Use of tegafur gimeracil oteracil for the preparation of a drug for treating colorectal cancer

Abstract

The application relates to application of tegoprazan in preparation of a colorectal cancer treatment drug and belongs to the technical field of biological medicines. The application finds that tegoprazan can be used for cancer treatment, in particular, colorectal cancer treatment. Specifically, the application finds that tegoprazan can reduce the proportion of T3 neutrophils in a tumor microenvironment and promote the death of T3 neutrophils, thereby inhibiting the growth of colorectal tumors. In addition, the application also finds that tegoprazan enhances the infiltration and cytotoxicity of CD8 + T cells and inhibits the exhaustion differentiation of the CD8 T cells, thereby playing an anti-tumor immune regulation role. The tegoprazan is used in combination with an immune checkpoint inhibitor, and the anti-tumor effect is synergistically enhanced, thereby providing a new drug use scheme for colorectal cancer treatment.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of ticaglucosidib in the preparation of drugs for the treatment of colorectal cancer. Background Technology

[0002] Colorectal cancer (CRC) is one of the leading malignant tumors with high incidence and mortality rates worldwide. Immune checkpoint blockade therapy is effective in many malignant tumors; however, in colorectal cancer, the inherent immunosuppressive properties of the tumor microenvironment prevent a significant number of patients from benefiting from it.

[0003] Tumor-infiltrating neutrophils (TINs), as the most abundant innate immune cell population in the tumor microenvironment, exhibit high functional plasticity. In colorectal cancer, they not only participate in regulating immune responses but are also closely related to adverse clinical outcomes. In recent years, single-cell and spatial transcriptomics studies have classified tumor neutrophils into three distinct states (T1 to T3). Among them, the terminally differentiated T3 subset is characterized by pro-angiogenic activity and immunosuppressive function, and can inhibit CD8+. + T cell-mediated anti-tumor immunity promotes tumor progression and treatment resistance. However, the molecular mechanisms regulating the dynamic transition of tumor-infiltrating neutrophils to the T3 state in the tumor microenvironment remain unclear.

[0004] Tideglusib is a synthetic small-molecule irreversible inhibitor of GSK3β. Currently, research on this drug in tissue regeneration covers the repair of dentin, bone, and tendons; in the field of neurological diseases, a phase II clinical trial for progressive supranuclear palsy is underway, and preclinical studies have been conducted for Duchenne muscular dystrophy, myotonic dystrophy, and Alzheimer's disease; furthermore, preclinical studies have also been conducted on its application in cardiomyopathy and other diseases.

[0005] Ticagrane has been used in studies for several non-tumor indications, but there are currently no studies reporting that ticaglucosidib can be used to treat colorectal cancer by regulating the polarization state of tumor-infiltrating neutrophils. Therefore, the application of ticaglucosidib in the field of tumor immunotherapy remains a technological gap, and there is a clear unmet clinical need. Summary of the Invention

[0006] Therefore, the technical problem to be solved by the present invention is to overcome the lack of a drug in the prior art that can regulate the dynamic transformation of tumor-infiltrating neutrophils to the T3 state in the tumor microenvironment, thereby achieving tumor treatment.

[0007] To address the aforementioned technical problems, this invention provides the application of ticaglucosidib in the preparation of a therapeutic drug for colorectal cancer. This invention is the first to discover that ticaglucosidib can be used for cancer treatment, particularly for colorectal cancer. Specifically, this invention finds that ticaglucosidib can reduce the proportion of T3 neutrophils in the tumor microenvironment and promote T3 neutrophil death, thereby inhibiting the growth of colorectal tumors. In addition, this invention also finds that ticaglucosidib enhances CD8... + Teglucaxibuvir enhances the infiltration and cytotoxic function of T cells and inhibits their depletion and differentiation, thereby exerting an anti-tumor immunomodulatory effect. Combining ticaglucosidib with immune checkpoint inhibitors synergistically enhances the anti-tumor effect, providing a new treatment option for colorectal cancer.

[0008] The first objective of this invention is to provide the use of ticaglucosidib in the preparation of medicaments for the treatment of colorectal cancer.

[0009] Furthermore, the colorectal cancer treatment drug reduces the proportion of T3 neutrophils in the tumor microenvironment and promotes the death of T3 neutrophils.

[0010] Furthermore, the colorectal cancer includes KRAS Mutant colorectal cancer.

[0011] Furthermore, the KRAS-mutant colorectal cancer includes KRAS G12D type colorectal cancer, KRAS G12V type colorectal cancer or KRAS G12C type colorectal cancer.

[0012] A second objective of this invention is to provide an application of ticaglucosidab in combination with an immune checkpoint inhibitor in the preparation of a drug for the treatment of colorectal cancer.

[0013] Furthermore, the immune checkpoint inhibitors include anti-programmed death receptor 1 (PD-1) antibodies and / or anti-cytotoxic T lymphocyte-associated protein 4 (CTLA-4) antibodies.

[0014] Furthermore, the colorectal cancer treatment drug increases the number of cytotoxic T lymphocyte-positive cells in the tumor microenvironment.

