Apoe knock-out of abhd17a in monocyte macrophages - / - Application of mice in atherosclerosis

Abstract

The application discloses an application of Apoe gene deletion mice with Abhd17a specifically deleted in mononuclear macrophages in atherosclerosis, relates to the technical field of animal models, and is constructed by CRISPR / Cas9 technology, and is further crossed and backcrossed with mice to obtain the mouse model. The application provides an animal model capable of specifically studying the role of Abhd17a in mononuclear macrophages in atherosclerosis, and establishes a standardized application method of the animal model in the disease research. Through monitoring, histopathological staining and analysis of the model mice, the influence of Abhd17a deletion in mononuclear macrophages can be revealed, and an experimental tool is provided for mechanism research and drug screening of atherosclerosis.

Description

Technical Field

[0001] This invention relates to the field of animal model technology, and more particularly to the knockout of Abhd17a in mononuclear macrophages. Application of mice in atherosclerosis. Background Technology

[0002] Atherosclerosis is an arterial disease characterized by lipid deposition and chronic inflammation. Its pathological process involves persistent immune cell infiltration and inflammatory response, which can ultimately lead to plaque formation, instability, or even rupture, resulting in serious cardiovascular and cerebrovascular events such as myocardial infarction and stroke. In this process, the transformation of macrophages derived from monocytes into foam cells is a key pathological step.

[0003] Palmitoylation is a reversible post-translational modification of proteins, primarily occurring on cysteine ​​residues. Through the binding and dissociation of palmitic acid, it dynamically regulates protein stability, membrane localization, and interactions, thus broadly participating in physiological and pathological processes such as cell proliferation, apoptosis, inflammatory responses, and differentiation. Recent studies have found that abnormal palmitoylation is closely associated with various metabolic diseases, particularly playing a significant role in non-alcoholic fatty liver disease, diabetes, and cardiovascular disease, suggesting that it may participate in the occurrence and development of atherosclerosis by regulating lipid metabolism and immune cell function.

[0004] The depalmitoylase-containing dehydrogenase domain 17A (Abhd17a) is an important depalmitoylating enzyme known to play a crucial role in synaptic development and functional regulation. Recently, it has also been identified as a metastasis inhibitor in the tumor microenvironment, suggesting its potential involvement in immune cell activation or immune surveillance. However, despite some understanding of the roles of Abhd17a in the nervous system and tumor immunity, its role in the differentiation of monocytes / macrophages into foam cells and in the formation of atherosclerosis has not been reported. Therefore, the lack of a clear understanding in this field regarding whether and how Abhd17a affects the development and progression of atherosclerosis by regulating monocyte / macrophage function, and how to construct cell-specific animal models for experimental purposes, hinders the progress in understanding disease mechanisms or developing potential intervention strategies based on this target. Summary of the Invention

[0005] This application embodiment provides a method for knocking out Abhd17a in mononuclear macrophages. The application of this technology in mice to atherosclerosis addresses the lack of reports on the role of Abhd17a in regulating the progression of atherosclerosis in existing technologies.

[0006] This application provides a method for knocking out Abhd17a in mononuclear macrophages. In mice, the Apoe gene was knocked out in the mouse model, and the Abhd17a gene in monocytes and macrophages was specifically knocked out.

[0007] Furthermore, the knockout of the Abhd17a gene in mononuclear macrophages in the mouse model was achieved using the Cre-loxp system.

[0008] Furthermore, the method for constructing the mouse model includes: Abhd17a gene conditional knockout mice were constructed using CRISPR / Cas9 technology, with loxp sequences inserted flanking the Abhd17a gene in the Abhd17a gene conditional knockout mice. The Abhd17a gene conditional knockout mice were crossed with Cx3cr1 gene Cre recombinase tool mice, and the Cx3cr1 gene Cre recombinase tool mice were also Apoe gene knockout mice. Mice with Abhd17a gene knockout and Apoe gene knockout in monocytes and macrophages were obtained by backcrossing.

[0009] Furthermore, the sgRNA sequence used in the construction of the Abhd17a gene conditional knockout mouse includes: sgRNA-1: 5'-GGGTCTCAAAAGATTTCTGGTGG-3'; sgRNA-2: 5'-ACTAGAGGGTGCCCAAGTGACGG-3'.

