A method for rapid induction of double haploid of radish in vivo

CN122603757APending Publication Date: 2026-08-21ZHEJIANG FORESTRY UNIVERSITY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611109042.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-07-24
Publication Date
2026-08-21

AI Technical Summary

Technical Problem

[0005]1、园艺作物单倍体诱导后多需胚挽救才能成苗,仍依赖组织培养,操作复杂,耗时长;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122603757A_ABST
    Figure CN122603757A_ABST
Patent Text Reader

Abstract

The application discloses a rapid induction method of radish in vivo double haploid, comprising the following steps: (1) hybrid parent preparation: selecting a radish cytoplasmic male sterile line, a radish male sterile maintainer line or a radish fertile cytoplasmic selfing line as a female parent, and selecting a radish intergeneric hybrid or a cruciferous radish distant species selfing line as an induction male parent; (2) reagent treatment and pollination: at the full flowering stage of the female parent plant, suitable development state stigmas are selected, and reagent treatment is performed: first, NaCl solution is sprayed, then polyamine solution is sprayed, or first, NaCl solution is sprayed, then GA3 solution is sprayed, and finally, polyamine solution is sprayed; after the reagent treatment, male parent pollen is collected to perform pollination, and after the pollination, marking and isolation are performed; (3) post-pollination management and induction related index statistics; and (4) radish double haploid identification. According to the application, double haploid seeds can be obtained only by directly treating stigmas with reagents and pollination, a fundamental breakthrough in a technical path is realized, and a breakthrough solution is provided for radish genetic breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetics and breeding technology, specifically to a method for rapidly inducing double haploids in radishes. Background Technology

[0002] radish( Raphanus sativus Radish (L.) is an important vegetable crop in my country, with a large planting area. Double haploid breeding technology can rapidly obtain homozygous lines through haploid induction and chromosome doubling, shortening the breeding cycle from the traditional 7-8 generations to 2-3 generations, greatly improving breeding efficiency. However, current haploid induction in radishes mainly relies on microspore culture technology, which is complex, time-consuming, severely limited by genotype, and has low and unstable induction efficiency, making it difficult to apply on a large scale in breeding.

[0003] Inducing haploids through heterologous pollination using inducing lines is another effective approach, which has been successfully applied in crops such as maize and wheat and has significantly promoted the breeding process. However, in radishes, there have been no successful reports of inducing haploids through heterologous pollination. The core difficulty lies in the severe reproductive isolation of distant hybridization, which manifests as poor silique enlargement after pollination, early embryonic abortion, extremely low seed setting rate, and inability to effectively obtain hybrid offspring.

[0004] Currently, the main bottlenecks in haploid induction using distant hybridization are as follows:

[0005] 1. After haploid induction, horticultural crops often require embryo rescue to grow into seedlings, which still relies on tissue culture, making the operation complex and time-consuming.

[0006] 2. The haploid induction rate is low, and a large amount of induction work is required to meet the breeding selection requirements;

[0007] 3. The offspring obtained after induction are mostly haploid or aneuploid, requiring double the amount of colchicine, which increases the workload and reduces the rate of obtaining double haploids.

[0008] Studies have shown that polyamine reagents have beneficial effects on tissue-cultured explants, delaying senescence and maintaining growth and proliferation. Exogenous application of plant growth regulators (such as 2,4-D) or polyamine metabolism regulators (such as polyamine promoters and other polyamines) can alleviate reproductive disorders and promote fruit development to some extent. While some progress has been made in the in vitro induction of gynogenesis in onions, cucumbers, and sugar beets, research on the direct in vivo induction of double haploidy by polyamines has not been reported, and related research on their application in radishes is also lacking.

[0009] Therefore, it is of great feasibility to conduct research on the regulation of double haploid induction in radish by polyamines, systematically explore key factors such as polyamine concentration, type of compound reagent, pollination time, and genotype, optimize treatment conditions from the perspectives of systematization, gradient, and metabolic correlation, and establish a complete, stable, and reproducible double haploid creation technology system in radish by combining efficient and accurate progeny identification technology.

[0010] In summary, developing a comprehensive technology that can effectively overcome the barriers to distant hybridization of radishes, significantly improve the induction rate of double haploids, directly obtain genetically homozygous double haploid seeds, and integrate multi-level identification methods is of vital importance to promoting the development of radish genetic breeding. Summary of the Invention

[0011] This invention provides a rapid induction method for double haploids in radishes to overcome the shortcomings of existing technologies.

[0012] To achieve the above objectives, the present invention adopts the following technical solution:

[0013] A rapid method for inducing double haploidy in radish includes the following steps:

[0014] (1) Preparation of hybrid parents: Select radish cytoplasmic male sterile line, radish male sterile maintainer line or radish fertile cytoplasmic inbred line as female parent, and select inbred line of intergenous hybrid of radish or distant species of radish in the Brassicaceae family as induced male parent; wherein, the intergenous hybrid of radish includes 'radish kale' allotetraploid, and the distant species of radish in the Brassicaceae family include white mustard or Brassica oleracea;

[0015] (2) Chemical treatment and pollination: During the peak flowering period of the female plant, select the stigma in a suitable developmental state and treat it with chemicals: spray NaCl solution first, then spray polyamine solution, or spray NaCl solution first, then GA3 solution, then spray polyamine solution; after chemical treatment, collect pollen from the male plant for pollination, and mark and isolate it after pollination.

[0016] (3) Post-pollination management and statistics of induction-related indicators;

[0017] (4) Identification of radish double haploids.

[0018] Furthermore, in step (1), when selecting a male-sterile radish maintainer line or a fertile radish cytoplasmic inbred line as the female parent, the female parent plant is deflowered and isolated 1 day before flowering, and then step (2) is carried out.

[0019] Further, in step (2), the stigma in the suitable development state is the stigma 1 day before flowering, the stigma on the day of flowering (i.e., the stigma on the 1st day of flowering), and the stigma on the 2nd day of flowering; wherein, the stigma 1 day before flowering is sprayed with the agent after the buds are removed.

[0020] Furthermore, in step (2), the stigma in the suitable developmental state is the stigma on the day of flowering, that is, the stigma on the first day of flowering.

[0021] Further, in step (2), a NaCl solution is sprayed first, followed by a polyamine solution. The NaCl solution includes 1.5wt% to 3wt% NaCl solution; the polyamine solution includes putrescine (FA) solution, spermidine (YJA) solution, or spermine (JA) solution. The putrescine solution includes 50 mg / L to 200 mg / L putrescine solution, the spermidine solution includes 20 mg / L to 40 mg / L spermidine solution, and the spermine solution includes 500 mg / L to 1000 mg / L spermine solution.

[0022] First, spray with NaCl solution, then spray with GA3 solution, and finally spray with polyamine solution. The NaCl solution comprises 1.5wt% to 3wt% NaCl solution; the GA3 solution comprises 50 mg / L to 100 mg / L GA3 solution; the polyamine solution comprises putrescine solution, spermidine solution, or spermine solution, wherein the putrescine solution comprises 50 mg / L to 200 mg / L putrescine solution, the spermidine solution comprises 20 mg / L to 40 mg / L spermidine solution, and the spermine solution comprises 100 mg / L to 1000 mg / L spermine solution.

[0023] The first solution should be dried before spraying the second solution; the polyamine solution should be dried before pollination.

[0024] Furthermore, in step (2), NaCl solution is sprayed first, followed by polyamine solution. The NaCl solution includes 2wt% NaCl solution; the polyamine solution includes putrescine solution, spermidine solution, or spermine solution. The putrescine solution includes 100 mg / L putrescine solution. When the maternal parent is a radish cytoplasmic male sterile line or a radish fertile cytoplasmic inbred line, the spermidine solution includes 20 mg / L spermidine solution. When the maternal parent is a radish male sterile maintainer line, the spermidine solution includes 30 mg / L spermidine solution. The spermine solution includes 1000 mg / L spermine solution.