[0015] A third object of the present invention is to provide a pharmaceutical composition for treating colorectal cancer, the pharmaceutical composition comprising ticaglucosidib.

[0016] Furthermore, the pharmaceutical composition further includes an anti-PD-1 antibody and / or an anti-CTLA-4 antibody.

[0017] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable carrier or excipient.

[0018] Compared with the prior art, the above-described technical solution of the present invention has the following advantages:

[0019] This invention is the first to discover that ticaglucosidib can be used for cancer treatment, particularly colorectal cancer. Specifically, this invention finds that ticaglucosidib can reduce the proportion of T3 neutrophils in the tumor microenvironment and promote T3 neutrophil death, thereby inhibiting the growth of colorectal tumors. In addition, this invention also finds that ticaglucosidib enhances CD8... + Teglucaxibuvir enhances the infiltration and cytotoxic function of T cells and inhibits their depletion and differentiation, thereby exerting an anti-tumor immunomodulatory effect. Combining ticaglucosidib with immune checkpoint inhibitors synergistically enhances the anti-tumor effect, providing a new treatment option for colorectal cancer. Attached Figure Description

[0020] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0021] Figure 1 This is a validation result based on public single-cell sequencing data to evaluate the expression characteristics of GSK3β in the colorectal cancer tumor microenvironment and its correlation with immune cell infiltration. n This indicates the sample size, and the same applies below.

[0022] Figure 2 It is a specific knockout of intestinal epithelium Gsk3β Validation results of inhibiting AOM / DSS-induced colorectal tumor development;

[0023] Figure 3 It is intestinal epithelium Gsk3β The single-cell transcriptomics validation results for remodeling the tumor immune microenvironment were missing.

[0024] Figure 4 It is intestinal epithelium Gsk3β Knockout Apc min / + Validation results of inhibiting tumorigenesis and remodeling the immune microenvironment in a spontaneous intestinal tumor model;

[0025] Figure 5 It is intestinal epithelium Gsk3β Validation results of the effects of deletion on differentially expressed genes and functional pathways of neutrophils in the tumor microenvironment;

[0026] Figure 6 This is a validation result of GSK3β regulating the differentiation of tumor-infiltrating neutrophil subsets and influencing tumor growth;

[0027] Figure 7 This is an in vivo functional validation result of how the T3 neutrophil subset promotes the progression of colorectal tumors;

[0028] Figure 8 This is a validation result of intestinal epithelial GSK3β driving tumor-infiltrating neutrophils to T3 phenotype polarization and transcriptional reprogramming;

[0029] Figure 9 This is a validation result showing that the pro-tumor activity of GSK3β depends on tumor-infiltrating neutrophils;

[0030] Figure 10 It is intestinal epithelium Gsk3β Deletion promotes T3 neutrophil death and enhances CD8 + Validation results of T-cell anti-tumor immunity;

[0031] Figure 11 It is intestinal epithelium Gsk3β The validation results for inhibiting tumorigenesis and remodeling the immune microenvironment in the AKP spontaneous colorectal cancer model are missing.

[0032] Figure 12 It is intestinal epithelium Gsk3β Overexpression inhibits T3 neutrophil death and weakens CD8 + Validation results of T-cell anti-tumor immunity;

[0033] Figure 13 This is a validation result of the intrinsic GSK3β of tumor cells maintaining the survival of T3 neutrophils and creating an immunosuppressive microenvironment;

[0034] Figure 14 This is a validation result of the clinical correlation between GSK3β expression and T3 neutrophil infiltration and patient prognosis in human colorectal cancer;

[0035] Figure 15 It is a patient-derived colorectal cancer organoid GSK3β The validation results of high expression driving T3 neutrophil polarization, "#1" indicates organoids derived from patient 1, the same below;

[0036] Figure 16 It is a silent patient-derived organoid of colorectal cancer GSK3β Validation results of inhibiting T3 neutrophil polarization;

[0037] Figure 17 This is a validation result of the GSK3β inhibitor ticaglucosidib reducing the proportion of T3 neutrophils in vitro;

[0038] Figure 18 This is the in vivo efficacy validation result of ticaglucosidib in reducing tumor burden and promoting T3 neutrophil death in an AOM / DSS-induced colorectal cancer model;

[0039] Figure 19Teglucaxibuvir enhances CD8 by targeting GSK3β in the intestinal epithelium. + Validation results of T-cell anti-tumor immunity;

[0040] Figure 20 yes Gsk3β The validation results of the absence of combined immune checkpoint blockade to enhance anti-tumor immune response;

[0041] Figure 21 It is the GSK 3β inhibitor ticaglucosidib combined with immune checkpoint blockade. AKP Validation results of synergistic enhancement of anti-tumor immunity in a spontaneous colorectal cancer model. Detailed Implementation

[0042] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0043] The English terms and their meanings used in the following examples are shown in Table 1.