[0010] Furthermore, the primer sequences for genotyping the Abhd17a gene conditional knockout mice include: Upstream primer Abhd17a-F1: CAGGTCTGTCTGGGTTGTCC; Downstream primer Abhd17a-R1: AGAACTGTGCATAAGAAGAGCCT.

[0011] Furthermore, the primer sequences for genotyping the Cx3cr1 gene Cre recombinase tool mouse include: Upstream primer Cx3cr1-F1: GACATTTGCCTTGCTGGAC; Downstream primer Cx3cr1-R1: GCAGGGAAATCTGATGCAAG; Downstream primer Cx3cr1-R2: CCTCAGTGTGACGGAGACAG.

[0012] Furthermore, mice obtained through backcrossing were mated with their siblings to establish a genetically stable offspring mouse strain with conditional knockout of the Abhd17a gene in monocytes and macrophages under the Apoe gene knockout background.

[0013] The above-mentioned method of knocking out Abhd17a in mononuclear macrophages Application of mice in atherosclerosis.

[0014] Furthermore, it can be used as a disease model for atherosclerosis research and for drug target validation and treatment strategy development.

[0015] One or more technical solutions provided in the embodiments of this application have at least the following technical effects or advantages: A genetically modified animal model with a clear genetic background, cell specificity, and stable phenotype was successfully constructed: Conditional knockout mice of the Abhd17a gene specific to monocytes and macrophages were successfully obtained in the Apoe-deficient background using CRISPR / Cas9 technology and a hybridization breeding strategy. This model has a clear genotype and is stably inherited, providing a reliable in vivo experimental tool for studying the function of Abhd17a in monocytes and macrophages in the context of atherosclerosis.

[0016] An efficient and reproducible phenotypic evaluation system for atherosclerosis was established. Based on this model, combined with hyperlipidemia induction, histopathological staining, and blood lipid testing, a systematic and quantitative method for atherosclerosis phenotypic analysis was developed. This method is standardized in operation, yields highly comparable results, and is suitable for standardized research on the mechanisms of this disease.

[0017] The model exhibits a significant and stable anti-atherosclerotic phenotype compared to control mice. In contrast, monocyte-macrophage-specific Abhd17a deletion Mice fed a high-fat diet showed a significant reduction in aortic plaque area and a marked decrease in the proportion of necrotic plaque cores. This model has clear experimental value in simulating the effect of Abhd17a deletion in mononuclear macrophages on the progression of atherosclerosis.

[0018] This model provides a novel experimental platform for research on the mechanisms of atherosclerosis and drug screening: It fills the gap in the lack of a dedicated animal model for Abhd17a in atherosclerosis research and can be used to: elucidate the specific mechanisms of action of Abhd17a in atherosclerosis, especially its function in the key cell type of monocytes and macrophages; evaluate drugs or interventions targeting the Abhd17a pathway; and explore the regulatory network between protein palmitoylation modification, immune metabolism, and atherosclerosis.

[0019] Therefore, this model not only has significant value in basic research but also provides a practical preclinical experimental system for the development of related treatment strategies. Its scientific significance is outstanding: it is the first time that Abhd17a deficiency in mononuclear macrophages has been demonstrated in an animal model to alleviate the progression of atherosclerosis in the context of Apoe deficiency, clarifying the role of Abhd17a as a potential regulatory target for atherosclerosis, and providing new theoretical basis and experimental platform for the study of the mechanism of this disease and the development of treatment strategies. Attached Figure Description

[0020] Figure 1 Electrophoresis diagram for genotyping of the Abhd17a gene-edited mouse of this invention; Figure 2 This is a diagram showing the Abhd17a gene knock-in strategy and DNA detection results of this invention. Figure 3 For the present invention and Electrophoretic identification of mouse hybrid offspring genotypes; Figure 4 The specific deletion of Abhd17a in mononuclear macrophages in this invention has the following effect: The effect of atherosclerosis phenotype on mice.