[0025] First, spray with NaCl solution, then spray with GA3 solution, and finally spray with polyamine solution. The NaCl solution comprises 2 wt% NaCl solution; the GA3 solution comprises 60 mg / L GA3 solution; the polyamine solution comprises putrescine solution, spermidine solution, or spermine solution. The putrescine solution comprises 100 mg / L putrescine solution. When the maternal parent is a radish cytoplasmic male sterile line or a radish fertile cytoplasmic inbred line, the spermidine solution comprises 20 mg / L spermidine solution. When the maternal parent is a radish male sterile maintainer line, the spermidine solution comprises 30 mg / L spermidine solution. The spermine solution comprises 1000 mg / L spermine solution.

[0026] The first solution should be dried before spraying the second solution; the polyamine solution should be dried before pollination.

[0027] Further, in step (2), each solution is sprayed onto the stigma of each radish inflorescence branch, and each inflorescence branch is sprayed 3 times, with each spray being about 0.5 mL.

[0028] Further, after pollination in step (3), normal cultivation and management are carried out, mature siliques are harvested, F1 generation seeds are obtained, and induction-related indicators are statistically analyzed. The induction-related indicators include the seed-silique ratio, seed ratio, plump seed ratio, and double haploid ratio.

[0029] Furthermore, step (4) employs multi-level identification, sequentially performing morphological screening, cytological chromosome counting identification, and SSR molecular marker verification on the F1 generation to screen out double haploid plants with a chromosome number of 18 and a homozygous genotype.

[0030] Furthermore, when the induced paternal parent is a 'radish and mustard green' allotetraploid, the primer pairs used for the SSR molecular marker are rSSR2, rSSR4, bSSR2, and bSSR4. The sequences of rSSR2 are shown in SEQ ID NO.29 and SEQ ID NO.30, the sequences of rSSR4 are shown in SEQ ID NO.33 and SEQ ID NO.34, the sequences of bSSR2 are shown in SEQ ID NO.3 and SEQ ID NO.4, and the sequences of bSSR4 are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0031] The beneficial effects of this invention are:

[0032] 1. This invention is the first to successfully apply a combination of NaCl solution and polyamine (putrescine, spermidine, spermine) solution, or a combination of NaCl solution, GA3 solution, and polyamine (putrescine, spermidine, spermine) solution, to the rapid induction of double haploids in radish. By combining parameter optimization, precise identification, and universality verification, a highly efficient (induction rate up to 14.43%), stable (good reproducibility), accurate (three-level identification), and practical (directly obtaining double haploid seeds) rapid induction technology system for radish has been established. This system, to a certain extent, solves the core problems in distant hybridization, such as poor silique enlargement and early embryonic abortion caused by reproductive isolation. Compared with traditional microspore culture technology, this invention does not rely on complex tissue culture and embryo rescue processes; double haploid seeds can be obtained simply by directly treating the stigma with chemicals and pollinating, achieving a fundamental breakthrough in the technical approach and providing a groundbreaking solution for radish genetic breeding.

[0033] 2. The maternal parent of this invention is applicable not only to radish cytoplasmic male sterile lines, but also to radish male sterile maintainer lines and radish fertile cytoplasmic inbred lines, indicating that the technology of this invention is not limited by cytoplasmic type and has the potential for cross-genotype promotion, verifying its wide adaptability to radishes of different genotypes. The paternal parent of this invention can be not only intergenous hybrids of radish (such as 'radish-kale' allotetraploids), but also inbred lines of distant relatives of radish species in the Brassicaceae family (such as white mustard and Brassica), breaking through the limitation of dependence on a single paternal parent.

[0034] 3. This invention employs a multi-level identification method for radish double haploids, sequentially performing morphological screening, cytological chromosome counting identification, and SSR molecular marker verification on the F1 generation, thereby ensuring the accuracy and reliability of the identification results.

[0035] 4. This invention can directly obtain genetically homozygous double haploid seeds, shortening the breeding cycle from 7-8 generations to 2-3 generations, significantly reducing the breeding period and greatly improving breeding efficiency. Furthermore, this invention eliminates the need for chromosome doubling, simplifying operation and greatly reducing breeding difficulty and costs, making it easy to apply on a large scale in breeding bases.

[0036] 5. The method described in this invention has a complete system, mature technology, and good reproducibility, providing strong technical support for genetic breeding research and new germplasm creation of radish. Attached Figure Description

[0037] Figure 1 The effect of spermidine on the induction of double haploidy in radish cytoplasmic male sterility line under different NaCl concentration gradients in Example 1 - with seed-to-silique ratio.

[0038] Figure 2The effect of spermidine on the induction of double haploidy in radish cytoplasmic male sterility lines under different NaCl concentration gradients in Example 1 - seed ratio.

[0039] Figure 3 The effect of spermidine on the induction of double haploidy in radish cytoplasmic male sterility line under different NaCl concentration gradients in Example 1 - the percentage of plump seeds.

[0040] Figure 4 The effect of spermidine on the induction of double haploidy in radish cytoplasmic male sterility lines under different NaCl concentration gradients in Example 1 - double haploid ratio.

[0041] Figure 5 The effect of different polyamine reagents on the induction of double haploidy in radish cytoplasmic male sterile lines in Example 2 - with seed-to-silique ratio.

[0042] Figure 6 The effect of different polyamine reagents on the induction of double haploids in radish cytoplasmic male sterile lines in Example 2 - seed ratio.

[0043] Figure 7 The effect of different polyamine reagents on the induction of double haploidy in radish cytoplasmic male sterile lines in Example 2 - the percentage of plump seeds.

[0044] Figure 8 The effect of different polyamine reagents on the induction of double haploidy in radish cytoplasmic male sterile lines in Example 2 - double haploid ratio.

[0045] Figure 9 The effect of different polyamine reagents on the induction of double haploids in radish cytoplasmic male sterile lines under the condition of adding GA3 in Example 2 - with seed silique ratio.

[0046] Figure 10 The effect of different polyamine reagents on the induction of double haploids in radish cytoplasmic male sterile lines under the condition of adding GA3 in Example 2 - seed ratio.

[0047] Figure 11 The effect of different polyamine reagents on the induction of double haploids in radish cytoplasmic male sterile lines under the condition of adding GA3 in Example 2 - the ratio of plump seeds.

[0048] Figure 12 The effect of different polyamine reagents on the induction of double haploids in radish cytoplasmic male sterile lines under the condition of adding GA3 in Example 2 - double haploid ratio.

[0049] Figure 13The effect of stigma reagent treatment and pollination at different developmental stages on the induction of double haploids in radish cytoplasmic male sterile lines in Example 3 - the ratio of seeded siliques.

[0050] Figure 14 The effect of stigma reagent treatment and pollination at different developmental stages on the induction of double haploidy in radish cytoplasmic male sterile lines in Example 3 - seed ratio.

[0051] Figure 15 The effect of stigma reagent treatment and pollination at different developmental stages on the induction of double haploidy in radish cytoplasmic male sterile lines in Example 3 - the percentage of plump seeds.

[0052] Figure 16 The effect of stigma reagent treatment and pollination at different developmental stages on the induction of double haploids in radish cytoplasmic male sterile lines in Example 3 – double haploid ratio.

[0053] Figure 17 The effect of different polyamine reagents on the induction of double haploids in the male-sterile maintainer line of radish in Example 4 - with seed-to-silique ratio.

[0054] Figure 18 The effect of different polyamine reagents on the induction of double haploids in the male sterility maintainer line of radish in Example 4 - seed ratio.

[0055] Figure 19 The effect of different polyamine reagents on the induction of double haploids in the male-sterile maintainer line of radish in Example 4 - the ratio of plump seeds.