[0044] Table 1

[0045]

[0046]

[0047]

[0048] Example 1: Expression Characterization Analysis of GSK3β in the Colorectal Cancer Tumor Immune Microenvironment Based on Single-Cell Transcriptome Sequencing

[0049] To evaluate the expression characteristics of GSK3β in the tumor immune microenvironment of colorectal cancer (CRC) and its correlation with immune cell infiltration, a systematic analysis was performed using public single-cell RNA sequencing (scRNA-seq) data. The original data were obtained from the Gene Expression Comprehensive Database (GEO), accession number GSE236581, which contains sequencing data from tumor tissue samples from multiple CRC patients. Data processing and analysis were performed using R software (version 4.5.1), and the main workflow included double cell removal, quality filtering, data normalization and scaling, principal component analysis for dimensionality reduction, Harmony batch effect correction (version 1.2.4), and graph-based cell clustering. Cell type annotation was initially determined based on reported marker gene profiles. Tumor cell subpopulations were further identified within the epithelial phenotype-positive cell population, and this was used as a basis for evaluation. GSK3β Relative expression level of mRNA.

[0050] To investigate the relationship between GSK3β expression and immunotherapy response, patients were grouped according to their clinical outcomes after PD-1 therapy, with 6 patients achieving partial response (PR) and 11 patients achieving complete response (CR). Tumor cells from both groups were analyzed. GSK3β The expression distribution was visualized using a violin plot, and the results showed that in the complete remission group, the expression distribution of tumor cells derived from intestinal epithelium was significantly higher. GSK3β mRNA expression levels were significantly lower in the partial remission group than in the partial remission group. Figure 1 The A in the figure suggests that the expression level of GSK3β is related to the degree of response to immunotherapy.

[0051] Based on T cell subset marker genes, T cells are conserved and classified into CD8+. + T cells, CD4 + T cells and natural killer (NK) cells were analyzed, and the proportion of each subset in the total T / NK cell population was calculated. Further analysis was conducted on tumor cells in all patients who achieved partial or complete remission after PD-1 immunotherapy. GSK3β Expression level and CD8 + Pearson correlation analysis of T cell percentage showed that intestinal epithelial tumor cells... GSK3β Expression and CD8 + The proportion of T cells in the total T / NK cell population was significantly negatively correlated ( Figure 1 (B in the text) indicates that high expression of GSK3β is associated with CD8. + It is associated with insufficient T cell infiltration.

[0052] Furthermore, to validate these findings in a larger, independent dataset, this embodiment further utilizes the Tumor Immunological Assessment Resource (TIMER) database to analyze colorectal adenocarcinoma (COAD) samples. GSK3β The correlation between mRNA expression levels and tumor cell purity and estimated neutrophil infiltration score. Results are as follows... Figure 1 As shown in C, GSK3β The expression of GSK3β was not significantly correlated with tumor cell purity, but was significantly positively correlated with the estimated neutrophil infiltration score, suggesting that GSK3β may play a regulatory role in the tumor immune microenvironment.

[0053] Example 2: Functional validation of GSK3β in colorectal tumor development and regulation of the tumor immune microenvironment

[0054] (1) Functional verification of GSK3β intestinal epithelial-specific knockout inhibiting the occurrence of colorectal tumors

[0055] To further investigate the function of intestinal epithelial GSK3β in the occurrence and progression of colorectal tumors, this embodiment constructs an intestinal epithelial-specific... Gsk3β Conditional knockout mice ( Gsk3βIEC- / - Animal experiments were conducted to validate the study. All mouse strains were from the C57BL / 6J genetic background and housed in the Specific Pathogen Free (SPF) environment at the Experimental Animal Center of Soochow University. The ambient temperature was controlled at 21-22°C, humidity at 40%-60%, and a 12-hour light / dark cycle was maintained. All experiments used age-matched male and female mice. Wild-type mice were randomly assigned to experimental groups, while transgenic mice were grouped according to genotype. All animal experiments were conducted in accordance with the guidelines of the Animal Care and Use Committee of Soochow University. The maximum tumor burden limit approved by the institutional ethics committee was not met or exceeded in this study.

[0056] Conditional gene knockout technology is based on the Cre-LoxP recombinase system. Its basic principle is to insert two LoxP sites aligned in the same direction into the target gene. Gsk3β Flanking the key exons, obtain Gsk3β fl / fl Mice were then bred with transgenic mice that specifically expressed Cre recombinase in their intestinal epithelial tissue. Villin-Cre + Hybridization. Cre recombinase recognizes LoxP sites and mediates specific recombination of the DNA sequence between two LoxP sites, thereby achieving hybridization only in intestinal epithelial cells where Cre recombinase is expressed. Gsk3β Genes are knocked out in a targeted manner.

[0057] Gsk3β fl / fl The transgenic mice were generated by Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. using genome editing technology mediated by regularly clustered, spaced short palindromic repeat sequences and their associated protein 9 (CRISPR / Cas9). Villin-Cre + Mice were purchased from Jackson's laboratory. Gsk3β fl / fl mice and Villin-Cre + Mice were hybridized to obtain genotypes of Gsk3β IEC+ / - F1 generation mice were then mated with males and females to obtain intestinal epithelial-specific... Gsk3β Conditional knockout experimental group mice ( Gsk3β IEC- / - ) and control mice that were not knocked out ( Gsk3β IEC+ / + () Figure 2 (A in the middle).

