Preparation method and application of bone-targeted ferroptosis lipid nanocomposites

Abstract

The application relates to the technical field of medicines, in particular to a preparation method and application of a bone-targeting ferroptosis lipid nanocomposite. 2k The bone-targeting ferroptosis lipid nanocomposite is composed of alendronate-modified dimyristyl glycerol polyethylene glycol 2000 (DMG-PEG The bone-targeting ferroptosis lipid nanocomposite provided by the application has good bone targeting and tumor-bone penetration effects, can target the ferroptosis lipid nanocomposite to bone tumors or tumor bone metastasis sites, induces tumor cell ferroptosis, and inhibits the progression and secondary metastasis of the tumor cells.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, specifically to a method for preparing and applying a bone-targeting ferrode lipid nanocomposite. Background Technology

[0002] Cancer poses a significant threat to human survival and health. During the development and progression of cancer, a large proportion of patients experience metastasis, with bone being a common site for tumor development and metastasis (Cook GJR, Thorpe MP. Cancer J.2024; 30(3): 202-209). Bone metastasis not only exacerbates tumor progression but also serves as a transit point for secondary metastasis (Satcher RL, Zhang XH. Nat Rev Cancer. 2022; 22(2): 85-101). Furthermore, bone metastasis leads to a series of bone-related events (SREs) such as bone pain, fractures, hypercalcemia, anemia, and nerve compression symptoms, posing significant challenges to patient survival and prognosis (van Broekhoven DL, et al. Clin Genitourin Cancer.2023; 21(3): e190-e197).

[0003] Currently, the main drugs targeting SREs are bisphosphonates and RANKL inhibitors, collectively referred to as bone-modifying drugs (Chinese Journal of Oncology, 2024, 46(6): 517-525). Bisphosphonates can specifically bind to hydroxyapatite in bone, inhibiting osteoclast activity, suppressing bone resorption, and improving SREs; RANKL inhibitors are mainly monoclonal antibody preparations targeting RANKL, which can also inhibit osteoclast activation and improve SREs. Therefore, bone-modifying drugs have high selectivity and active targeting for bone, and can be used as targets for formulation development.

[0004] Chinese patent document CN113521097A discloses a trivalent iron-chelated dendritic macromolecule / pDNA complex, its preparation, and its application. This complex is a fifth-generation polyamide amine PAMAM dendritic macromolecule surface-modified with 8-hydroxyquinoline-2-carboxylic acid to chelate trivalent iron ions, internally encapsulating gold nanoparticles and loading p53pDNA. It exhibits good biocompatibility, monodispersity, and low cytotoxicity, while also possessing fluorescence imaging capabilities. It can be used for combined therapy of ferroptosis and gene therapy for tumors. Chinese patent document CN115645527A discloses a method for preparing and applying a triple-combination tumor-targeting nanodelivery system. Folic acid-modified dopamine and dopamine polymerization are used to obtain a carrier material, which is then co-loaded with camptothecin and iron to obtain a co-loaded camptothecin / iron triple-combination chemotherapy / ferroptosis / photothermal nanotherapy system with active tumor targeting and photothermal conversion properties. This system can be used for active targeted tumor therapy, synergistically killing drug-resistant tumor cells through multiple pathways. However, there are currently no reports on the preparation method and application of a bone-targeting ferroptosis lipid nanocomposite with good bone targeting and tumor-bone penetration. Summary of the Invention

[0005] The purpose of this invention is to provide a method for preparing and applying a bone-targeting ferroptosis lipid nanocomposite.

[0006] In a first aspect, the present invention provides a bone-targeting ferroptosis lipid nanocomposite comprising dimyristoylglycerol polyethylene glycol 2000 (DMG-PEG) modified with sodium alendronate. 2k Composed of α-ALE, sterols, phospholipids, cationic lipids, and ferrodegenerative drugs.

[0007] Furthermore, the sodium alendronate-modified dimyristic glycerol polyethylene glycol 2000 (DMG-PEG) 2k The structure of -ALE is shown in Formula I, and its preparation method includes the following steps:

[0008] (a) Mix 1-10 parts of sodium alendronate with 1-5 parts of NHS-modified dimyristic glycerol polyethylene glycol 2000 (DMG-PEG). 2k -NHS) was reacted at room temperature with stirring for 4-24 h at pH 7.2-9;

[0009] (b) The product from step (a) was purified by rapid column chromatography to obtain purified DMG-PEG. 2k -ALE products;

[0010] (c) The product from step (b) is freeze-dried and stored at -20°C, -40°C, -60°C, -80°C or in liquid nitrogen.

[0011]

[0012] Formula I

[0013] In one embodiment of the present invention, the sodium alendronate-modified dimyristic glycerol polyethylene glycol 2000 (DMG-PEG) 2k The preparation method of (-ALE) is as follows: take 1.5 parts of alendronate sodium and 1 part of DMG-PEG. 2k -NHS was dissolved in NaOH solution at pH 8.0 and stirred overnight at room temperature. The product was purified by rapid column chromatography to obtain DMG-PEG. 2k -ALE, freeze-dried and stored at -20℃.