[0021] In the picture: Figure 4 AB: Statistical analysis of plaque area shown by Oil Red O staining of the entire aorta; Figure 4 CE: H&E staining of the aortic root shows statistical analysis of plaque area and necrosis core. Figure 4 F: Weight change curve during a high-fat diet; Figure 4 GJ: Analysis chart of plasma total cholesterol (TC), triglycerides (TG), high-density lipoprotein (HDL-C) and low-density lipoprotein (LDL-C) levels. Detailed Implementation

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains; the terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to limit the invention; the term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0023] Example 1: To directly verify and reveal the role of Abhd17a in regulating the process of atherosclerosis, and to address the technological gap in the lack of tools for studying Abhd17a function in monocytes and macrophages under atherosclerotic pathological scenarios, this example provides the optimal technical solution of the present invention. The core innovation of this solution lies in: creatively constructing and applying "monocyte-macrophage-specific Abhd17a-deficient mice (… This novel animal model system targets the specific chronic inflammatory disease environment of atherosclerosis, combining disease-susceptibility-based (Apoe-deficient) Cre mice with monocyte-macrophage-specific genes with target gene floxp mice. By combining these methods, an effective in vivo research tool can be provided to solve the aforementioned technical problems.

[0024] First, build Mice; Determination of the target sequence: Using CRISPR / Cas9 gene editing technology and CRISPOR online design software, the location of the mouse Abhd17a gene was determined and the loxp sequence was inserted.

[0025] Specifically, the mouse Abhd17a gene sequence (ENSMUSG00000003346.15) was located in the mouse genome database ensembl. Then, the online design software CRISPOR was used to screen and design specific guide RNAs (sgRNAs) within the Intron 2-3 and Intron 3-4 regions of this gene. (See details below.) Figure 1 As shown. The designed sgRNA is intended to be inserted into the loxp sequence via induced frameshift, and its sequence details are provided below (all sgRNAs were synthesized and provided by Nanjing Genscript Biotech Co., Ltd.): Among them, sgRNA-1: 5'-· GGGTCTCAAAAGATTTCTGGTGG-3'; sgRNA-2: 5'-ACTAGAGGGTGCCCAAGTGACGG -3'; Embryo microinjection: Purified Cas9 mRNA and the above-mentioned sgRNA are co-injected into the embryo. Background: The pronucleus of a mouse zygote.

[0026] Embryo transfer and offspring generation: The injected embryos were transferred into the oviducts of pseudopregnant mice, and F0 generation mice were obtained by full-term delivery.

[0027] Genotyping and strain establishment: Genomic DNA was extracted from mouse tails, and specific primers were designed targeting the Abhd17a gene editing site for PCR amplification. The PCR products were then analyzed by gel electrophoresis or sequencing. The primer sequences are as follows: Abhd17a-F1: CAGGTCTGTCTGGGTTGTCC; Abhd17a-R1:AGAACTGTGCATAAGAAGAGCCT; The PCR reaction system was as follows: 20 ng of mouse tail DNA as template; 2 μL of upstream primer; 2 μL of downstream primer; 25 μL of 2 × Taq Master Mix (purchased from Vazyme, P111-01); supplementary... Add to a total volume of 50 μL. The PCR reaction program is as follows: pre-denaturation at 94℃ for 5 min; followed by 35 cycles of denaturation at 94℃ for 30 s, annealing at 60℃ for 30 s, and extension at 72℃ for 30 s; finally, a final extension at 72℃ for 10 min. If only the wild-type allele is present, a band of approximately 160 bp can be amplified; if the loxp site insertion is present, a band of approximately 194 bp can be amplified. Figure 1 The gel image is shown. After obtaining the PCR product, 2 μL of the product was used for electrophoresis detection. By analyzing the amplification results of the two pairs of primers, it can be determined whether the Founder mouse carries the loxp sequence insertion.

[0028] like Figure 1 The identification results shown indicate that the Q62-65 genotypes are all... Mice, Based on the electrophoresis results, one of them was... Mouse Q65 and a wild-type The remaining PCR products from the mice were sent for sequencing. Figure 2 As shown, one inserted loxp sequence was found in each of the second and third exons, and in the third and fourth exons of the Abhd17a gene obtained from mice.

[0029] Filter out mice and Mice were hybridized, and the offspring underwent continuous genotyping and mating with siblings to obtain the resulting offspring. Mice and Mouse backcrossing eventually bred mice and Mouse strains.