[0058] To assess the impact of GSK3β deficiency in intestinal epithelium on tumorigenesis, colon cancer models were constructed in experimental and control mice using the AOM / DSS chemical induction method. Figure 2In the letter B, AOM represents azomethane and DSS represents sodium dextran sulfate. The results showed that, compared with the control group mice, the experimental group mice had better intestinal epithelial development. Gsk3β The absence of these tumors resulted in a significant reduction in the number of visible colonic tumor lesions, and a significant reduction in tumors was also observed in hematoxylin and eosin (H&E) stained tissue sections. Figure 2 In the C), quantitative analysis of both tumor number and tumor size showed a significant reduction in tumor number (C). Figure 2 (D in the middle).

[0059] The above results indicate that the intestinal epithelium Gsk3β It plays a key pro-tumor role in AOM / DSS-induced colorectal tumorigenesis.

[0060] (2) Analysis of GSK3β-regulated colorectal tumor immune microenvironment based on single-cell transcriptome sequencing

[0061] To further elucidate the regulatory mechanism of intestinal epithelial GSK3β on the tumor immune microenvironment, studies were conducted on patients treated with AOM / DSS. Gsk3β IEC+ / + control group mice and Gsk3β IEC- / - 10× single-cell RNA sequencing (scRNA-seq) was performed on colon tumor tissues from the experimental group mice. Figure 3 (A) After digesting tumor tissue into a single-cell suspension, scRNA-seq libraries were constructed using the Chromium Next GEM Single-Cell Kit (version 3.1, catalog number PN-1000121), and sequencing was performed by Shanghai Ouyi Biomedical Technology Co., Ltd. on an Illumina NovaSeq 6000 PE150 platform. Sequencing data have been submitted to the Gene Expression Database (GEO), accession number GSE333935. Raw data were aligned to the mm10 mouse reference genome (GRCm38 / mm10) using Cell Ranger software (version 7.0.1) to obtain a gene expression count matrix. Subsequent downstream analysis was performed using the Seurat R package (version 4.0.0), with filtering criteria including: fewer than 200 genes, unique molecular identifier (UMI) count less than 1,000, mitochondrial RNA UMI ratio greater than 10%, and hemoglobin RNA UMI ratio greater than 5%. Double-cell pairs were removed using the DoubletFinder package (version 2.0.3). The data was standardized using the LogNormalize method before further analysis.

[0062] Unified manifold approximation and projection (UMAP) dimensionality reduction analysis identified 17 distinct cell subpopulations, totaling 19,018 cells. Based on marker gene expression profiles, these subpopulations were labeled as B cells, CD4 cells, etc. +T cells, CD8 + T cells, dendritic cells, endothelial cells, epithelial cells, fibroblasts, γδ T cells (γδ represents the γ and δ chains that make up the T cell receptor), mononuclear myeloid-derived suppressor cells (M-MDSCs), macrophages, mast cells, monocytes, mononuclear-derived dendritic cells, neutrophils, natural killer T cells (NKT), plasma cells, and regulatory T cells (Tregs). The distribution characteristics of each cell subset are shown in the UMAP diagram. Figure 3 In B, where UMAP1 and UMAP2 represent the first and second dimensions after dimensionality reduction, respectively. Statistical analysis was performed on the proportions of each cell population in different groups. Figure 3 (C) The results showed that, compared with the control group, Gsk3β IEC- / - The proportion of immunosuppressive cell populations (M-MDSCs, Tregs, and macrophages) in mouse tumors was reduced, while the proportion of anti-tumor immune cells (CD8+) was increased. + T cells, CD4 + An increased proportion of T cells, B cells, and NKT cells suggests that GSK3β deficiency in the intestinal epithelium can remodel the tumor microenvironment into an immune-activated state.

[0063] Further analysis revealed that, Gsk3β IEC- / - CD8 derived from mouse tumors + T cells showed significantly higher levels of the activation marker CD44 (produced by...). Cd44 The expression level of the gene encoding PD-1, while the exhaustion marker PD-1 (genome derived from PD-1) is also relevant. Pdcd1 The expression of (the gene encoding) was significantly reduced. Figure 3 The D in the image suggests that epithelial GSK3β deficiency is beneficial for maintaining CD8. + It activates T cells and inhibits their depletion and differentiation.

[0064] These results indicate that intestinal epithelial GSK3β shapes the immunosuppressive tumor microenvironment and induces CD8... + T cell depletion plays a crucial role in the development of colorectal tumors.