[0014] Furthermore, the cationic lipid is CAL-1, with the structural formula shown in Formula II:

[0015]

[0016] Formula II

[0017] Furthermore, the sterol is selected from one or more of cholesterol, β-sitosterol, fucosterol, stigmasterol, campesterol, rapeseed sterol, alfalfa sterol, spinach sterol, cycloartenol, lupeol, ergosterol, 24-methylenecholesterol, brassosterol, and tomato sterol.

[0018] Further, the phospholipid is selected from 1,2-dioleoyl-SN-glycerol-3-phosphatidylethanolamine (DOPE), 1,2-distearatel-SN-glycerol-3-phosphatidylcholine (DSPC), 1,2-dipalmitoyl-SN-glycerol-3-phosphatidylcholine (DPPC), 1,2-dimyristoyl-SN-glycerol-3-phosphatidylcholine (DMPC), 1,2-dioleoyl-SN-glycerol-3-phosphatidylcholine (DOPC), and 1-palmitoyl-2-oleoyllecithin. One or more of the following: phosphatidylcholine (POPC), 1,2-dioleoyloxy-3-(N-N',N'-dimethylaminoethane)-propionamide hydrochloride (DOTAP), 1,2-dioleoyl-SN-glycerol-3-phosphatidylserine (DOPS), diphytylphosphatidylcholine (DPhPC), diethylphosphatidylcholine (DEPE), macrophosphatidylcholine, egg yolk phosphatidylcholine, soybean phosphatidylethanolamine, egg yolk phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, and phosphatidylinositol.

[0019] Furthermore, the ferroptosis drugs include fat-soluble ferroptosis drugs and water-soluble ferroptosis drugs;

[0020] Fat-soluble ferroptosis drugs can be one or more of the following: small molecule ferroptosis inducers, oleic acid-modified iron(III) oxide, and polyunsaturated fatty acids.

[0021] Water-soluble ferroptosis drugs can be one or more of the following: siRNA, saRNA, sgRNA, shRNA, antisense nucleotides, oligonucleotides, miRNA, mRNA, bmRNA, piRNA, hnRNA, lincRNA, circRNA, plasmids, DNA, ctDNA, peptides, and proteins.

[0022] Furthermore, the lipid-soluble ferroptosis drug is the lipid-soluble ferroptosis inducer NEO2734 (NEO); the water-soluble ferroptosis drug is the ferroptosis gene inducer PHGDH siRNA (siP).

[0023] In one embodiment of the present invention, the nucleotide sequence of the PHGDH siRNA (siP) is as follows:

[0024] The positive sequence is: CAGAACUCACUUGUGGAAUTT (SEQ ID No. 1);

[0025] Antonym sequence: AUUCCACAAGUGAGUUCUGCG (SEQ ID No. 2).

[0026] Furthermore, the preparation method of the bone-targeting ferroptosis lipid nanocomposite includes the following steps:

[0027] (A) Add 0.5-10 parts of DMG-PEG 2k - ALE, 20-50 parts sterol, 5-30 parts phospholipid, 20-80 parts cationic lipid and 0.1-100 parts lipid-soluble ferroptosis drug are dissolved in ethanol, and 0.1-100 parts water-soluble ferroptosis drug is dissolved in an equal volume of citrate-phosphate buffer at pH 4.0.

[0028] (B) The ethanol phase and aqueous phase described in step (A) are mixed at a constant speed of 1:3 under continuous stirring, and the reaction is carried out at room temperature for 4-24 h.

[0029] (C) Transfer the reaction product from step (B) to a 100kMWCO ultrafiltration tube, centrifuge at 2000-8000 rpm for 5-60 min, and collect the concentrated product in the ultrafiltration tube;

[0030] (D) Adjust the concentrated product from step (C) to neutral with phosphate buffer at pH 7.4 to obtain the bone-targeting ferroptosis lipid nanocomposite.

[0031] (E) The bone-targeted ferrode lipid nanocomposite obtained in step (D) is stored at 4°C or freeze-dried at -20°C, -40°C, -60°C, -80°C or in liquid nitrogen.

[0032] In one embodiment of the present invention, the bone-targeting ferroptosis lipid nanocomposite is prepared by taking 30 parts of CAL-1, 40 parts of cholesterol, 20 parts of 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine (DOPE), and 10 parts of DMG-PEG. 2k -ALE and 30 parts of the lipid-soluble ferroptosis inducer NEO2734 (NEO) were dissolved in ethanol. Ten parts of the ferroptosis gene inducer PHGDH siRNA (siP) were dissolved in an equal volume of pH 4.0 citrate-phosphate buffer at a 1:3 ratio and mixed uniformly under continuous stirring at room temperature for 8 h. The product was then centrifuged at 4000 rpm for 20 min using a 100 kM WCO ultrafiltration tube. The concentrated product was collected and adjusted to neutral by adding 15 times the volume of phosphate buffer (PBS, pH 7.4). The resulting bone-targeted ferroptosis lipid nanocomposite (tCAL-LNP@siP / NEO) was stored at 4 °C or lyophilized at -20 °C.

[0033] A second aspect of the present invention provides a method for preparing the bone-targeting ferroptosis lipid nanocomposite as described above, comprising the following steps:

[0034] (A) Add 0.5-10 parts of DMG-PEG 2k - ALE, 20-50 parts sterol, 5-30 parts phospholipid, 20-80 parts cationic lipid and 0.1-100 parts lipid-soluble ferroptosis drug are dissolved in ethanol, and 0.1-100 parts water-soluble ferroptosis drug is dissolved in an equal volume of citrate-phosphate buffer at pH 4.0.