[0056] Figure 20 The effect of different polyamine reagents on the induction of double haploids in the male-sterile radish maintainer line in Example 4 - double haploid ratio.

[0057] Figure 21 The effect of different types of male parent pollination on the induction of double haploid in radish cytoplasmic male sterile lines in Example 5 - the ratio of seeded siliques.

[0058] Figure 22 The effect of different types of male parent pollination on the induction of double haploid in radish cytoplasmic male sterile lines in Example 5 - seed ratio.

[0059] Figure 23 The effect of different types of male parent pollination on the induction of double haploidy in radish cytoplasmic male sterile lines in Example 5 - the ratio of plump seeds.

[0060] Figure 24 The effect of different types of male parent pollination on the induction of double haploids in radish cytoplasmic male sterile lines in Example 5 - double haploid ratio.

[0061] Figure 25 The effect of different radish parent materials on the induction of double haploids under polyamine complex treatment in Example 6 is shown in the seed-to-silique ratio.

[0062] Figure 26 The effect of different radish parent materials on the induction of double haploids under polyamine complex treatment in Example 6 is shown in the seed ratio.

[0063] Figure 27 The effect of polyamine compound treatment on the double haploid induction effect of different radish parent materials in Example 6 is shown in the figure of plump seed ratio.

[0064] Figure 28 The effect of different radish parent materials on the induction of double haploids under polyamine complex treatment in Example 6 is shown in the double haploid ratio.

[0065] Figure 29 The radish double haploid seedling phenotype induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L FA solution in Example 2.

[0066] Figure 30 The radish double haploid seedling phenotype induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution in Example 2.

[0067] Figure 31 The radish double haploid seedling phenotype induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 1000 mg / L JA solution in Example 2.

[0068] Figure 32 The radish double haploid seedling phenotype induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 30 mg / L YJA solution in Example 4.

[0069] Figure 33 The phenotypic phenotype of radish double haploid seedlings induced by the use of Zhejiang Youzha Cai (24A818) as the male parent in Example 5.

[0070] Figure 34 The phenotypic phenotype of radish double haploid seedlings induced by pollination treatment with seed mustard (24A804) as the male parent in Example 5.

[0071] Figure 35 The phenotypic phenotype of radish double haploid seedlings induced by pollination treatment with seed mustard (yellow seed) (24A807) as the male parent in Example 5.

[0072] Figure 36The phenotypic phenotype of radish double haploid seedlings induced by pollination treatment with seed mustard (brown seed) (24A808) as the male parent in Example 5.

[0073] Figure 37 The chromosome number (2n=18) of radish double haploid root tip cells induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L FA solution in Example 2.

[0074] Figure 38 The chromosome number (2n=18) of radish double haploid root tip cells induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution in Example 2.

[0075] Figure 39 The chromosome number (2n=18) of radish double haploid root tip cells induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 1000 mg / L JA solution in Example 2.

[0076] Figure 40 The chromosome number (2n=18) of radish double haploid root tip cells induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 30 mg / L YJA solution in Example 4.

[0077] Figure 41 The chromosome number (2n=18) of radish double haploid root tip cells induced by the pollination treatment of Zhejiang Youzha Cai (24A818) as the male parent in Example 5.

[0078] Figure 42 The chromosome number (2n=18) of the root tip cells of radish double haploids induced by pollination treatment with seed mustard (24A804) as the male parent in Example 5.

[0079] Figure 43 The chromosome number (2n=18) of radish double haploid root tip cells induced by pollination treatment with seed mustard (yellow seed) (24A807) as the male parent in Example 5.

[0080] Figure 44 The chromosome number (2n=18) of the root tip cells of radish double haploids induced by pollination treatment with seed mustard (brown seed) (24A808) as the male parent in Example 5.

[0081] Figure 45The electrophoretic pattern for identifying radish double haploids induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution in Example 2 using SSR molecular markers (primer rSSR2, radish-specific primer) in Example 7 is shown. Lane 1 (M) is Mark, lane 2 (651) is the male parent material being an allotetraploid of 'Radish and Chinese Mustard Green' (RRCC, number 24A873), lane 3 (number 201) is the female parent material being a radish cytoplasmic male sterile line (number 24A201A), and subsequent lanes (1-29) are all radish double haploid plants induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution in Example 2.

[0082] Figure 46 The electrophoretic pattern for identifying radish double haploids induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution in Example 2 using SSR molecular markers (primer rSSR4, radish-specific primer) in Example 7 is shown. Lane 1 (M) is Mark, lane 2 (651) is the male parent material being an allotetraploid of 'Radish and Mustard Green' (RRCC, number 24A873), lane 3 (number 201) is the female parent material being a radish cytoplasmic male sterile line (number 24A201A), and subsequent lanes (1-29) are all radish double haploid plants induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution in Example 2.

[0083] Figure 47 The above are the electrophoretic patterns of radish double haploids induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution in Example 2, identified using SSR molecular markers (primer bSSR2, a radish-specific primer) in Example 7. The first lane (M) is Mark, the second lane (651) is the paternal material being the 'radish-radish' allotetraploid (RRCC, number 24A873), the third lane (number 201) is the maternal material being the radish cytoplasmic male sterile line (number 24A201A), and the subsequent lanes (1-29) are all radish double haploid plants induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution in Example 2.

[0084] Figure 48The above are the electrophoretic patterns of radish double haploids induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution in Example 2, identified using SSR molecular markers (primer bSSR4, a radish-specific primer) in Example 7. The first lane (M) is Mark, the second lane (651) is the paternal material being the 'radish-radish' allotetraploid (RRCC, number 24A873), the third lane (number 201) is the maternal material being the radish cytoplasmic male sterile line (number 24A201A), and the subsequent lanes (1-29) are all radish double haploid plants induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution in Example 2.

[0085] Figure 49 The water control treatment in Example 2 shows the development of radish double haploid siliques.

[0086] Figure 50 The image shows the development of radish double haploid siliques induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L FA solution in Example 2.

[0087] Figure 51 The image shows the development of radish double haploid siliques induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution in Example 2.

[0088] Figure 52 The image shows the development of radish double haploid siliques induced by treatment with 2wt% NaCl solution + 60 mg / L GA3 solution + 1000 mg / L JA solution in Example 2. Detailed Implementation

[0089] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. The following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the protection scope of the present invention.

[0090] The radish cytoplasmic male sterile line (number 24A201A) involved in the following examples uses the Crystal White Jade variety (purchased from Jiaxing Jiafeng Seed Co., Ltd.) as the sterile source and crosses it with the Spring No Old variety (purchased from Sichuan Zhongdu Gaoke Seed Industry Co., Ltd.) as the male parent. Stable radish cytoplasmic male sterile lines are obtained by selecting sterile plants and backcrossing them for four consecutive generations.

[0091] The 'Radish and Chinese Mustard Green' allotetraploid (RRCC, No. 24A873) was obtained by distant hybridization of a thin-necked round white radish variety (purchased from Hangzhou Kefeng Seed Co., Ltd.) with a large-core yellow Chinese mustard green variety (purchased from Maya Shunxing Seed Shop, Rongcheng District, Jieyang City) as the male parent. The hybrid was obtained through ovary culture, and then the radish and Chinese mustard green allotetraploid was obtained by doubling with colchicine. Then, stable genetic lines were obtained through three generations of continuous self-pollination.

[0092] The male-sterile radish maintainer line (No. 24A202B) was purchased from Sichuan Zhongdu Gaoke Seed Industry Co., Ltd.

[0093] White mustard (item number 24A886) was purchased from Jiangxi Yihao Agricultural Technology Co., Ltd.

[0094] Zhejiang-quality pickled mustard tuber (No. 24A818) was purchased from Jiaxing Jiafeng Seed Co., Ltd.