[0030] Specifically, genomic DNA was extracted from the rat tail, and specific primers were designed to target the Abhd17a gene and the Cx3cr1 editing site for PCR amplification. The PCR products were then analyzed by gel electrophoresis. The reaction system and PCR procedure for Abhd17a were the same as described above. The PCR primer sequences for Cx3cr1 are as follows: Cx3cr1-F1:GACATTTGCCTTGCTGGAC; Cx3cr1-R1:GCAGGGAAATCTGATGCAAG; Cx3cr1-R2: CCTCAGTGTGACGGAGACAG; The PCR reaction system for Cx3cr1 was as follows: 20 ng of mouse tail DNA as template; 2 μL of each primer; 25 μL of 2 × Taq Master Mix (purchased from Vazyme, P111-01); supplementary... Add to a total volume of 50 μL. The PCR reaction program is as follows: pre-denaturation at 94℃ for 5 min; followed by 35 cycles of denaturation at 94℃ for 30 s, annealing at 60℃ for 30 s, and extension at 72℃ for 40 s; and a final extension at 72℃ for 10 min. If only the wild-type allele is present, a band of approximately 302 bp can be amplified; if the loxp site insertion is present, a band of approximately 380 bp can be amplified.

[0031] like Figure 3 The identification results shown indicate that the R81-82 genotype is... Mice, R83 genotype is The R84-85 genotype is The R86 genotype is .

[0032] To verify the above construction The model can effectively reveal the role of Clec4d in atherosclerosis and demonstrate its breakthrough as an optimal solution tool. This embodiment presents a systematic phenotypic and mechanistic analysis.

[0033] Experimental design: Grouping of experimental animals: Control group: Mice (n=9). The Abhd17a gene function was normal in the mononuclear macrophages of this group of mice, serving as a control.

[0034] Experimental group: Dual-gene modified mice (n=15). This group is the disease model constructed in this invention, and the research subjects are mononuclear macrophages with specific deletion of the Abhd17a gene.

[0035] Disease model induction: Both groups of mice were fed a high-fat diet (containing 21% fat and 0.15% cholesterol) from 7-8 weeks of age for 14 weeks to stably induce atherosclerotic plaque formation. Mouse weight was recorded weekly to monitor basic health status.

[0036] Effect evaluation and data analysis: 1. Overall assessment of atherosclerotic lesions; Methods: After 14 weeks of high-fat feeding, mice were sacrificed, the entire aorta (from the heart to the bifurcation of the iliac artery) was separated, longitudinally dissected, and Oil Red O staining was performed to mark lipid deposits (plaques) in the arterial wall.

[0037] Results and conclusions: Figure 4 As shown in A and B, through intuitive comparison and statistical analysis, The total aortic plaque area of ​​the experimental group mice was significantly smaller than that of the experimental group mice. Control group (p<0.05). This result is the first direct demonstration at the in vivo animal level that the specific deletion of the Abhd17a gene in mononuclear macrophages can significantly reduce the overall disease burden during the development of atherosclerosis.

[0038] 2. Stability assessment of aortic root plaques; Methods: Frozen or paraffin sections were prepared from the root of the mouse aorta and stained with hematoxylin and eosin (H&E) to quantitatively analyze the plaque area and the proportion of necrotic core within the plaque.

[0039] Results and conclusions: Figure 4 As shown in CE, H&E staining revealed plaque formation in the aortic root of both groups of mice, but quantitative analysis revealed more profound differences. The proportion of necrotic cores within plaques in the experimental group mice was significantly lower than that in the control group. control group ( Figure 4 E, p<0.01). Necrotic core is a key feature of plaque instability and rupture. This result indicates that Abhd17a deletion in monocytes and macrophages not only reduces plaque size but, more importantly, improves plaque stability, pointing to a clinical benefit superior to simply shrinking plaques (such as reducing the risk of myocardial infarction), highlighting the high value of the findings of this invention.

[0040] 3. Monitoring of weight changes; Methods: From week 0 to week 14, mice in both groups were weighed weekly and their weight changes were recorded.

[0041] Results and conclusions: Figure 4 As shown in Figure F, the weight gain of both groups of mice remained stable throughout the high-fat feeding period, with no statistically significant differences in weight at any time point. This result indicates that the atherosclerotic mitigation effect caused by Abhd17a deletion in monocytes and macrophages is not due to the indirect effect of weight changes.

[0042] 4. Systemic metabolic index analysis; Methods: Mouse plasma was collected, and the levels of total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were detected using a biochemical analyzer.