[0035] (B) The ethanol phase and aqueous phase described in step (A) are mixed at a constant speed of 1:3 under continuous stirring, and the reaction is carried out at room temperature for 4-24 h.

[0036] (C) Transfer the reaction product from step (B) to a 100kMWCO ultrafiltration tube, centrifuge at 2000-8000 rpm for 5-60 min, and collect the concentrated product in the ultrafiltration tube;

[0037] (D) Adjust the concentrated product from step (C) to neutral with phosphate buffer at pH 7.4 to obtain the bone-targeting ferroptosis lipid nanocomposite.

[0038] (E) The bone-targeted ferrode lipid nanocomposite obtained in step (D) is stored at 4°C or freeze-dried at -20°C, -40°C, -60°C, -80°C or in liquid nitrogen.

[0039] A third aspect of the present invention provides the use of the bone-targeting ferroptosis lipid nanocomposite described above in the preparation of a therapeutic drug for bone tumors or metastatic bone tumors.

[0040] Furthermore, the aforementioned bone metastatic tumors refer to malignant tumors with the potential to metastasize to the bone, including prostate cancer, breast cancer, ovarian cancer, kidney cancer, lung cancer, liver cancer, cervical cancer, colorectal cancer, pancreatic cancer, and stomach cancer.

[0041] The advantages of this invention are:

[0042] 1. DMG-PEG 2k -ALE has bone-targeting activity. The bone-targeting ferroptosis lipid nanocomposite provided by this invention has good bone-targeting and tumor-bone penetration effects, which can deliver ferroptosis drugs to bone metastasis sites and deep tumors, induce ferroptosis in tumor cells, and thus inhibit tumor growth and further metastasis.

[0043] 2. The bone-targeting ferroptosis lipid nanocomposite provided by the present invention has a good bone protection effect and can reduce the occurrence and severity of SREs such as fractures and bone deformities.

[0044] 3. The bone-targeted ferroptosis lipid nanocomposite provided by this invention can be used as an adjunct therapy for first-line tumor treatment, improving efficacy and delaying the development of drug resistance.

[0045] 4. The bone-targeted ferrode lipid nanocomposite provided by this invention is biodegradable, has good safety, and has no obvious biotoxicity.

[0046] 5. The preparation method of the present invention is simple and easy to implement, and can be appropriately combined as needed, which has good clinical development and translational value. Attached Figure Description

[0047] Figure 1 DMG-PEG 2k -NHS 1 H NMR spectrum.

[0048] Figure 2 For CAL-1 1 H NMR spectrum.

[0049] Figure 3 This is the HPLC chromatogram of CAL-1.

[0050] Figure 4 The MS spectrum of CAL-1.

[0051] Figure 5Physicochemical characterization of tCAL-LNP. A) Transmission electron microscopy (TEM) image of tCAL-LNP; B) Particle size, polydispersity index (PDI), and potential results of tCAL-LNP; C) pKa detection results of tCAL-LNP; D) Gene transfection results with different tCAL-LNP:EGFP plasmid mass ratios were investigated using EGFP plasmid as a gene drug model drug and commercial liposome Lipofectamine 2000 (Lipo2000) as a positive control; E) Statistical results and F) Cytotoxicity results (n = 3, mean ± standard deviation, one-way ANOVA, ns, no statistical difference, * p < 0.05, ** p < 0.01, **** p < 0.0001).

[0052] Figure 6 Physicochemical characterization of tCAL-LNP@siP / NEO. A) TEM image of tCAL-LNP@siP / NEO; B) Particle size, PDI and potential results of tCAL-LNP@siP / NEO; C) Drug loading and encapsulation efficiency results of tCAL-LNP@siP / NEO; D) Drug release curve of tCAL-LNP@siP / NEO (n = 3, mean ± standard deviation).

[0053] Figure 7 Results of the investigation into the cellular transport mechanism of tCAL-LNP. A) Cellular uptake results of tCAL-LNP@Nile (scale bar = 100 μm), with Nile red (Nile) as the model drug and B) statistical results; C) Flow cytometry results of cellular uptake of tCAL-LNP@siFAM, with FAM-labeled siRNA (siFAM) as the model drug and D) statistical results; E) Intracellular colocalization results of tCAL-LNP@siFAM / Nile (scale bar = 200 μm); F) Investigation of lysosomal escape mechanism of tCAL-LNP@siFAM (scale bar = 200 μm); G) Mitochondrial localization results of tCAL-LNP@Nile (scale bar = 200 μm) (n = 3, mean ± standard deviation, one-way ANOVA, ns, no statistical difference, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).

[0054] Figure 8The results show the in vivo tumor-bone targeting and tumor-bone penetration capabilities of tCAL-LNP. A) Drug penetration in tumor tissue 24 h after tail vein injection of CAL-LNP@DiR and tCAL-LNP@DiR; B) Biodistribution of CAL-LNP@DiR and tCAL-LNP@DiR in vivo at 6 and 24 h after administration; C) Biodistribution of CAL-LNP@DiR and tCAL-LNP@DiR in the heart, liver, spleen, lungs, kidneys, tumor, and both tibias 24 h after administration; D) Drug penetration in tumor-bearing tibia 24 h after tail vein injection of CAL-LNP@DiR and tCAL-LNP@DiR; E) Image J analysis of drug penetration of CAL-LNP@DiR and tCAL-LNP@DiR in tumor tissue; F) Image J analysis of drug penetration of CAL-LNP@DiR and tCAL-LNP@DiR in tumor-bearing tibia (DiR: 1 mg / kg, scale bar = 2 mm).