[0095] Seed mustard greens (No. 24A804) were purchased from Qingxian Xingyun Seed Industry Co., Ltd. (Huayu brand).

[0096] Seed mustard greens (yellow seeds) (No. 24A807) were purchased from Qingxian Xingyun Seed Industry Co., Ltd. (Huayu brand).

[0097] Seed mustard greens (brown seeds) (No. 24A808) were purchased from Qingxian Xingyun Seed Industry Co., Ltd. (Huayu brand).

[0098] The fertile cytoplasmic inbred line 896-1-2 of radish was purchased from Zhejiang Wuwangnong Seed Industry Co., Ltd.

[0099] The fertile cytoplasmic inbred line 1135 of radish was purchased from Hebei Qinfeng Seed Industry Technology Co., Ltd.

[0100] The fertile cytoplasmic inbred line 1136 of radish was purchased from Henan Lvhuo Agricultural Technology Co., Ltd.

[0101] The fertile cytoplasmic inbred line 897 of radish was purchased from Hebei Qinfeng Seed Industry Technology Co., Ltd.

[0102] The fertile cytoplasmic inbred line 8091 of radish was purchased from Hengshui Jinqiu Seed Industry Co., Ltd.

[0103] The fertile cytoplasmic inbred line 8098 for radish was purchased from Zhejiang Kecheng Seed Industry Co., Ltd.

[0104] Black mustard (reference number 24A803) was provided by Professor Chen Liping's research group at Zhejiang University.

[0105] Mustard (reference number 24A809) was provided by Professor Liping Chen's research group at Zhejiang University.

[0106] Example 1: Effect of spermidine on double haploid induction in radish cytoplasmic male sterility line under different NaCl concentration gradients

[0107] 1. Prepare four sodium chloride (NaCl) concentration gradient solutions (0 wt%, 1.5 wt%, 2 wt%, and 3 wt%), a 60 mg / L gibberellin (GA3) solution, and a 20 mg / L spermidine (YJA) solution, all in water. The maternal material was a radish cytoplasmic male sterile line (number 24A201A; 2n=18, the same below). The paternal material was a 'radish-kale' allotetraploid (RRCC, number 24A873; 2n=36, the same below).

[0108] 2. Chemical Treatment and Pollination: During the peak flowering period of the female plant, select the stigmas on the day of flowering (the stigmas should be healthy, bright, and glossy, secreting a sticky liquid; the petals should be thick; and the flower shape should be upright). Before artificial pollination, spray each treatment stigma with four different concentration gradients of NaCl solution. After the solutions have dried, spray each stigma with a 60 mg / L GA3 solution. After the solutions have dried, spray each stigma with a 20 mg / L YJA solution. After the solutions have dried, collect fresh pollen from the male plant for artificial pollination. Each solution should be sprayed using a small spray bottle onto the stigmas of each radish inflorescence branch, with each inflorescence branch sprayed three times, approximately 0.5 mL each time. Four treatments were administered: 0 wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution (0%NaCl + 60GA + 20YJA, as a control); 1.5 wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution (1.5%NaCl + 60GA + 20YJA, as experimental group 1); 2 wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution (2%NaCl + 60GA + 20YJA, as experimental group 2); and 3 wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution (3%NaCl + 60GA + 20YJA, as experimental group 3). Each treatment had three replicates, with approximately 80 flowers per replicate. Flowers were tagged and isolated after pollination.

[0109] Radish planting and management are carried out according to conventional cultivation methods.

[0110] 3. Data Statistics and Seed Harvesting: Thirty days after pollination, siliques from each treatment were harvested and tested for seed quality. Seeds of the induced progeny were also harvested. The seed-to-silique ratio, seed ratio, percentage of plump seeds, and percentage of double haploids were statistically analyzed for each treatment. Multiple comparison analysis was performed on the data of each group, with a significance level set at p<0.05.

[0111] The calculation methods for seed-to-silique ratio, seed ratio, plump seed ratio, and double haploid ratio are as follows:

[0112] Percentage of seeded siliques (%) = Number of seeded siliques / Number of pollinated flowers × 100;

[0113] Seed ratio (%) = Number of seeds / Number of pollinated flowers × 100;

[0114] Percentage of plump seeds (%) = Number of plump seeds / Number of pollinated flowers × 100;

[0115] Double haploid ratio (%) = Number of double haploid seeds / Number of pollinated flowers × 100.

[0116] The determination of the number of double haploid seeds was carried out according to Example 7.

[0117] 4. Results: such as Figures 1-4 As shown, the four indicators of seed-pod ratio, seed ratio, plump seed ratio, and double haploid ratio in each experimental group were higher than those in the control group. Among them, experimental group 2, which was treated with 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution, showed the best effect, which significantly improved the seed-pod ratio, seed ratio, plump seed ratio, and double haploid ratio, with the double haploid ratio reaching as high as 12.62%.

[0118] Example 2: Effects of different polyamine reagents on the induction of double haploidy in radish cytoplasmic male sterility lines

[0119] 1. Prepare 2wt% sodium chloride (NaCl) solution, 60 mg / L gibberellin (GA3) solution, 1 mg / L, 50 mg / L, 100 mg / L, and 200 mg / L putrescine (FA) solutions, 20 mg / L, 30 mg / L, and 40 mg / L spermidine (YJA) solutions, and 50 mg / L, 100 mg / L, 500 mg / L, and 1000 mg / L spermidine (JA) solutions, all in water. The maternal material was a radish cytoplasmic male sterile line (number 24A201A). The paternal material was a 'radish-kale' allotetraploid (RRCC, number 24A873).

[0120] 2. Chemical Treatment and Pollination: During the peak flowering period of the female plant, select the stigmas on the day of flowering (the stigmas should be healthy, bright, and glossy, secreting a sticky liquid; the petals should be thick; and the flower shape should be upright). Before artificial pollination, spray each treatment stigma with a 2wt% NaCl solution. After the solution dries, spray with 1 mg / L, 50 mg / L, 100 mg / L, and 200 mg / L FA solution, or 20 mg / L, 30 mg / L, and 40 mg / L YJA solution, or 50 mg / L, 100 mg / L, 500 mg / L, and 1000 mg / L JA solution, respectively. After the solutions dries, collect fresh pollen from the male plant for artificial pollination. Each solution is sprayed using a small spray bottle onto the stigmas of each radish inflorescence branch, with each inflorescence branch sprayed 3 times, approximately 0.5 mL each time. A water treatment is set up as a control (an equal volume of water is used instead of water when spraying each solution). A total of 12 treatments were set up: water treatment (CK, as control), 2wt% NaCl solution + 1 mg / L FA solution (1FA), 2wt% NaCl solution + 50 mg / L FA solution (50FA), 2wt% NaCl solution + 100 mg / L FA solution (100FA), 2wt% NaCl solution + 200 mg / L FA solution (200FA), 2wt% NaCl solution + 20 mg / L YJA solution (20YJA), 2wt% NaCl solution + 30 mg / L YJA solution (30YJA), 2wt% NaCl solution + 40 mg / L YJA solution (40YJA), 2wt% NaCl solution + 50 mg / L JA solution (50JA), 2wt% NaCl solution + 100 mg / L JA solution (100JA), 2wt% NaCl solution + 500 mg / L JA solution (50JA), 2wt% NaCl solution + 100 mg / L JA solution (100JA), 2wt% NaCl solution + 500 mg / L FA solution (500JA), 2wt% NaCl solution + 100 mg / L JA solution (100JA), 2wt% NaCl solution + 100 mg / L FA solution (500JA), 2wt% NaCl solution + 100 mg / L FA solution (1 ... 500 JA was used in 2 wt% NaCl solution + 1000 mg / L JA solution. Each treatment had three replicates, with approximately 80 flowers per replicate. Flowers were tagged and isolated after pollination.

