50%, 443.57%, and 410.91% respectively compared with the control, with significant differences.
[0124] 6. Effects of different ratios of red and blue light on the activity of photosynthetic enzymes in cowpea leaves.
[0125] Depend on Figure 26It was found that, under red-blue light (R:B=7:3) treatment, the Rubisco activity of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 239.27%, 291.57%, 55.26%, 192.92%, 294.23%, and 78.11% respectively compared to the control group (CK), showing significant differences. Under red-blue light (R:B=4:1) treatment, the Rubisco activity of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased by 22.61%, 646.39%, 529.51%, 165.79%, 93.17%, and 2212.28% respectively compared to the control group (CK), showing significant differences. Under red-blue light (R:B = 10:1) treatment, the Rubisco activity of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased significantly compared to the control (CK) by 276.33%, 375.97%, 465.82%, 863.43%, 207.31%, and 573.24%, respectively. Under red-blue light (R:B = 12:1) treatment, the Rubisco activity of cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 increased significantly compared to the control (CK) by 157.30%, 156.43%, 93.94%, 386.51%, 113.38%, and 453.78%, respectively. Under red-blue light (R:B = 12:1) treatment, the Rubisco activity of cowpea varieties JD7, JD10, and JD13 increased by 139.02%, 93.94%, and 564.54% respectively compared to the control (CK), showing significant differences; JD12 decreased by 51.63%, also showing significant differences; while JD4 and JD11 showed no significant differences.
[0126] 7. Effects of different ratios of red and blue light on gene expression levels in cowpea leaves.
[0127] Depend on Figure 27It was found that, under the red-blue light (R:B=7:3) treatment, the expression level of the Rubisco small subunit (rbcS) gene in cowpea varieties was significantly increased by 222.02%, 122.85%, and 257.04% in varieties JD10, JD11, and JD12, respectively, compared to the control group (CK); the difference was not significant for JD4, JD7, and JD13. Under the R:B=4:1 treatment, the expression level of the rbcS gene in cowpea varieties was significantly increased by 172.12% and 160.33% in varieties JD10 and JD11, respectively, compared to the control group (CK); the difference was not significant for JD4, JD7, JD12, and JD13. Under an R:B ratio of 10:1, the expression level of the rbcS gene in cowpea varieties JD4, JD10, JD11, JD12, and JD13 was significantly upregulated compared to the control (CK) by 148.95%, 223.16%, 131.28%, 314.80%, and 286.29%, respectively; the difference in JD7 was not significant. Under an R:B ratio of 12:1, the expression level of the rbcS gene in cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 was not significantly different compared to the CK. Under an R:B ratio of 14:1, the expression level of the rbcS gene in cowpea varieties JD7 was significantly downregulated by 86.25% compared to the CK; the difference in JD4, JD10, JD11, JD12, and JD13 was not significant.
[0128] Depend on Figure 28 It was found that, under the red-blue light (R:B=7:3) treatment, the expression levels of the Rubisco active (Rca) gene in cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 showed no significant difference compared to the control group (CK). Under the R:B=4:1 treatment, the Rca gene expression levels in cowpea varieties JD11 and JD12 were significantly upregulated by 325.94% and 269.32% respectively compared to the control group (CK); however, the expression levels in JD4, JD7, JD10, and JD13 showed no significant difference. Under the R:B=10:1 treatment, the Rca gene expression levels in cowpea varieties JD4 and JD13 were significantly upregulated by 192.96% and 74.53% respectively compared to the control group (CK); however, the expression levels in JD7, JD10, JD11, and JD12 showed no significant difference. Under the R:B=12:1 treatment, the expression levels of the Rca gene in cowpea varieties JD4, JD7, JD10, JD11, JD12, and JD13 showed no significant difference compared to the control (CK). Under the R:B=14:1 treatment, the Rca gene expression levels in cowpea varieties JD10 and JD13 were upregulated by 84.75% and 75.99%, respectively, compared to the CK, with significant differences; while the expression levels in JD4, JD7, JD11, and JD12 showed no significant difference.
[0129] Ninth, Conclusion.