[0065] (3) Flow cytometry verification of the regulation of the immune microenvironment of colorectal tumors by intestinal epithelial GSK3β

[0066] To verify the regulatory role of intestinal epithelial GSK3β on the tumor immune microenvironment, we... Apc min / + Further knockout of epithelial cells in a spontaneous intestinal tumor mouse model Gsk3β . ApcThe gene encodes adenomatous polyposis protein, a key negative regulator of the Wnt signaling pathway. Its mutation and inactivation lead to abnormal activation of the Wnt / β-catenin signaling pathway, driving the development of intestinal tumors. Apc min / + mice carrying Apc Point mutations in genes can spontaneously form multiple intestinal adenomas, making it a classic mouse model for studying the occurrence of colorectal tumors. Apc min / + Mice were purchased from Jackson's lab and were compared with... Gsk3β IEC- / - Mice mate to obtain Apc min / + ; Gsk3β IEC+ / - F1 generation mice were then mated with males and females to obtain spontaneous intestinal tumors with intestinal epithelium specificity. Gsk3β Conditional knockout experimental group mice ( Apc min / + ; Gsk3β IEC- / - ) and control mice that were not knocked out ( Apc min / + ; Gsk3β IEC+ / + ).

[0067] The results showed that, compared with the control group mice, Apc min / + ; Gsk3β IEC- / - The growth of colon tumors in mice was significantly inhibited. Figure 4 In the A), both the number of tumors and the tumor burden were significantly reduced (in the A). Figure 4 (B in the text), this result is consistent with previous findings in AOM / DSS induced models (e.g., ... Figure 2 As shown in the figure, this further confirms the tumor-promoting function of GSK3β in the development of colorectal tumors.

[0068] To further analyze the changes in immune cell composition in the tumor microenvironment, flow cytometry was used to analyze the infiltration of immune cells in colon tumor tissue. Barnes-Hut random neighborhood embedding (bh-SNE) dimensionality reduction visualization and statistical analysis of immune cell proportions showed that, compared with the control group, Apc min / + ; Gsk3β IEC- / - CD4 in mouse tumor tissue + T cells, CD8 + The proportion of T cells and B cells increases, while the proportion of macrophages and neutrophils decreases accordingly. Figure 4In this context, C and D, t-SNE1 and t-SNE2 represent the first and second dimensions after dimensionality reduction, respectively. This result is consistent with the trend of changes in immune cell composition observed in single-cell sequencing analysis. Figure 3 (D in the middle).

[0069] In summary, intestinal epithelial GSK3β plays a key pro-tumor role in colorectal tumorigenesis by remodeling the tumor immune microenvironment, inhibiting the infiltration of anti-tumor immune cells, and promoting the recruitment of immunosuppressive cells, indicating that epithelial GSK3β is a key regulator of the tumor immune microenvironment.

[0070] Example 3: The regulatory effect of GSK3β deficiency in intestinal epithelium on neutrophil function in the tumor microenvironment

[0071] Through comparison Gsk3β IEC- / - experimental group and Gsk3β IEC+ / + CD45 in tumor tissue of control mice + The percentage of various subsets of immune cells revealed that neutrophils constituted the most abundant immune cell population in the tumor microenvironment of the AOM / DSS-induced colorectal tumor model. Figure 5 (A) In view of this, the above single-cell sequencing data were further analyzed. GSK3 β IEC- / - Differentially expressed genes in neutrophils from tumor tissues of mice and control mice. Genes with a fold change greater than 1.2 and... P A value less than 0.05 was used as the cutoff criterion. A total of 323 upregulated genes and 143 downregulated genes were identified. Figure 5 (B in the original text). Gene ontology and pathway enrichment analysis showed that these differentially expressed genes were significantly enriched in multiple key biological processes, including glycolysis, HIF-1 signaling pathway, ferroptosis, VEGF signaling pathway, cytokine-cytokine receptor interaction, and T cell receptor signaling pathway. Figure 5 The C in the figure suggests that GSK3β deficiency in intestinal epithelium can remodel the functional state of neutrophils in the tumor microenvironment.

[0072] Example 4: Verification of the Regulation of T3 Neutrophil Subpopulation Differentiation and Pro-tumor Function by GSK3β in Intestinal Epithelial Cells

[0073] (1) Analysis of the regulation of tumor-infiltrating neutrophil subset differentiation by intestinal epithelial GSK3β

[0074] To further investigate the heterogeneity of tumor-infiltrating neutrophils and its relationship with GSK3β regulatory function, cluster analysis of neutrophil subsets was first performed using the aforementioned single-cell sequencing data. Subsequently, an orthotopic rectal injection model was used to assess... Gsk3βThe effects of overexpression on tumor growth and neutrophil subset differentiation were investigated, and the findings were validated by flow cytometry.

[0075] Using the single-cell sequencing data mentioned above, tumor-infiltrating neutrophils were further sub-clustered into three distinct subsets—T1, T2, and T3—based on their transcriptional profiles. Figure 6 (A in the diagram). The distribution characteristics of each subgroup are shown in the UMAP diagram. Figure 6 (B) The relative proportions of each subgroup in Gsk3β IEC+ / + control group and Gsk3β IEC- / - Analysis was performed on mice in the experimental group ( Figure 6 (C in the middle), the results showed that the T3 subgroup was in Gsk3β IEC- / - The levels of T1 and T2 subsets were significantly reduced in mouse tumors, while the proportions of T1 and T2 subsets were correspondingly increased.