[0121] Alternatively, during the peak flowering period of the mother plant, select the stigmas on the day of flowering (the stigmas should be healthy, bright, and glossy, secreting a sticky liquid; the petals should be thick; and the flower shape should be upright). Before artificial pollination, spray each treatment's stigmas with a 2wt% NaCl solution. After the solution dries, spray each treatment with a 60 mg / L GA3 solution. After the solution dries, spray with 1 mg / L, 50 mg / L, 100 mg / L, and 200 mg / L FA solutions, or 20 mg / L, 30 mg / L, and 40 mg / L YJA solutions, or 50 mg / L, 100 mg / L, 500 mg / L, and 1000 mg / L JA solutions, respectively. After the solutions dries, collect fresh pollen from the male parent for artificial pollination. Each solution should be sprayed using a small spray bottle onto the stigmas of each radish inflorescence branch, with each inflorescence branch sprayed 3 times, approximately 0.5 mL each time. A separate water treatment was set up as a control (an equal volume of water was used instead of water when spraying each solution). A total of 12 treatments were set up: water treatment (CK, as control), 2wt% NaCl solution + 60 mg / L GA3 solution + 1 mg / L FA solution (1FA), 2wt% NaCl solution + 60 mg / L GA3 solution + 50 mg / L FA solution (50FA), 2wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L FA solution (100FA), 2wt% NaCl solution + 60 mg / L GA3 solution + 200 mg / L FA solution (200FA), 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution (20YJA), 2wt% NaCl solution + 60 mg / L GA3 solution + 30 mg / L YJA solution (30YJA), 2wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L FA solution (100FA), 2wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L FA solution (200FA), 2wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L FA solution (200FA), 2wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L FA solution (200FA), 2wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L FA solution (200YJA ... Treatments included 40 mg / L YJA solution (denoted as 40YJA), 2 wt% NaCl solution + 60 mg / L GA3 solution + 50 mg / L JA solution (denoted as 50JA), 2 wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L JA solution (denoted as 100JA), 2 wt% NaCl solution + 60 mg / L GA3 solution + 500 mg / L JA solution (denoted as 500JA), and 2 wt% NaCl solution + 60 mg / L GA3 solution + 1000 mg / L JA solution (denoted as 1000JA). Each treatment had three replicates, with approximately 80 flowers per replicate. Flowers were tagged and isolated after pollination.

[0122] Radish planting and management are carried out according to conventional cultivation methods.

[0123] 3. Data statistics and seed harvesting: Same as in Example 1.

[0124] 4. Results: In the water control, none of the siliques enlarged after pollination, and no double haploids were produced. Figure 49 ).like Figures 5-8 (Results of 0 are not shown in the figure) As shown, without the combined treatment of 60 mg / L GA3, putrescine, spermine, and spermidine were all effective in inducing double haploid morphology in radish. Putrescine at concentrations of 50–200 mg / L could induce seeded siliques, seeds, plump seeds, and double haploid seeds. The best-performing concentration for the latter three induction indicators (seed ratio, plump seed ratio, and double haploid ratio) was 100 mg / L, with the highest double haploid ratio of 11.19%. Speridine at a concentration of 20 mg / L was most effective for all four induction indicators (seed-silique ratio, seed ratio, plump seed ratio, and double haploid ratio), with the highest double haploid ratio of 11.36%. Spermine at a concentration of 1000 mg / L was most effective for all four induction indicators (seed-silique ratio, seed ratio, plump seed ratio, and double haploid ratio), with the highest double haploid ratio of 11.58%. Figures 9-12 (Results of 0 are not shown in the graph) and Figures 50-52 As shown, when treated with 60 mg / L GA3, the treatment effects of various polyamine reagents were generally improved. Among them, 100 mg / L putrescine, 20 mg / L spermidine and 1000 mg / L spermine still had the best effects among the three polyamine reagents, with double haploid induction rates of 14.43%, 13.04% and 11.63%, respectively.

[0125] Example 3: Effects of stigma treatment and pollination at different developmental stages on the induction of double haploidy in radish cytoplasmic male sterility lines.

[0126] 1. Prepare 1.5wt% and 2wt% sodium chloride (NaCl) solutions, 60 mg / L GA3 solution, and 20 mg / L spermidine (YJA) solution. The maternal material is a radish cytoplasmic male sterile line (number 24A201A). The paternal material is a 'radish-kale' allotetraploid (RRCC, number 24A873).

[0127] 2. Chemical treatment and pollination: During the peak flowering period of the female plant, select stigmas 1 day before flowering, stigmas on the day of flowering (i.e., stigmas on the 1st day of flowering, requiring healthy, bright, and glossy stigmas that secrete a sticky liquid; thick petals; and upright flower shape), stigmas on the 2nd day of flowering, stigmas on the 3rd day of flowering, and stigmas on the 4th day of flowering. Before artificial pollination, spray the stigmas 1 day before flowering with a 1.5wt% NaCl solution, and the stigmas on the 2nd day of flowering, 3rd day of flowering, and 4th day of flowering with a 2wt% NaCl solution. After the solution dries, spray them evenly with a 60 mg / L GA3 solution. After the solution dries, spray them evenly with a 20 mg / L LYJA solution. After the solution dries, collect fresh pollen from the male plant for artificial pollination. Each solution was applied to the stigmas of each radish inflorescence branch using a small spray bottle, with each branch sprayed three times, approximately 0.5 mL each time. The solution was sprayed again one day before flowering, after the stigmas had been peeled. A total of five treatments were included. Each treatment had three replicates, with approximately 80 flowers per replicate. Post-pollination flowers were tagged and isolated.

[0128] Radish planting and management are carried out according to conventional cultivation methods.

[0129] 3. Data statistics and seed harvesting: Same as in Example 1.

[0130] 4. Results: such as Figures 13-16 As shown (results of 0 are not displayed in the figure), the ratio of seeds to siliques was similar in treatments of stigmas 1 day before flowering and stigmas on the day of flowering. However, in other treatments, the ratio of seeds to siliques decreased as stigma development time increased. The seed ratio, in all treatments, showed a trend of first increasing and then decreasing as stigma development time increased, with the highest ratio (82.86%) in the treatment of stigmas on the day of flowering. The ratio of plump seeds was also highest in the treatment of stigmas on the day of flowering (14.71%), while treatments of stigmas on the 3rd and 4th days of flowering showed no plump seeds. The ratio of double haploids followed a similar pattern to the ratio of plump seeds, with the highest ratio (12.19%) in the treatment of stigmas on the 1st day of flowering.

[0131] Example 4: Effects of different polyamine reagents on the induction of double haploidy in radish male sterility maintainer lines

[0132] 1. Prepare 2wt% sodium chloride (NaCl) solution, 60 mg / L gibberellin (GA3) solution, 1 mg / L, 50 mg / L, 100 mg / L, and 200 mg / L putrescine (FA) solutions, 20 mg / L, 30 mg / L, and 40 mg / L spermidine (YJA) solutions, and 100 mg / L, 500 mg / L, and 1000 mg / L spermidine (JA) solutions, all in water. The maternal parent material was a radish male-sterile maintainer line (number 24A202B) (2n=18). The paternal parent material was a 'radish-kale' allotetraploid (RRCC, number 24A873). The purpose of this example is to clarify whether fertile and sterile cytoplasm have an effect on the induction of double haploidy in radish.