[0055] Figure 9 To evaluate the in vitro anti-cell proliferation, invasion and metastasis capabilities, synergistic effects, and drug resistance reversal capabilities of tCAL-LNP@siP / NEO. A) Construction of bone metastasis tumor spheres from prostate cancer (DiO: PC-3). Enz A) The killing effect of tCAL-LNP@siP / NEO + Enz and each control group on CRPC bone metastasis tumor spheres (PHGDHsiRNA / NEO: 100 nM, Enz: 100 μM, scale bar = 500 μm); B) The killing effect of tCAL-LNP@siP / NEO + Enz and each control group on CRPC bone metastasis tumor spheres (PHGDHsiRNA / NEO: 100 nM, Enz: 100 μM, scale bar = 500 μm); C) The anti-PC-3 ... Enz Cell proliferation curve (PHGDH siRNA / NEO C) max 2000 nM, Enz C max 200 μM, tCAL-LNP C max : 0.246 mg / mL, mean ± standard deviation, n = 3); D) NEO with Enz, tCAL-LNP@siP with Enz and tCAL-LNP@siP / NEO treatment for C4-2B Enz or PC-3 Enz Cellular synergy index ( △ 0.3 < CI ≤ 0.7: Synergistic effect. △△ 0.1 < CI ≤ 0.3: Strong synergistic effect. △△△CI < 0.1: Super synergistic effect); E) tCAL-LNP@siP / NEO + Enz and anti-PC-3 in each control group Enz Cell invasion and metastasis ability assessment (PHGDH siRNA / NEO: 100 nM, Enz: 100 μM, scale bar = 100 μm).

[0056] Figure 10 The results of the investigation on the ferroptosis induction effect of tCAL-LNP@siP / NEO. A) Using DCFH-DA as a probe, the intracellular reactive oxygen species (ROS) levels of tCAL-LNP@siP / NEO + Enz and each control group were investigated (PHGDH siRNA / NEO2734: 100 nM, Enz: 100 μM, scale bar = 50 μm); B) Using JC-1 as a probe, the mitochondrial membrane potential of tCAL-LNP@siP / NEO + Enz and each control group was detected; C) Using MitoSOX Red as a probe, the mitochondrial superoxide levels of tCAL-LNP@siP / NEO + Enz and each control group were investigated; D) The lipid peroxide levels of tCAL-LNP@siP / NEO + Enz and each control group were detected using an MDA kit; E) The oxidative / reduced lipid levels of tCAL-LNP@siP / NEO + Enz and each control group were detected using C11-BODIPY as a probe (mean ± standard deviation, n = 3, one-way ANOVA, * p < 0.05, *** p < 0.05). 0.001, **** p < 0.0001).

[0057] Figure 11 The results of tumor inhibition in tCAL-LNP@siP / NEO + Enz and control mice were presented (PHGDHsiRNA: 0.5 mg / kg, NEO2734: 10 mg / kg, Enz: 20 mg / kg, mean ± standard deviation, n = 10, *p < 0.05, ****p < 0.0001).

[0058] Figure 12 The microCT images (scale bar = 2 mm) of the tumor-bearing tibias in each group after the efficacy experiment of Example 13 are shown.

[0059] Figure 13 The results of the safety assessment of tCAL-LNP are as follows. A) tCAL-LNP versus PC-3 Enz Cell toxicity study (n = 3); B) tCAL-LNP versus C4-2B EnzCell toxicity study (n = 3); C) tCAL-LNP versus C4-2B Enz The effects of tCAL-LNP on the toxicity of tumor spheres (n = 3); D) Effect of tCAL-LNP on the serum alanine aminotransferase (ALT) level in mice (n = 5); E) Effect of tCAL-LNP on the serum aspartate aminotransferase (AST) level in mice (n = 5); F) Effect of tCAL-LNP on the serum blood urea nitrogen (BUN) level in mice (n = 5); G) Effect of tCAL-LNP on the serum creatinine (CREA) level in mice (n = 5). Detailed Implementation

[0060] The specific embodiments provided by the present invention will be described in detail below with reference to examples.

[0061] Example 1: DMG-PEG 2k Synthesis of -ALE

[0062] Take 1.5 parts of alendronate sodium and 1 part of DMG-PEG. 2k -NHS was dissolved in NaOH solution at pH 8.0 and stirred overnight at room temperature. The product was purified by rapid column chromatography to obtain DMG-PEG. 2k -ALE, with the structural formula shown in Formula I, is freeze-dried and stored at -20°C.