[0076] Table 2 Figure 6 The English abbreviations involved in A and their Chinese explanations

[0077]

[0078]

[0079] To verify the findings of the single-cell sequencing, flow cytometry was used to analyze the cells. Gsk3β IEC+ / + control group and Gsk3β IEC- / - The proportions of different subsets of tumor-infiltrating neutrophils in the experimental group mice were quantitatively analyzed. After digestion, tumor tissue was prepared into a single-cell suspension. Fc receptors were blocked using anti-mouse CD16 / 32 antibody (from BioLegend, catalog number 156604). Dead cells were excluded using the Zombie Red / Aqua fixable viability dye kit (from BioLegend). Cells were then incubated in the dark with fluorescently conjugated antibodies targeting mouse CD45, CD11b, Ly6C, Ly6G, CD101, and DcTRAIL-R1 (from BioLegend and eBioscience). After fixation, the cells were analyzed. Data acquisition was performed using a FACSCelesta flow cytometer (from BD Biosciences), and data analysis was performed using FlowJo software (from TreeStar). Results are as follows: Figure 6 As shown in D, Gsk3β IEC- / - The proportion of the T3 subset in mouse tumors was significantly lower than that in the control group.

[0080] To further investigate the heterogeneity of tumor-infiltrating neutrophils and its relationship with the regulatory function of GSK3β, the effects of GSK3β expression levels on tumor growth and neutrophil subset differentiation were assessed using an orthotopic rectal injection model.

[0081] Eight-week-old C57BL / 6J mice were anesthetized and fixed in a supine position on a gauze-lined operating table. The limbs were secured with surgical tape to fully expose the perianal area. The rectal mucosa was gently everted with forceps. A single-cell suspension of MC38 (mouse colon cancer cell line 38) tumor cells (1×10⁻⁶) was injected using a 30-gauge insulin syringe (needle outer diameter approximately 0.3 mm, suitable for precise micro-injection). 6 Cells were dissolved in 20 μL of PBS containing 50% Matrigel (Matrigel from Corning, catalog number 356231) and injected directly into the submucosa of the posterior rectal wall. Successful injection was indicated by the formation of fluid-filled vesicles in the submucosa without intraluminal leakage. After injection, the needle was held in place for several seconds to prevent backflow. Tumor growth was monitored daily based on symptoms of rectal bleeding or prolapse in mice.

[0082] The MC38 cells used for injection were constructed via lentiviral infection. Gsk3β Stable overexpression cell lines and their empty vector control cell lines. Specifically, pLenti- Gsk3β -puro vector (containing mouse) Gsk3β The gene (NCBI ID: NM_001347232.1, mRNA coding region (CDS) located at positions 1526-2827) was co-transfected with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G into human embryonic kidney 293T cells (HEK-293T cells). The supernatant containing the virus particles was collected to infect MC38 cells. Infected cells were then selected using puromycin (2 ng / μL, from Beyotime Biotechnology, catalog number ST551) to obtain... Gsk3β Stable overexpressing cell lines were used as the experimental group; pLenti-puro empty vector virus was packaged in the same manner and used to infect MC38 cells, which were then screened with puromycin as the control group.

[0083] The results are as follows Figure 6 As shown in E, Gsk3β The rectal tumors in the overexpression group mice grew significantly faster, with both tumor volume and weight increasing markedly compared to the control group. Flow cytometry analysis showed that... Gsk3β The proportion of T3 neutrophils in tumors in the overexpression group was significantly higher than that in the control group. Figure 6 The F in the figure further supports the positive regulatory role of GSK3β in promoting T3 neutrophil infiltration.

[0084] The above results indicate that intestinal epithelial GSK3β remodels the tumor immune microenvironment by regulating the infiltration of T3 neutrophil subsets, thereby promoting the progression of colorectal tumors.

[0085] (2) Functional verification of T3 neutrophil subset promoting the progression of colorectal tumors

[0086] Recent research shows that the tumor microenvironment continuously releases multiple signals, including chemokines and cytokines. Neutrophils infiltrating the tumor undergo staged reprogramming based on their residence time and the cumulative intensity of stimulation, forming three functional subpopulations: T1, T2, and T3. Immature neutrophils that have just entered the tumor are only briefly exposed to weak early signals, initiating basic transcriptional changes and retaining the characteristics of a circular nucleus, which is defined as the T1 subpopulation. As the residence time increases, the cells continuously receive differentiation stimulation signals, gradually completing nuclear lobulation and maturation, forming highly lobulated mature neutrophils, which is defined as the T2 subpopulation. If the infiltration continues for a long time and sufficient microenvironment stimulation is accumulated, the cells further initiate terminal reprogramming, stably and highly expressing DcTRAIL-R1, forming the phenotypically stable and irreversible T3 terminal differentiation subpopulation. Both T1 and T2 cells exhibit high environmental plasticity and can convergently transform into T3 cells under long-term tumor signaling. Therefore, by precisely controlling the exposure duration of neutrophils in the tumor microenvironment, it is possible to gradient-induce enrichment of single dominant subsets of T1, T2, or T3 cells, providing an operable time window for intervention strategies targeting neutrophil reprogramming.