[0133] 2. Chemical Treatment and Pollination: One day before flowering, the female plants were de-emerged and isolated. The following day, when the stigmas developed to a stage similar to that of normal flowering on the first day, each treatment stigma was first sprayed with a 2wt% NaCl solution. After the solution dried, each treatment stigma was then sprayed with a 60 mg / L GA3 solution. After the solution dried, each treatment stigma was sprayed with 1 mg / L, 50 mg / L, 100 mg / L, and 200 mg / L FA solution, or 20 mg / L, 30 mg / L, and 40 mg / L YJA solution, or 100 mg / L, 500 mg / L, and 1000 mg / L JA solution, respectively. After the solutions dried, fresh pollen from the male plants was collected for artificial pollination. Each solution was sprayed using a small spray bottle onto the stigmas of each radish inflorescence branch, with each inflorescence branch sprayed three times, approximately 0.5 mL each time. Ten treatments were administered: 2wt% NaCl solution + 60 mg / L GA3 solution + 1 mg / L FA solution (denoted as 1FA); 2wt% NaCl solution + 60 mg / L GA3 solution + 50 mg / L FA solution (denoted as 50FA); 2wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L FA solution (denoted as 100FA); 2wt% NaCl solution + 60 mg / L GA3 solution + 200 mg / L FA solution (denoted as 200FA); 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution (denoted as 20YJA); 2wt% NaCl solution + 60 mg / L GA3 solution + 30 mg / L YJA solution (denoted as 30YJA); and 2wt% NaCl solution + 60 mg / L GA3 solution + 40 mg / L FA solution. YJA solution (denoted as 40YJA), 2wt% NaCl solution + 60 mg / L GA3 solution + 100 mg / L JA solution (denoted as 100JA), 2wt% NaCl solution + 60 mg / L GA3 solution + 500 mg / L JA solution (denoted as 500JA), and 2wt% NaCl solution + 60 mg / L GA3 solution + 1000 mg / L JA solution (denoted as 1000JA) were used. Each treatment had three replicates, with approximately 80 flowers per replicate. Flowers were tagged and isolated after pollination.

[0134] Radish planting and management are carried out according to conventional cultivation methods.

[0135] 3. Data statistics and seed harvesting: Same as in Example 1.

[0136] 4. Results: such as Figures 17-20As shown, all three polyamine treatments were effective in improving four indicators: seed-to-pod ratio, seed ratio, percentage of plump seeds, and double haploid ratio. After treatment with 100 mg / L putrescine, all four indicators were higher than the other three concentrations, with the highest double haploid ratio at 13.85%. After treatment with 30 mg / L spermidine, all four indicators were also higher than the other two concentrations, with the highest double haploid ratio at 11.22%. After treatment with 1000 mg / L spermidine, all four indicators were also higher than the other two concentrations, with the highest double haploid ratio at 7.98%. Compared with the treated radish cytoplasmic male sterile line, the overall effects were similar. The optimal treatment concentrations for putrescine and spermidine were consistent, but for spermidine, the optimal concentration was 30 mg / L, which is slightly different from the radish cytoplasmic male sterile line. Overall, the treatment effects of the radish male sterility maintainer line and the radish cytoplasmic male sterility line were similar. The effect of fertile cytoplasm on the induction of double haploids in radish was limited. This treatment technique can be used to induce double haploids in the radish male sterility maintainer line.

[0137] Example 5: Effects of different types of male parent pollination on the induction of double haploidy in radish cytoplasmic male sterile lines

[0138] 1. Prepare a 2wt% sodium chloride (NaCl) solution, a 60 mg / L gibberellin (GA3) solution, and a 20 mg / L spermidine (YJA) solution. The maternal parent material was a radish cytoplasmic male sterile line (number 24A201A), and the paternal parent materials were seven inbred lines from other species in the Brassicaceae family, namely white mustard (number 24A886; 2n=24), black mustard (number 24A803; 2n=16), African mustard (number 24A809; 2n=34), Zhejiang superior pickled mustard tuber (number 24A818; 2n=36), seed mustard (number 24A804; 2n=36), seed mustard (yellow seed) (number 24A807; 2n=36), and seed mustard (brown seed) (number 24A808; 2n=36).

[0139] 2. Chemical Treatment and Pollination: During the peak flowering period of the female parent plant, select the stigmas on the day of flowering (the stigmas should be healthy, bright, and glossy, secreting a sticky liquid; the petals should be thick; and the flower shape should be upright). Before artificial pollination, spray each treatment's stigmas with a 2wt% NaCl solution. After the solution dries, spray each treatment with a 60 mg / L GA3 solution. After the solution dries, spray each treatment with a 20 mg / L LYJA solution. After the solution dries, collect fresh pollen from each male parent plant for artificial pollination. Each solution is sprayed using a small spray bottle onto the stigmas of each radish inflorescence branch, with each inflorescence branch sprayed 3 times, approximately 0.5 mL each time. A total of 7 treatments were performed. Each treatment had 3 replicates, with approximately 80 flowers per replicate. The pollinated flowers were tagged and isolated.

[0140] Radish planting and management are carried out according to conventional cultivation methods.

[0141] 3. Data statistics and seed harvesting: Same as in Example 1.

[0142] 4. Results: such as Figures 21-24 As shown, pollination with these seven different types of Brassicaceae male parents all had a certain effect on inducing double haploid radish. Among the seed-to-silique ratio index, the pollination values ​​of four male parents—Zheyou pickled mustard tuber (24A818), seed mustard (24A804), seed mustard (yellow seed) (24A807), and seed mustard (brown seed) (24A808)—were relatively high (11.81%–17.05%), while the pollination effects of three male parents—white mustard (24A886), black mustard (24A803), and American mustard (24A809)—were slightly lower. The same pattern was observed in the seed ratio index. However, in the two indicators of plump seed ratio and double haploid ratio, the values ​​of seed mustard (brown seed) (24A808) as the male parent decreased rapidly, with the top three being seed mustard (yellow seed) (24A807), seed mustard (24A804), and Zhejiang Youzha pickled mustard (24A818). Among all four indicators, seed mustard (24A804) and seed mustard (yellow seed) (24A807) showed the best induction effects, with double haploid induction rates of 12.77% and 13.31%, respectively. This is similar to the induction effect when using the 'Radish Mustard Greens' allotetraploid (RRCC) as the male parent.

[0143] Example 6: Effects of different fertile cytoplasmic radish parent plants on double haploid induction under polyamine complex treatment.

[0144] 1. Prepare a 2wt% sodium chloride (NaCl) solution, a 60 mg / L gibberellin (GA3) solution, and a 20 mg / L spermidine (YJA) solution. The maternal parent material consisted of fertile cytoplasmic inbred lines (2n=18) of other radish genotypes, namely 896-1-2, 1135, 1136, 897, 8091, and 8098. The paternal parent material was a 'radish-kale' allotetraploid (RRCC, number 24A873). This example is to clarify the effect of the method of the present invention on the induction of double haploidy in radishes of different genotypes.

[0145] 2. Treatment and Pollination: One day before flowering, the female plants were de-emerged and isolated. The following day, when the stigmas developed to a stage similar to that of normal flowering on the first day, each treatment's stigmas were first sprayed with a 2wt% NaCl solution. After the solution dried, each treatment was then sprayed with a 60 mg / L GA3 solution. After the solution dried, each treatment was then sprayed with a 20 mg / L YJA solution. After the solution dried, fresh pollen from the male plants was collected for artificial pollination. Each solution was sprayed using a small spray bottle onto the stigmas of each radish inflorescence branch, with each inflorescence branch sprayed three times, approximately 0.5 mL each time. A total of six treatments were performed. Each treatment had three replicates, with approximately 80 flowers per replicate. The pollinated flowers were tagged and isolated.

[0146] Radish planting and management are carried out according to conventional cultivation methods.

[0147] 3. Data statistics and seed harvesting: Same as in Example 1.

[0148] 4. Results: such as Figures 25-28 As shown, the double haploid induction effects of six different radish fertile cytoplasmic inbred lines varied under the combined treatment of 2wt% NaCl solution + 60 mg / L GA3 solution + 20 mg / L YJA solution. The seed-to-silique ratio showed a large range of variation (4.57%–26.12%), with three radish materials having a ratio above 6%. The seed ratio, plump seed ratio, and double haploid ratio followed the same pattern as the seed-to-silique ratio. Four radish materials had a seed ratio greater than 6%, while the plump seed ratio and double haploid ratio showed the same variation range (1.39%–10.22%), with two radish materials having both ratios greater than 6%.