[0063] Example 2: DMG-PEG 2k Characterization and Validation of ALE

[0064] Take an appropriate amount of the synthesized product from Example 1 for use 1 H NMR (400 MHz, CDCl3) detection, results are as follows Figure 1 As shown, DMG-PEG 2k The characteristic peaks of DMG-PEG (δ 5.10 (m, 1H), 4.36 – 4.01 (m, 4H), 3.64 (s, 200H), 3.44 (dd, J = 19.6, 14.8 Hz, 4H), 3.09 (s, 8H), 2.30 (dd, J = 11.0, 4.2 Hz, 4H), 1.59 (d, J = 5.7 Hz, 4H), 1.25 (s, 40H), and 0.87 (t, J = 6.8 Hz, 6H) are consistent with the theoretical values, indicating that the DMG-PEG characteristic peaks are in agreement with the theoretical values. 2k - Successful synthesis of ALE.

[0065] Example 3: Synthesis of cationic lipid CAL-1

[0066] One part of N-(2-aminoethyl)piperazine-1,4-diethylamine and six parts of 1,2-epoxytetradecane were dissolved in ethanol / water (v / v, 1:1) and reacted with stirring at 60-90°C for 3 days. The mixture was then concentrated and precipitated in acetone and desolventized to obtain cationic CAL-1, with the structural formula shown in Formula II. The prepared CAL-1 was lyophilized and stored at -20°C.

[0067] Example 4: Characterization of cationic lipid CAL-1

[0068] Take an appropriate amount of the synthesized product from Example 3 for use 1 H NMR (400 MHz, CDCl3), HPLC and MS detection. 1 The H NMR results are as follows Figure 2 As shown, the characteristic peaks δ 0.793–0.827 (t, 15H), 1.187–1.363 (m, 115H), 2.214–2.686 (m, 30H), and 3.537–3.551 (t, 5H) are consistent with the theoretical values; the HPLC results are as follows. Figure 3 As shown, the purity of CAL-1, the product of Example 3, is 98.86%; MS results are as follows. Figure 4 As shown, the molecular ion peak at 1277.2 is consistent with the theoretical molecular weight of CAL-1, which is 1277.19; these results indicate the successful synthesis of the cationic lipid CAL-1.

[0069] Example 5: Synthesis of bone-targeting lipid nanocomposite (tCAL-LNP)

[0070] Take 30 parts CAL-1, 40 parts cholesterol, 20 parts 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine (DOPE), and 10 parts DMG-PEG. 2k -ALE was dissolved in ethanol and then mixed with an equal volume of pH 4.0 citrate-phosphate buffer at a speed of 1:3 under continuous stirring. The mixture was stirred at room temperature for 8 h. The concentrated product was collected by centrifugation at 4000 rpm for 20 min using a 100 kM WCO ultrafiltration tube. 15 times the volume of phosphate buffer (PBS, pH 7.4) was added to adjust the pH to neutral. The resulting bone-targeting lipid nanocomposite (tCAL-LNP) was stored at 4 °C or lyophilized at -20 °C.

[0071] Example 6: Physicochemical characterization of tCAL-LNP

[0072] Take an appropriate amount of the tCAL-LNP prepared in Example 5 for TEM detection, such as... Figure 5As shown in Figure A, tCAL-LNP particles are spherical with a diameter of ~50 nm. Particle size potential results show that the particle size of tCAL-LNP is 46.3 ± 1.6 nm, PDI < 0.3, and the potential is 5.78 ± 1.03 mV. Figure 5 B). TNS detection showed that the pKa constant of tCAL-LNP was 6.712 ( Figure 5 C). Furthermore, tCAL-LNP exhibits superior gene transfection capability compared to the commercially available liposome Lipo2000, and its cytotoxicity is lower than Lipo2000, with virtually no cell-killing effect. Figure 5 DF).

[0073] Example 7: Synthesis of iron-death lipid nanocomposite (tCAL-LNP@siP / NEO)

[0074] Take 30 parts CAL-1, 40 parts cholesterol, 20 parts 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine (DOPE), and 10 parts DMG-PEG. 2k -ALE and 30 portions of the lipid-soluble ferroptosis inducer NEO2734 (NEO, purchased from Shanghai Maclean Biochemical Technology Co., Ltd., CAS No.: 2081072-29-7) were dissolved in ethanol. 10 portions of the ferroptosis gene inducer PHGDH siRNA (siP, sequences as follows: sense sequence: CAGAACUCACUUGUGGAAUTT, SEQ ID No. 1; antisense sequence: AUUCCACAAGUGAGUUCUGCG, SEQ ID No. 2) were dissolved in an equal volume of pH 4.0 citrate-phosphate buffer at a ratio of 1:3 under continuous stirring and mixed uniformly at room temperature for 8 h. The concentrated product in the ultrafiltration tube was collected by centrifugation at 4000 rpm for 20 min using a 100 kM CO2 ultrafiltration tube. The product was then adjusted to neutral by adding 15 times the volume of phosphate buffer (PBS, pH 7.4). The resulting bone-targeting ferroptosis lipid nanocomposite (tCAL-LNP@siP / NEO) was stored at 4 °C or lyophilized at -20 °C.