[0130] Photosynthetic parameters: Red and blue light treatments generally increased net photosynthetic rate (Pn), with R:B=10:1 showing the most significant increase in Pn for all varieties (22.86%~69.25%); stomatal conductance (Gs) was most significantly increased at R:B=4:1 and 10:1 (up to 280.62%), while R:B=14:1 had no significant effect; intercellular CO2 concentration (Ci) significantly increased at R:B=7:3 and 4:1, and significantly decreased at R:B=14:1; transpiration rate (Tr) was most significantly increased at R:B=4:1; water use efficiency (WUE) was most significantly increased at R:B=14:1 (up to 104.15%); apparent CO2 use efficiency (CUE) was most significantly increased at R:B=10:1 and 14:1.
[0131] Chlorophyll fluorescence parameters: The actual photosynthetic efficiency (Y(II)) and the maximum photochemical efficiency of PSII (Fv / Fm) showed the greatest increase at R:B=10:1 and 12:1 (Y(II) increased by up to 73.89%, and Fv / Fm increased by up to 68.72%). Photochemical quenching (qP) only significantly increased JD13 at most ratios. Non-photochemical quenching (NPQ) and qN showed significant increases (e.g., JD12) or significant decreases (e.g., JD10) for different varieties at R:B=7:3~14:1, indicating that the photoprotection mechanism is variety-specific.
[0132] Photosynthetic pigments: The contents of chlorophyll a, chlorophyll b, carotenoids, and total chlorophyll were most significantly increased in most varieties at R:B=14:1 (up to 113.75%), while R:B=10:1 and 12:1 had a decreasing effect on some varieties; the chlorophyll a / b ratio generally increased at R:B=10:1 and 12:1.
[0133] Botanical traits: Leaf length, leaf width, plant height, root length, stem diameter, and seedling vigor coefficient were all significantly promoted under different light quality ratios. Among them, the seedling vigor coefficient was significantly improved for all varieties at R:B=10:1 (increased by 36.53%~215.72%), showing the best effect; plant height saw the largest increase at R:B=12:1 (up to 82.77%); and stem diameter was significantly increased for all varieties at R:B=10:1.
[0134] Carbohydrates: The contents of soluble sugars, sucrose, and starch were significantly increased under all red and blue light treatments. Soluble sugars showed the greatest increase (up to 828.40%) at R:B = 4:1 and 10:1; starch showed the most significant increase (up to 652.57%) at R:B = 12:1 and 14:1.
[0135] Photosynthetic enzyme activity: Rubisco enzyme activity was significantly increased under all treatments, with R:B=4:1 increasing JD13 by as much as 2212.28%, and R:B=10:1 increasing all varieties steadily and significantly (207.31%~863.43%).
[0136] Gene expression: The Rubisco small subunit (rbcS) gene was most significantly upregulated at R:B=10:1 (up to 314.80%); the Rubisco activator (Rca) gene was significantly upregulated in some varieties at R:B=4:1 and 14:1.
[0137] In summary, different ratios of red and blue light have significant effects on the physiological growth indicators of cowpea varieties. The red-blue light ratio R:B=10:1 shows the best performance in improving net photosynthetic rate, photosynthetic efficiency, seedling vigor coefficient, soluble sugar, and rbcS gene expression, and is the optimal light quality ratio for promoting cowpea photosynthesis and growth.
[0138] The above conclusions show that the optimal ratio of red to blue light (R:B = 10:1) for cowpea seedlings is clearly indicated. This demonstrates that LED red and blue light improves the robustness and photosynthetic characteristics of cowpea seedlings. Therefore, LED red and blue light can be used as one of the methods to improve the robustness of cowpea seedlings.
[0139] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A method for improving the vigorous growth of cowpea seedlings using LED red and blue light, characterized in that, Includes the following steps: S1. Cowpea crops were treated with red and blue light in different ratios, where R represents red light and B represents blue light. The red-blue light ratios were: R:B=7:3, R:B=4:1, R:B=10:1, R:B=12:1, and R:B=14:
1. The illumination time for both red and blue light was from 6:00 am to 8:00 pm, and the total light intensity was 200 μmol·m⁻¹. -2 ·s -1 The cowpea crop was obtained after being treated with red and blue light; S2. Cowpea crops were treated without red or blue light, with a light exposure time of 6:00 am to 8:00 pm and a total light intensity of 200 μmol·m⁻¹. -2 ·s -1 The cowpea crop of the control group was obtained; S3. Leaf testing was performed on the cowpea crops treated in steps S1 and S2 to obtain multiple sets of test data. Seedlings were then cultivated in Hoagland nutrient solution at an incubator temperature of 16℃-25℃. Leaf testing included detection of leaf photosynthetic characteristics, leaf chlorophyll fluorescence characteristics, leaf photosynthetic pigments, botanical traits, leaf carbohydrates, leaf photosynthetic enzyme activity, and leaf gene expression levels. S4. Based on the changes in data on photosynthetic characteristics, chlorophyll fluorescence characteristics, leaf photosynthetic pigment detection, botanical trait detection, leaf carbohydrate detection, leaf photosynthetic enzyme activity detection, and leaf gene expression level detection, determine whether different ratios of red and blue light treatment have an effect on improving seedling vigor in cowpea crops, and thus determine the optimal red and blue light ratio.