[0087] To assess the pro-tumor function of neutrophil subsets at different differentiation stages in vivo, a tumor-bearing mouse model was established by subcutaneous injection of tumor cells on day 0. Neutrophils induced in vitro via a gradient infusion were reinfused via the tail vein on days 3, 7, and 12. All mice were sacrificed on day 20 for oncological analysis. Four groups were included: a PBS control group (tumor cells and an equal volume of phosphate-buffered saline (PBS) were injected, without neutrophil reinfusion), a T1 enrichment group (infusion of immature T1 subsets obtained from short-term in vitro stimulation), a T2 enrichment group (infusion of mature T2 subsets obtained from prolonged in vitro stimulation), and a T3 enrichment group (infusion of terminally differentiated T3 subsets obtained from continuous in vitro stimulation). Figure 7 (A in the middle).

[0088] The volume and weight of each group of ex vivo tumors were calculated, and the results are as follows: Figure 7 As shown in B: there were no significant differences in tumor volume and average weight among the PBS control group, T1 group, and T2 group, while the tumor volume and weight of the T3 enrichment group were significantly higher than those of the other three groups, indicating that only the T3 neutrophil subset has the function of significantly promoting tumor proliferation and growth.

[0089] (3) Verification analysis of intestinal epithelial GSK3β-driven neutrophil polarization towards T3 phenotype

[0090] To define the characteristics of the T3 subset at the molecular level and explore the molecular mechanisms by which intestinal epithelial GSK3β regulates it, we analyzed... Gsk3β IEC- / - experimental group mice and Gsk3β IEC+ / + Differentially expressed genes in T3 neutrophils of tumor tissue from control mice. Genes with a fold change greater than 1.2 and... P A value less than 0.05 is used as the cutoff criterion, and the results are as follows: Figure 8 As shown in A ( Zg16 This indicates the gene encoding zymogen granule protein 16. Fth1 (This indicates the gene encoding ferritin heavy chain 1), in Gsk3β IEC- / - The tumors in the experimental group mice included Ldha , Vegfa , Zeb2 , Tnfrsf23 , Cd274 (The gene encoding the PD-L1 protein) and Ccl3 Key genes, including those mentioned above, were significantly downregulated. Functional enrichment analysis showed that these genes are functionally closely related to immune processes such as neutrophil chemotaxis, T cell activation, and cytotoxicity. Figure 8 (B in the middle).

[0091] Further analysis revealed that the intestinal epithelium Gsk3β The deletion specifically downregulates T3 neutrophils Cd274 The expression of [certain substances] was observed, but no significant changes were observed in T1 or T2 neutrophils. Figure 8 The C in the figure indicates that GSK3β in the intestinal epithelium mainly affects the phenotype of the T3 neutrophil subset, while its effect on the T1 and T2 subsets is relatively limited.

[0092] To depict the differentiation relationships among neutrophil subsets, a pseudo-temporal analysis was performed. This is a bioinformatics method that infers cell differentiation trajectories and developmental sequences based on single-cell transcriptome data, revealing the lineage relationships and differentiation directions among cell subsets. The analysis results predicted the pseudo-temporal trajectory of neutrophils from T1 / T2 to T3. Figure 8 (D in the model). Consistent with this model, T3 characteristic genes are displayed along the pseudo-timeline trajectory. Cd274 and Tnfrsf23 Expression gradually increases in the later stages of differentiation. Figure 8 (E in the text). At the same time, Ccl3 , Cstb , Hilpda , Vegfa , Hmox1 , Mif and LdhaThe expression of core T3 genes also showed a trend of gradual upregulation along a pseudo-temporal trajectory. Figure 8 (F in the middle).

[0093] Based on the above experimental results, intestinal epithelial GSK3β plays a key pro-tumor function in the occurrence and progression of colorectal tumors by driving tumor-infiltrating neutrophils to polarize towards the T3 phenotype.

[0094] Example 5: GSK3β regulation of T3 neutrophil survival and CD8 in intestinal epithelium + Functional verification of T-cell anti-tumor immunity

[0095] (1) Validation analysis of GSK3β pro-tumor activity dependent on tumor-infiltrating neutrophils

[0096] To investigate whether the pro-tumorigenic function of GSK3β depends on tumor-infiltrating neutrophils, a mouse model of neutrophil clearance was established using anti-Ly6G antibody. From the date of tumor inoculation, mice were intraperitoneally injected twice weekly with anti-Ly6G antibody (from BioXcell, catalog number BE0075-1) at a dose of 5 mg / kg. Control mice received immunoglobulin G (IgG) isotype control antibody under the same conditions. To verify the neutrophil clearance efficiency, flow cytometry was used to detect CD45 levels in peripheral blood. + CD11b + Percentage of neutrophils within the population, and further analysis of Ly6C. + CXCR2 + The neutrophil population was analyzed. Ly6C is a neutrophil surface marker, and CXCR2 is a chemokine receptor; their combined use can accurately identify mature neutrophils with migratory ability. Since the clearance of anti-Ly6G antibodies may affect the detection results by downregulating Ly6G expression, combined detection of CXCR2 can more accurately assess the neutrophil clearance effect. Results are as follows... Figure 9 As shown in Figure A, the proportion of neutrophils was significantly reduced in the anti-Ly6G antibody treatment group. Furthermore, myeloperoxidase (MPO) immunohistochemical staining further confirmed the effective clearance of neutrophils from the tumor tissue. Figure 9 The result (B) indicates the successful construction of an in vivo neutrophil clearance model.