[0075] Example 8: Physicochemical characterization of tCAL-LNP@siP / NEO

[0076] Take an appropriate amount of the tCAL-LNP@siP / NEO prepared in Example 7 for TEM detection, such as... Figure 6 As shown in Figure A, tCAL-LNP@siP / NEO are spherical particles with a diameter of ~50 nm. Particle size potential results show that the particle size of tCAL-LNP is 54.2 ± 1.8 nm, PDI < 0.3, and potential is -0.63 ± 1.01 mV. Figure 6B). tCAL-LNP@siP / NEO achieved an encapsulation efficiency of up to 95.7% for siP and a drug loading of 6.8%; and an encapsulation efficiency of up to 92.3% for NEO and a drug loading of 40.1%. Figure 6 C). Furthermore, the release behavior of siP by tCAL-LNP@siP / NEO under pH 7.4 and pH 6.5 conditions was investigated, and the results ( Figure 6 D) shows that tCAL-LNP@siP / NEO exhibits faster drug release behavior in an acidic microenvironment, with approximately 90% of the drug being released cumulatively within 24 hours, demonstrating acid-sensitive drug release.

[0077] Example 9: Investigation of the cellular transport mechanism of tCAL-LNP

[0078] Using Nile as a model drug for NEO and FAM-labeled siRNA (siFAM) as a model drug for siP, tCAL-LNP@Nile, tCAL-LNP@siFAM, and tCAL-LNP@siFAM / Nile were prepared according to the method in Example 7. Simultaneously, unmodified alendronate sodium DMG-PEG was used. 2k As controls, non-bone-targeting lipid nanocomposites CAL-LNP@Nile and CAL-LNP@siFAM were prepared. These were then used to target the prostate cancer bone metastasis cell line PC-3. Enz Cells were co-incubated with bone transfer conditioned medium for 24 h, and then co-incubated with tCAL-LNP@Nile, tCAL-LNP@siFAM, CAL-LNP@Nile, CAL-LNP@siFAM, and free siFAM and Nile for 2 h respectively. The results are as follows: Figure 7 AD analysis showed that both tCAL-LNP@Nile and tCAL-LNP@siFAM exhibited significantly higher cellular uptake rates than the free drug group and the non-bone-targeted lipid nanocomposite. Furthermore, tCAL-LNP@siFAM / Nile was compared with PC-3... Enz After co-incubation for 2 hours, both Nile's red fluorescence and siFAM's green fluorescence were co-localized around the cell nucleus, indicating that tCAL-LNP can successfully deliver both lipid-soluble and water-soluble drugs into bone metastases. Figure 7 E). Lysosomal escape experiment ( Figure 7 F) shows that siFAM begins to enter lysosomes at 1 h and is gradually released from lysosomes after 4 h, indicating that siRNA carried by tCAL-LNP can escape phagocytosis and degradation by lysosomes. Given that mitochondria are an important site for the regulation of ferroptosis, we also investigated the mitochondrial localization of tCAL-LNP. The results are as follows... Figure 7As shown in G, tCAL-LNP gradually enters the mitochondria over time. This not only indicates that tCAL-LNP entry into the cell is an energy-consuming process, but also that tCAL-LNP can carry drugs to exert mitochondrial function and regulate ferroptosis.

[0079] Example 10: In vivo targeting and tumor-bone penetration ability of tCAL-LNP

[0080] Using mouse prostate cancer cell line RM-1 Enz A prostate cancer bone metastasis model was established in C57BL / 6J male mice. The deep red fluorescent dye DiR was used as the model drug, and CAL-LNP@DiR and tCAL-LNP@DiR were prepared according to Example 9. After tumor formation, CAL-LNP@DiR and tCAL-LNP@DiR (DiR: 1 mg / kg) were injected intravenously via the tail vein into the mice, respectively. Biodistribution in the two groups of mice was observed at 6 and 24 hours. Results are as follows: Figure 8 As shown in Figure B, the tCAL-LNP@DiR group showed significant accumulation in tumor tissue and tumor-bearing tibia at 6 h, and the fluorescence intensity did not decrease at 24 h. In contrast, the CAL-LNP@DiR group was mainly distributed in the liver region, with only a small amount of drug accumulation observed in tumor tissue at 24 h. This may be attributed to the EPR effect of CAL-LNP@DiR. The in vivo distribution results indicate that tCAL-LNP@DiR has good tumor and bone targeting effects and a certain degree of long-circulation activity. The results of the ex vivo organ distribution are basically consistent with the in vivo distribution results, showing that tCAL-LNP@DiR has good bone and tumor targeting effects. Figure 8 C). Further fluorescent sections were prepared from the tumor and tumor-bearing tibia and observed under an integrated fluorescence microscope imaging system. It was found that compared with the unmodified target CAL-LNP@DiR, tCAL-LNP@DiR had significantly stronger tumor tissue penetration and bone penetration capabilities, and showed a wider and stronger fluorescence distribution in tumor tissue and tumor-bearing bone tissue, providing strong evidence for the precise delivery of drugs. Figure 8 A, DF).

[0081] Example 11: Investigation of the in vitro anti-proliferative, anti-invasive metastatic, and synergistic effects of tCAL-LNP@siP / NEO, and its ability to reverse drug resistance.