[0149] Example 7 Identification of induced double haploids in offspring

[0150] 1. Planting and preliminary morphological screening: The induced progeny (F1 generation) seeds obtained in Examples 1-6 were sown and seedlings were raised. When the seedlings grew to 4-5 true leaves, their phenotypes were observed, and suspected double haploid plants with obvious leaf notches, lighter leaf color, and thinner leaves were preliminarily screened.

[0151] 2. Cytological Chromosome Counting and Identification: Seeds suspected of being double haploid from the induced progeny (F1 seeds) obtained in Examples 1-6 were germinated for approximately one week. The radicle tips were then treated with 2 mM 8-hydroxyquinoline solution for 3 h. Alternatively, young pistils (3-4 mm) from mature plants suspected of being double haploid from the induced progeny (F1 seeds) obtained in Examples 1-6 were treated with 2 mM 8-hydroxyquinoline solution for 5 h. After treatment, the samples were washed three times with distilled water, then fixed with Carnoy's fixative for 2-24 h, and then stored in 70 v / v% ethanol. The fixed and stored experimental materials were then dissociated in 1 M hydrochloric acid at 60°C for 8-10 min. Root tips or young pistils were then removed and washed three times with distilled water. Root tip meristems or young pistils were placed on glass slides, stained with a modified phenol-fuchsin solution (purchased from Shanghai Yuanye Biotechnology Co., Ltd., model R20749), and then subjected to routine slide preparation. Chromosomes were observed and counted under a microscope. The chromosome number of the observed material was confirmed and photographed under a microscope. When the number of chromosomes in the root tip or young pistil was 18 (2n=18), it was determined to be a radish double haploid.

[0152] 3. Microsatellite (SSR) molecular marker verification: Genomic DNA was extracted from the above-mentioned double haploid plants confirmed by cytology. For plants whose paternal parent was a 'radish-kale' allotetraploid (RRCC, number 24A873), PCR amplification was performed using polymorphic SSR primers from the radish and kale genomes (Tables 1 and 2). For plants whose paternal parent was one of seven inbred lines from other Brassicaceae species, PCR amplification was performed using polymorphic SSR primers from the radish genome and their respective species genomes. The amplification products were analyzed by agarose gel electrophoresis. Compared with the maternal and paternal parents, the double haploid plants showed consistency with the maternal parent at all loci, thus finally confirming their double haploid status.

[0153] To amplify the genomic DNA of parent and offspring, we employed an efficient method: screening primers based on the paternal and maternal genomic DNA. Taking a paternal allotetraploid of 'Radish and Mustard Greens' (RRCC, number 24A873) as an example, we initially screened 22 primer pairs (Table 1). From these 22 pairs, we selected four primer pairs with a high number of polymorphic sites, stable amplification products, and co-dominant amplification (Table 2) for molecular identification of the induced double haploid offspring. All primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0154] Table 1

[0155] bSSR1 SEQ ID NO.1 TTGTAAATGTAAACAAAGGGG SEQ ID NO.2 CAAAATGAAACAATTCTCAGGG bSSR2 SEQ ID NO.3 TATCAGGGTTTCCTGGGTTG SEQ ID NO.4 GTGAACAAGAAGAAAAGAGAGCC bSSR3 SEQ ID NO.5 GGAGGAACGACCTTGATT SEQ ID NO.6 GCCAAAATATACTATGCGTCT bSSR4 SEQ ID NO.7 AATGCCCCGGAAGTTATG SEQ ID NO.8 CACTACGAATCAGCCATCAAAG bSSR5 SEQ ID NO.9 CATGATTTGTGAATTGTTATCC SEQ ID NO.10 TCAAGTTTAGGGAAAGGTGT bSSR6 SEQ ID NO.11 CGCTAGACGGAAGGAGAAAG SEQ ID NO.12 TAGAGTTTAGGGGCCAAAGG bSSR7 SEQ ID NO.13 CCAGCGAAGGATTTGACGAC SEQ ID NO.14 GACGAATCGAGTGCCCTG bSSR8 SEQ ID NO.15 GTTTTGGCCGTAAATCCCAC SEQ ID NO.16 GTTACGGGTAGCGTGTGTC bSSR9 SEQ ID NO.17 TGCTGCGCCGAACAATAG SEQ ID NO.18 CCGATCGTGGTTCATATTGC bSSR10 SEQ ID NO.19 GTTAACGCACTTAAGGACCATG SEQ ID NO.20 ATTGACAACACCACCTCCCG bSSR11 SEQ ID NO.21 CCATTCGCAGCTGTATTTCA SEQ ID NO.22 ACCCACTGATGCATACCTCC bSSR12 SEQ ID NO.23 GCTTTATACGCCGTCTCTCG SEQ ID NO.24 TTGAAAAGAGCCGCTCCTAA bSSR13 SEQ ID NO.25 GTGGCGTTAGAGGTTGATGG SEQ ID NO.26 TCAAGAGTCAGATCGAGACGG rSSR1 SEQ ID NO.27 AACTTTGCTATGTCCGGTGG SEQ ID NO.28 SUMMERSUMMARYAGG rSSR2 SEQ ID NO.29 TTGCGTATTTAGACGAGGGC SEQ ID NO.30 GGTCGCATGAGTTCCTTCTC rSSR3 SEQ ID NO.31 CTTCTTCACCTTCGTCTCCG SEQ ID NO.32 TGCTGTTGCTGTTGTGAATG rSSR4 SEQ ID NO.33 GACTTCTGGAAACAGCCCAC SEQ ID NO.34 TATTTCCCGGGGCTAAAATTC rSSR5 SEQ ID NO.35 GTTCGATCAAGAAGCCTTGC SEQ ID NO.36 TCATCAAGGAAGCACGAC rSSR6 SEQ ID NO.37 GGAGCCAGGAGAAGAGG SEQ ID NO.38 CCCAAAACTTCCAAGAAAAGC rSSR7 SEQ ID NO.39 CGGTGGAATTTTCCAAAAA SEQ ID NO.40 TGTCTTTCTCTTTCTCCCTATCACA rSSR8 SEQ ID NO.41 GGAGGAGCAATGTCGTCTTC SEQ ID NO.42 TGCTGTGGAATCTCTTTGTGC rSSR9 SEQ ID NO.43 GAAGCCCTCAGATGTCAAGC SEQ ID NO.44 CATCCGTTTTGAGATGGAAA

[0156] Table 2

[0157] rSSR2 SEQ ID NO.29 TTGCGTATTTAGACGAGGGC SEQ ID NO.30 GGTCGCATGAGTTCCTTCTC rSSR4 SEQ ID NO.33 GACTTCTGGAAACAGCCCAC SEQ ID NO.34 TATTTCCCGGGGCTAAAATTC bSSR2 SEQ ID NO.3 TATCAGGGTTTCCTGGGTTG SEQ ID NO.4 GTGAAAGAAAGAGAGCC bSSR4 SEQ ID NO.7 AATGCCCCGGAAGTTATG SEQ ID NO.8 CACTACGAATCAGCCATCAAAG

[0158] 4. Results: Based on the morphological characteristics of the induced plants (maternal parent), namely the radish cytoplasmic male sterile line, male sterile maintainer line, and other fertile cytoplasmic inbred lines of various genotypes, it can be preliminarily determined whether the induced offspring seedlings are double haploids. The induced lines (pollinating paternal parent) are allotetraploids of 'Radish and Mustard Greens' (RRCC, number 24A873) or inbred lines of other Brassicaceae species (white mustard, Brassica). These lines exhibit significant morphological differences, and their true hybrid offspring show some characteristics of mustard plants, such as low leaf notching, dark leaf color, and thick leaves. In contrast, the double haploid offspring are genetically consistent with the radish cytoplasmic male sterile line, male sterile maintainer line, and other fertile cytoplasmic inbred lines of various genotypes used in this invention. They show distinctly deep leaf notching, lighter leaf color, and thinner leaves. Therefore, double haploid offspring can be preliminarily identified from the induced offspring (some double haploid offspring, such as...). Figures 29-36 (As shown).