2. The method for improving cowpea seedling vigor using LED red and blue light according to claim 1, characterized in that, The red and blue light processing time is 5 days.
3. The method for improving cowpea seedling vigor using LED red and blue light according to claim 1, characterized in that, The leaf photosynthetic characteristic detection includes the following steps: On a sunny day from 9:00 am to 12:00 am, the photosynthetic rate, transpiration rate, stomatal conductance, intercellular CO2 concentration, water use efficiency, and CO2 use efficiency of the leaves of various cowpea varieties were measured.
4. The method for improving cowpea seedling vigor using LED red and blue light according to claim 1, characterized in that, The detection of leaf chlorophyll fluorescence characteristics includes the following steps: Leaves were marked sequentially between 9:00 am and 12:00 am. After 30 minutes of dark adaptation, the chlorophyll fluorescence parameters excited by laser were measured using a multi-channel continuous monitoring-PAM fluorescence spectrometer. The measured parameters included actual photosynthetic efficiency Y(II), photochemical quenching qP, non-photochemical quenching coefficient qN, non-photochemical quenching NPQ, and PSII maximum photosynthetic efficiency Fv / Fm.
5. A method for improving cowpea seedling vigor using LED red and blue light according to claim 1, characterized in that, The detection of photosynthetic pigments in leaves includes the following steps: Cut the leaves into small pieces and place 0.1 g of the leaves into 10 ml of a mixed extract of 95% ethanol:acetone:water = 4.5:4.5:
1. Soak overnight in the dark until the leaves turn completely white. Using the extract as a control, measure the absorbance of the extract at 440, 645, and 663 nm using an enzyme-linked immunosorbent assay (ELISA) reader. Calculate the contents of chlorophyll a, chlorophyll b, carotenoids, chlorophyll a / b, and total chlorophyll.
6. A method for improving cowpea seedling vigor using LED red and blue light according to claim 1, characterized in that, The botanical trait detection includes the following steps: Select 3 healthy plants, measure the length and width of the leaves, plant height and root length with a ruler, measure the stem diameter with a vernier caliper, and calculate the seedling vigor coefficient = (stem diameter / plant height + dry weight of underground part / dry weight of above-ground part) × total dry weight of plant.
7. A method for improving the vigorous growth of cowpea seedlings using LED red and blue light according to claim 1, characterized in that, The leaf carbohydrate detection includes the following steps: Take the leaves and dry them in an oven. Blanch them at 105℃ for 30 min, dry them at 80℃ for 3~10 h, grind them into powder, and use them to determine the content of soluble sugar, sucrose and starch by anthrone colorimetric method.
8. A method for improving cowpea seedling vigor using LED red and blue light according to claim 1, characterized in that, The detection of photosynthetic enzyme activity in leaves includes the following steps: Weigh 0.1 g of fresh leaves, add 1 ml of extract, and homogenize in an ice bath; centrifuge at 10000 g, 4℃ for 10 min, collect the supernatant, and place on ice for testing; Preparation of working solution: Add all of reagent 1 to reagent 2 before use, mix thoroughly, and incubate at 25℃ for 5 min; Preheat the spectrophotometer / ELISA reader for 30 minutes, adjust the wavelength to 340 nm, and zero the instrument with distilled water. Add the sample following these steps: ; The absorbance of the cowpea sample at 340 nm for 20 s was recorded as A1 measurement, and the absorbance at 340 nm for 5 min 20 s was recorded as A2 measurement. The difference between the two was recorded as ΔA measurement. The absorbance of the cowpea blank control at 340 nm for 20 s was recorded as A1 blank, and the absorbance at 340 nm for 5 min 20 s was recorded as A2 blank. The difference between the two was recorded as ΔA blank. ΔA measurement = A1 measurement - A2 measurement, ΔA blank = A1 blank - A2 blank. ΔA is the difference between the absorbance of the sample tube at 340 nm and the absorbance of the blank control tube. ΔA = ΔA measurement - ΔA blank. The reaction temperature was maintained at 25℃.