[0082] PC-3 EnzCells (labeled with green fluorescent dye DiO) and MG-63 cells (labeled with red fluorescent dye DiD) were added at a 1:1 ratio to 96-well plates coated with agarose gel containing culture medium. The plates were centrifuged at 4000 rpm for 10 min to construct CRPC bone metastasis tumor spheres. After the tumor spheres were formed, the cell nuclei were stained with blue fluorescent dye DAPI. Confocal microscopy revealed that both cell types were well co-localized within the tumor spheres, indicating the successful construction of prostate cancer bone metastasis tumor spheres. Figure 9 A). Further anti-proliferation experiments showed that tCAL-LNP@siP / NEO combined with enzalutamide (Enz) had a significant tumor spheroid ablation effect and anti-PC-3 activity compared to the control group such as Enz. Enz Cell proliferation activity, demonstrating strong killing ability ( Figure 9 B, C). In addition, collaborative experiments ( Figure 9 D) Demonstrates that NEO and Enz, or tCAL-LNP@siP and Enz, or tCAL-LNP@siP / NEO co-loaded with two ferroptosis drugs all have significant synergistic effects and can reverse PC-3. Enz Cells or C4-2B Enz Cellular resistance to Enzylamine enhances the proliferative capacity of anti-tumor cells. Transwell assays also demonstrated that tCAL-LNP@siP / NEO combined with enzalutamide significantly reduces PC-3. Enz Cell invasion and metastasis ( Figure 9 E). These results indicate that the bone-targeting ferroptosis lipid nanocomposite constructed in this invention has significant anti-tumor cell proliferation, invasion and metastasis effects, and exhibits good synergistic effects, and can reverse the drug resistance of tumor cells to first-line treatment regimens.

[0083] Example 12: Investigation of the ferroptosis induction effect of tCAL-LNP@siP / NEO

[0084] PC-3Enz cells were co-incubated with tCAL-LNP@siP / NEO + Enz (PHGDH siRNA / NEO2734: 100 nM, Enz: 100 μM) and control groups for 24 h. Intracellular reactive oxygen species, mitochondrial membrane potential, mitochondrial superoxide dismutase, lipid peroxides, and oxidative / reduced lipid levels in each group were detected using DCFH-DA, JC-1, MitoSOX Red, MDA, and C11-BODIPY probes or kits. Results are as follows: Figure 10As shown, the tCAL-LNP@siP / NEO bone-targeted ferroptosis lipid nanocomposite can synergistically induce significant upregulation of cellular reactive oxygen species, mitochondrial superoxide, lipid peroxides, and oxidative / reduced lipid levels, and significantly reduce mitochondrial membrane potential, indicating that the bone-targeted ferroptosis lipid nanocomposite constructed in this invention has a strong ferroptosis induction effect.

[0085] Example 13: Investigation of the in vivo antitumor effect of tCAL-LNP@siP / NEO

[0086] PC-3 Enz Cells were injected into the right hind limb of nude mice to establish a prostate cancer bone metastasis model, followed by castration surgery. The tumors in the mice were allowed to grow to 50 mm. 3 Tumors were administered tCAL-LNP@siP / NEO + Enz (PHGDH siRNA: 0.5 mg / kg, NEO2734: 10 mg / kg, Enz: 20 mg / kg) every 2 days, along with a control group. The administration period was 12 days. Tumor volume was measured in each group on the last day of administration. Results are as follows: Figure 11 As shown, the bone-targeting lipid nanocomposite tCAL-LNP, whether as a single ferroptosis drug, a co-ferroptosis drug, or in combination with enzalutamide, a first-line treatment for prostate cancer, exhibits significant tumor-suppressive effects.

[0087] Example 14: Investigation of the bone-protective effect of tCAL-LNP@siP / NEO

[0088] After the efficacy test in Example 14, the tumor-bearing tibia (right hind limb) from each group and the normal tibia (left hind limb) from the PBS group were used as blank controls. MicroCT was used to observe the tibial injury in each group, and the results are as follows: Figure 12 As shown in the results, the PBS group and the tCAL-LNP group had a large number of osteophyte formations and osteolytic damage in the tibia, and fractures were also observed. The Enz group also had a lot of osteophyte formations and osteolytic damage. However, the bone-targeting lipid nanocomposite tCAL-LNP, whether it was a single ferroptosis drug, a co-ferroptosis drug, or combined with enzalutamide, a first-line treatment for prostate cancer, could significantly reduce osteophyte formations, osteolytic damage, and fractures. Furthermore, the tibia of the tCAL-LNP@siP / NEO and tCAL-LNP@siP / NEO combined with enzalutamide groups showed almost no obvious bone damage and was basically the same as the normal control group in appearance. This indicates that the bone-targeting ferroptosis lipid nanocomposite constructed in this invention has a good osteoprotective effect.

[0089] Example 15: Safety Study of tCAL-LNP

[0090] tCAL-LNP was prepared according to the method described in Example 5. tCAL-LNP at concentrations of 0-400 μg / mL was then reacted with PC-3.Enz Or C4-2B Enz After co-incubation of cells for 24 h, the results showed no significant toxicity to either cell type. Figure 13 A, B). In addition, 400 μg / mL tCAL-LNP and C4-2B Enz No obvious toxicity was observed after co-incubation of tumor spheres for 24 hours. Figure 13 C). After the efficacy test in Example 13, serum samples from the tCAL-LNP and PBS groups were collected to detect ALT, AST, BUN, and CREA levels. The results showed that tCAL-LNP had no hepatotoxicity or nephrotoxicity and good safety. Figure 13 DG).

[0091] In the above embodiments, the descriptions of each embodiment have different focuses. For parts not described in detail in a certain embodiment, please refer to the relevant descriptions in other embodiments.

[0092] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.