[0159] Chromosomal composition is identified by inducing chromosome number in the radicles or young pistils of offspring seeds. Currently, two types of chromosome numbers have been identified: one type has 18 chromosomes (the chromosome number of some double-haploid offspring is as follows...). Figures 37-44 As shown, one type is a double haploid, and its seedling morphology is consistent with the induced maternal parent; the other type has a chromosome number other than 18 (including 27, 26, 21 or 17), which is a true hybrid, and its plant morphology is intermediate between radish and mustard.

[0160] Genomic DNA of induced progeny identified as double haploids by cytology was amplified by PCR and analyzed by SSR molecular markers. The results showed that the banding pattern of the identified plants was completely consistent with the maternal parent and inconsistent with the paternal parent, confirming at the molecular level that they were double haploids derived from the maternal parent (electrophoresis images of some double haploid progeny are shown below). Figures 45-48 As shown, the results of the four molecular marker identifications corroborate each other, conclusively proving that all the tested progeny plants (1-29) contain only specific bands from the maternal radish cytoplasmic male sterile line (number 24A201A) in their genomes, and completely lack specific bands or other heterozygous bands from the paternal 'radish-gaylan' allotetraploid (RRCC, number 24A873). This molecular evidence, combined with the chromosome counting results (2n=18), forms a complete chain of evidence, ultimately confirming that these progeny plants are genetically homozygous double haploids. This result strongly demonstrates that the method of this invention can effectively produce radish double haploids without exogenous genomes, providing ideal homozygous material for subsequent genetic research and breeding applications.

Claims

1. A rapid method for inducing double haploidy in radish, characterized in that, Includes the following steps: (1) Preparation of hybrid parents: Select radish cytoplasmic male sterile line, radish male sterile maintainer line or radish fertile cytoplasmic inbred line as female parent, and select inbred line of intergenous hybrid of radish or distant species of radish in the Brassicaceae family as induced male parent; wherein, the intergenous hybrid of radish includes 'radish kale' allotetraploid, and the distant species of radish in the Brassicaceae family include white mustard or Brassica oleracea; (2) Chemical treatment and pollination: During the peak flowering period of the female plant, select the stigma in a suitable developmental state and treat it with chemicals: spray NaCl solution first, then spray polyamine solution, or spray NaCl solution first, then GA3 solution, then spray polyamine solution; after chemical treatment, collect pollen from the male plant for pollination, and mark and isolate it after pollination. (3) Post-pollination management and statistics of induction-related indicators; (4) Identification of radish double haploids.

2. The rapid induction method for double haploidy in radish according to claim 1, characterized in that, In step (1), when selecting a male-sterile radish maintainer line or a fertile radish cytoplasmic inbred line as the female parent, the female parent plant is deflowered and isolated 1 day before flowering, and then step (2) is carried out.

3. The rapid induction method for double haploidy in radish according to claim 1, characterized in that, In step (2), the stigmas in the suitable development state are stigmas 1 day before flowering, stigmas on the day of flowering (i.e., stigmas on the 1st day of flowering), and stigmas on the 2nd day of flowering; wherein, the stigmas 1 day before flowering are sprayed with the agent after the buds are removed.

4. The rapid induction method for double haploidy in radish according to claim 3, characterized in that, In step (2), the stigma in the suitable development state is the stigma on the day of flowering, that is, the stigma on the first day of flowering.

5. The rapid induction method for double haploidy in radish according to claim 1, characterized in that, Step (2) First, spray NaCl solution, then spray polyamine solution. The NaCl solution includes 1.5wt% to 3wt% NaCl solution; the polyamine solution includes putrescine solution, spermidine solution or spermine solution, wherein the putrescine solution includes 50 mg / L to 200 mg / L putrescine solution, the spermidine solution includes 20 mg / L to 40 mg / L spermidine solution, and the spermine solution includes 500 mg / L to 1000 mg / L spermine solution; First, spray with NaCl solution, then spray with GA3 solution, and finally spray with polyamine solution. The NaCl solution comprises 1.5wt% to 3wt% NaCl solution; the GA3 solution comprises 50 mg / L to 100 mg / L GA3 solution; the polyamine solution comprises putrescine solution, spermidine solution, or spermine solution, wherein the putrescine solution comprises 50 mg / L to 200 mg / L putrescine solution, the spermidine solution comprises 20 mg / L to 40 mg / L spermidine solution, and the spermine solution comprises 100 mg / L to 1000 mg / L spermine solution. The first solution should be dried before spraying the second solution. The polyamine solution should be dried before pollination.

6. The rapid induction method for double haploidy in radish according to claim 5, characterized in that, Step (2) First spray NaCl solution, then spray polyamine solution. The NaCl solution includes 2wt% NaCl solution; the polyamine solution includes putrescine solution, spermidine solution or spermine solution. The putrescine solution includes 100 mg / L putrescine solution. When the maternal parent is a radish cytoplasmic male sterile line or a radish fertile cytoplasmic inbred line, the spermidine solution includes 20 mg / L spermidine solution. When the maternal parent is a radish male sterile maintainer line, the spermidine solution includes 30 mg / L spermidine solution. The spermine solution includes 1000 mg / L spermine solution. First, spray with NaCl solution, then spray with GA3 solution, and finally spray with polyamine solution. The NaCl solution comprises 2 wt% NaCl solution; the GA3 solution comprises 60 mg / L GA3 solution; the polyamine solution comprises putrescine solution, spermidine solution, or spermine solution. The putrescine solution comprises 100 mg / L putrescine solution. When the maternal parent is a radish cytoplasmic male sterile line or a radish fertile cytoplasmic inbred line, the spermidine solution comprises 20 mg / L spermidine solution. When the maternal parent is a radish male sterile maintainer line, the spermidine solution comprises 30 mg / L spermidine solution. The spermine solution comprises 1000 mg / L spermine solution. The first solution should be dried before spraying the second solution; the polyamine solution should be dried before pollination.

7. The rapid induction method for double haploidy in radish according to claim 1, characterized in that, Step (2) Spray each solution onto the stigma of each radish inflorescence branch, spraying each inflorescence branch 3 times, about 0.5 mL each time.

8. The method for rapid induction of double haploidy in radish according to claim 1, characterized in that, Step (3) After pollination, normal cultivation and management are carried out, mature siliques are harvested, F1 generation seeds are obtained, and induction-related indicators are statistically analyzed. The induction-related indicators include the seed-silique ratio, seed ratio, plump seed ratio and double haploid ratio.

9. The rapid induction method for double haploidy in radish according to claim 1, characterized in that, Step (4) adopts multi-level identification, and performs morphological screening, cytological chromosome counting identification and SSR molecular marker verification on the F1 generation in sequence to screen out double haploid plants with 18 chromosomes and homozygous genotype.

10. The method for rapid induction of double haploids in radish according to claim 9, characterized in that, When the induced parent is a 'radish and mustard green' allotetraploid, the primer pairs used for SSR molecular markers are rSSR2, rSSR4, bSSR2, and bSSR4. The sequences of rSSR2 are shown in SEQ ID NO.29 and SEQ ID NO.30, the sequences of rSSR4 are shown in SEQ ID NO.33 and SEQ ID NO.34, the sequences of bSSR2 are shown in SEQ ID NO.3 and SEQ ID NO.4, and the sequences of bSSR4 are shown in SEQ ID NO.7 and SEQ ID NO.8.