[0043] Results and conclusions: Figure 4 As shown in GJ, experimental group and In the control group mice, there were no statistically significant differences in plasma cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL), and low-density lipoprotein cholesterol (LDL) levels. This result indicates that the atherosclerotic mitigation and plaque stabilization effects of Abhd17a deficiency in monocytes and macrophages are not achieved through the traditional pathway of systemic regulation of blood lipid levels. It suggests that Abhd17a exerts its pro-atherosclerotic effect by regulating local functions of monocytes and macrophages (such as inflammatory responses and foam cell formation).

[0044] This embodiment is explained in detail. The process of constructing the dual-gene-modified mouse model and the application of this model in disease phenotypic analysis clearly demonstrate that the constructed model... Mouse models are an effective tool for studying the function of Abhd17a in monocytes and macrophages in atherosclerosis; using this model, it was revealed for the first time that Abhd17a deficiency in monocytes and macrophages can significantly alleviate... This study modulates the severity of atherosclerotic lesions in mice and enhances plaque stability, with this protective effect independent of systemic lipid and body weight changes. This not only clarifies the crucial role of Abhd17a in this disease for the first time, filling a technological gap, but more importantly, it provides novel insights into the immune-inflammatory regulatory mechanisms of atherosclerosis and the role of protein palmitoylation modification within them, laying a solid experimental foundation for developing novel therapeutic strategies targeting Abhd17a.

[0045] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. For those skilled in the art, the present invention can have various modifications and variations. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for knocking out Abhd17a in mononuclear macrophages Mice, characterized in that, In the mouse model, the Apoe gene was knocked out, and the Abhd17a gene in monocytes and macrophages was specifically knocked out.

2. The method of knocking out Abhd17a in mononuclear macrophages as described in claim 1 Mice, characterized in that, The knockout of the Abhd17a gene in mononuclear macrophages in the mouse model was achieved using the Cre-loxp system.

3. The method of knocking out Abhd17a in mononuclear macrophages as described in claim 1 Mice, characterized in that, The method for constructing the mouse model includes: Abhd17a gene conditional knockout mice were constructed using CRISPR / Cas9 technology, with loxp sequences inserted flanking the Abhd17a gene in the Abhd17a gene conditional knockout mice. The Abhd17a gene conditional knockout mice were crossed with Cx3cr1 gene Cre recombinase tool mice, and the Cx3cr1 gene Cre recombinase tool mice were also Apoe gene knockout mice. Mice with Abhd17a gene knockout and Apoe gene knockout in monocytes and macrophages were obtained by backcrossing.

4. The method for knocking out Abhd17a in mononuclear macrophages as described in claim 3 Mice, characterized in that, The sgRNA sequence used in the construction of the Abhd17a gene conditional knockout mouse includes: sgRNA-1: 5'-GGGTCTCAAAAGATTTCTGGTGG-3'; sgRNA-2: 5'-ACTAGAGGGTGCCCAAGTGACGG-3'.

5. The method for knocking out Abhd17a in mononuclear macrophages as described in claim 3 Mice, characterized in that, The primer sequences for genotyping the Abhd17a gene conditional knockout mice include: Upstream primer Abhd17a-F1: CAGGTCTGTCTGGGTTGTCC; Downstream primer Abhd17a-R1: AGAACTGTGCATAAGAAGAGCCT.

6. The method for knocking out Abhd17a in mononuclear macrophages as described in claim 3 Mice, characterized in that, The primer sequences for genotyping the Cx3cr1 gene Cre recombinase tool mouse include: Upstream primer Cx3cr1-F1: GACATTTGCCTTGCTGGAC; Downstream primer Cx3cr1-R1: GCAGGGAAATCTGATGCAAG; Downstream primer Cx3cr1-R2: CCTCAGTGTGACGGAGACAG.

7. The method for knocking out Abhd17a in mononuclear macrophages as described in claim 3 Mice, characterized in that, Mice obtained through backcrossing were mated with their siblings to establish a genetically stable progeny mouse strain with conditional knockout of the Abhd17a gene in monocytes and macrophages under the Apoe gene knockout background.

8. The method for knocking out Abhd17a in mononuclear macrophages as described in any one of claims 1-7 Application of mice in atherosclerosis.

9. The application as described in claim 8, characterized in that, Its applications include serving as a disease model for atherosclerosis research and for drug target validation and treatment strategy development.

Images