Claims

1. A bone-targeting ferroptosis lipid nanocomposite, characterized in that, It consists of sodium alendronate-modified dimyristic glycerol polyethylene glycol 2000, sterols, phospholipids, cationic lipids and ferroptosis drugs; The structural formula of the sodium alendronate-modified dimyristic glycerol polyethylene glycol 2000 is shown in Formula I: Formula I The cationic lipid is CAL-1, with the structural formula shown in Formula II: Formula II The ferroptosis drugs mentioned include fat-soluble ferroptosis drugs and water-soluble ferroptosis drugs.

2. The bone-targeting ferroptosis lipid nanocomposite according to claim 1, characterized in that, The preparation method of sodium alendronate-modified dimyristic glycerol polyethylene glycol 2000 includes the following steps: (a) 1-10 parts of sodium alendronate and 1-5 parts of NHS-modified dimyristic glycerol polyethylene glycol 2000 were stirred at room temperature for 4-24 h at pH 7.2-9. (b) The product in step (a) was purified by rapid column separation to obtain purified sodium alendronate-modified dimyristic glycerol polyethylene glycol 2000 product; (c) The product from step (b) is freeze-dried and stored at -20°C, -40°C, -60°C, -80°C or in liquid nitrogen.

3. The bone-targeting ferroptosis lipid nanocomposite according to claim 1, characterized in that, The lipid-soluble ferroptosis drug is selected from one or more of small molecule ferroptosis inducers, oleic acid-modified iron(III) oxide, and polyunsaturated fatty acids.

4. The bone-targeting ferroptosis lipid nanocomposite according to claim 1, characterized in that, The water-soluble ferroptosis drug is selected from one or more of the following: siRNA, saRNA, sgRNA, shRNA, antisense nucleotides, oligonucleotides, miRNA, mRNA, bmRNA, piRNA, hnRNA, lincRNA, circRNA, plasmids, DNA, ctDNA, peptides, and proteins that induce ferroptosis.

5. The bone-targeting ferroptosis lipid nanocomposite according to claim 1, characterized in that, The sterols mentioned are selected from one or more of cholesterol, β-sitosterol, fucosterol, stigmasterol, campesterol, rapeseed sterol, alfalfa sterol, spinach sterol, cycloartenol, lupeol, ergosterol, 24-methylenecholesterol, brassosterol, and tomato sterol.

6. The bone-targeting ferroptosis lipid nanocomposite according to claim 1, characterized in that, The phospholipids mentioned are selected from 1,2-dioleoyl-SN-glycerol-3-phosphatidylethanolamine (DOPE), 1,2-distearate-SN-glycerol-3-phosphatidylcholine (DSPC), 1,2-dipalmitoyl-SN-glycerol-3-phosphatidylcholine (DPPC), 1,2-dimyristoyl-SN-glycerol-3-phosphatidylcholine (DMPC), 1,2-dioleoyl-SN-glycerol-3-phosphatidylcholine (DOPC), and 1-palmitoyl-2-oleoyllecithin (P... One or more of the following: OPC, 1,2-dioleoyloxy-3-(N-N',N'-dimethylaminoethane)-propionamide hydrochloride (DOTAP), 1,2-dioleoyl-SN-glycerol-3-phosphatidylserine (DOPS), diphytylphosphatidylcholine (DPhPC), diethylphosphatidylcholine (DEPE), macrophosphatidylcholine, egg yolk phosphatidylcholine, soybean phosphatidylethanolamine, egg yolk phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, and phosphatidylinositol.

7. A method for preparing the bone-targeting ferroptosis lipid nanocomposite as described in claim 1, characterized in that, Includes the following steps: (A) Dissolve 0.5-10 parts of sodium alendronate-modified dimyristoyl glycerol polyethylene glycol 2000, 20-50 parts of sterol, 5-30 parts of phospholipid, 20-80 parts of cationic lipid and 0.1-100 parts of lipid-soluble ferroptosis drug in ethanol, and dissolve 0.1-100 parts of water-soluble ferroptosis drug in an equal volume of citrate-phosphate buffer at pH 4.0; (B) The ethanol phase and aqueous phase described in step (A) are mixed at a constant speed of 1:3 under continuous stirring, and the reaction is carried out at room temperature for 4-24 h. (C) Transfer the reaction product from step (B) to a 100kMWCO ultrafiltration tube, centrifuge at 2000-8000 rpm for 5-60 min, and collect the concentrated product in the ultrafiltration tube; (D) Adjust the concentrated product from step (C) to neutral with phosphate buffer at pH 7.4 to obtain the bone-targeting ferroptosis lipid nanocomposite. (E) The bone-targeted ferrode lipid nanocomposite obtained in step (D) is stored at 4°C or freeze-dried at -20°C, -40°C, -60°C, -80°C or in liquid nitrogen.

8. The use of a bone-targeting ferroptosis lipid nanocomposite as described in any one of claims 1-6 in the preparation of a therapeutic drug for bone tumors or bone metastases.

9. The application according to claim 8, characterized in that, The aforementioned bone metastatic tumors refer to malignant tumors with the potential to metastasize to bones, including prostate cancer, breast cancer, ovarian cancer, kidney cancer, lung cancer, liver cancer, cervical cancer, colorectal cancer, pancreatic cancer, and stomach cancer.

Images