9. A method for improving the vigorous growth of cowpea seedlings using LED red and blue light according to claim 1, characterized in that, The detection of leaf gene expression levels includes the following steps: The RNA extraction procedure was performed according to the Solarbio Polysaccharide and Polyphenol Plant RNA Extraction Kit instructions, as follows: Take 500 μl of Buffer RPA (please check that β-mercaptoethanol has been added before use) and add it to a 1.5 ml RNase-free centrifuge tube; After the tissue sample was ground with liquid nitrogen, the powdered sample (50-100 mg) was added to a 1.5 ml centrifuge tube containing 500 μl Buffer RPA and vortexed vigorously to mix until there was no obvious precipitation in the lysis buffer. Then centrifuge at 12,000 rpm for 2 min; Place the filter column into the collection tube, then transfer the supernatant collected in the previous centrifugation step to the Filtration Columns with Collection Tubes-RF, place the filter column in the collection tube, centrifuge at 12,000 rpm for 2 min, and carefully aspirate the filtrate from the collection tube. Slowly add 0.4 times the volume of filtrate of anhydrous ethanol, mix well, and transfer the resulting solution and precipitate together into SpinColumns with Collection Tubes-RC. Place the adsorption column in the collection tube, centrifuge at 12,000 rpm for 15 s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Add 350 μl of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube; Preparation of RNase-free DNase working solution: Take 10 μl of RNase-free DNase, add it to a new RNase-free centrifuge tube, add 70 μl of Buffer DB, mix well, and prepare RNase-free DNase working solution with a final concentration of 80 μl; Add 80 μl of RNase-free DNase working solution to the adsorption column and incubate at room temperature for 15 min. Add 350 μl of Buffer RW1 to the adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube; Add 500 μl of Buffer RW2 to the adsorption column (please check that anhydrous ethanol has been added before use), incubate at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Repeat the previous step once; Return the adsorption column to the collection tube and centrifuge at 12,000 rpm for 3 min at room temperature; this step is very important, otherwise the residual ethanol in BufferRW2 will affect subsequent experiments. Place the adsorption column into a new 1.5 ml centrifuge tube (DNase / RNase-free), add 50-100 μl of BufferTB, incubate at room temperature for 1-2 min, centrifuge at 12,000 rpm for 1 min to obtain the RNA solution; the obtained RNA should be used immediately or aliquoted and stored at -80℃ to avoid repeated freeze-thaw cycles. Then, cDNA was synthesized by reverse transcription using the HiScript® Q RT SuperMix for qPCR + gDNA wiper kit from Yisheng Biotechnology. The steps were as follows: 4×Hifair® AdvanceFast One-Step RT SuperMix, gDNARemover Mix, and RNase-free Water were melted on ice, and the reagent components were thoroughly mixed. The total RNA of the sample was added and prepared in an RNase-free centrifuge tube. The reverse transcription reaction program was: 37℃, 5 min, 85℃, 30 s. This process includes reverse transcription and gDNA digestion. Search for known cowpea rbcS and Rca gene sequences on NBCI. The NCBI accession number for cowpea rbcS is NC_040282.1, and the NCBI accession number for the Rca gene is NC_040279.
1. Primers were designed as follows: The primer RbcS-F sequence is shown in SEQ ID NO: 1: CAGCAGAACAACAAGTGATTCAGAAG; The primer RbcS-R sequence is shown in SEQ ID NO: 2: TGA ACGGAGCCACCATGCC; The primer Rca-F sequence is shown in SEQ ID NO: 3: CCAGAGTGTATGATGATGAAGTGAGG; The primer Rca-R sequence is shown in SEQ ID NO: 4: GGCTGTTCAAAGGTTGGAGGTC; Real-time quantitative PCR was performed using a real-time fluorescence quantitative PCR instrument. The reaction program was as follows: 94℃, 10 s; 94℃, 20 s; 60℃, 20 s; for a total of 40 cycles; three replicates; gene expression levels were quantified using relative fluorescence. Calculation by method.