[0097] Under the aforementioned neutrophil clearance conditions, the effect of GSK3β overexpression on CD8 was further evaluated. + The effects of T-cell anti-tumor immune response, experimental grouping and treatment protocols are shown in Table 3.

[0098] Table 3 Treatment methods

[0099]

[0100] The results are as follows Figure 9 As shown in C, Gsk3β In the overexpression group, the rectal tumor volume and tumor weight were significantly increased compared to the control group; however, in the neutrophil clearance... Gsk3β In the overexpression group, because Gsk3β The tumor growth acceleration effect driven by overexpression was significantly weakened.

[0101] Flow cytometry analysis further showed that, Gsk3β In tumors with overexpression, invasive CD8 + The number of T cells decreased ( Figure 9 (in D), and CD8 + The expression levels of cytotoxic effector molecules TNF and granzyme B are decreased in T cells. Figure 9 The above effects were all reversed after neutrophil clearance (E). Figure 9 (D and E in the data) suggests that GSK3β may inhibit CD8 by recruiting neutrophils. + T cell infiltration and cytotoxicity.

[0102] The above results indicate that the pro-tumor activity of intestinal epithelial GSK3β depends on tumor-infiltrating neutrophils, and it does so by inhibiting CD8+. + T-cell anti-tumor immune responses drive the progression of colorectal tumors.

[0103] (2) Validation analysis of the effect of GSK3β deficiency in intestinal epithelium on promoting T3 neutrophil death

[0104] To assess the effect of intestinal epithelial GSK3β deficiency on T3 neutrophil death, flow cytometry was used for detection: firstly, from CD45... + CD11b + Ly6G delineated in myeloid cell population hi Ly6C dim Cells recognize neutrophils and then release DcTRAIL-R1 within that phylum. + Cells were defined as the T3 subset. Based on this, positivity for citrullinated histone H3 (CitH3, a specific marker of neutrophil extracellular trap apoptosis) was used as an indicator of T3 neutrophil death.

[0105] Flow cytometry analysis showed that, compared with the control group, Gsk3β IEC- / - The frequency of T3 neutrophils as a percentage of total neutrophils was significantly reduced in mouse tumors. Figure 10 (A in the original text), while the proportion of cell death in this subpopulation was significantly increased ( Figure 10 (B in the text) suggests that GSK3β deficiency in intestinal epithelium can specifically promote the death of T3 neutrophils.

[0106] Given the immunomodulatory role of neutrophils, we in the intestinal epithelium Gsk3β Further validation of GSK3β's effect on CD8 in the tumor microenvironment in mice with missing GSK3β was conducted. + The effect of cytotoxic T lymphocytes on the antitumor immune response. Flow cytometry analysis showed that... Gsk3β IEC- / - Infiltrating CD8 in mouse tumors + The number of T cells increased significantly ( Figure 10 (in C); in addition, these CD8 + The expression levels of cytotoxic effector molecules TNF and granzyme B in T cells were significantly increased. Figure 10 (D and E in the text) indicates that in the intestinal epithelium Gsk3β Missing CD8 can enhance + Activation status and effector function of cytotoxic T lymphocytes.

[0107] The above results indicate that GSK3β deficiency in the intestinal epithelium relieves its inhibition of CD8 by promoting T3 neutrophil death. + The immunosuppressive effect of T cells, thereby enhancing CD8 + T-cell anti-tumor immune response.

[0108] (3) GSK3β deficiency in intestinal epithelium AKP Validation analysis of tumor suppression and immune microenvironment remodeling in spontaneous models

[0109] To validate these findings in a hereditary colorectal cancer model, Apc min / + ; Kras G12D ; Tp53 + / - (hereinafter referred to as) AKP Mice (a gift from Professor Qin Jun of the Shanghai Branch of the Chinese Academy of Sciences) and Gsk3β IEC- / - Mouse hybridization to obtain AKP ; GSK3 β IEC+ / - F1 generation mice were then bred together to obtain... AKP Spontaneous intestinal tumor and intestinal epithelial specificity Gsk3β Conditional knockout experimental group mice ( AKP ; Gsk3β IEC- / - ) and control mice that were not knocked out ( AKP ; GSK3 β IEC+ / +At 8 weeks of age, mice were intraperitoneally injected for three consecutive days with tamoxifen (2 mg / mouse, from Selleck, catalog number S1238) to induce Cre recombinase-mediated intestinal epithelial-specific... Gsk3β Gene knockout.

[0110] H&E staining results are as follows Figure 11 As shown in A, compared with the control group ( AKP ; Gsk3β IEC+ / + )compared to, AKP ; Gsk3β IEC- / - The tumor area in the mouse colon tissue was significantly reduced. Flow cytometry analysis showed that... AKP ; Gsk3β IEC- / - The frequency of T3 neutrophils as a percentage of the total neutrophil count was significantly reduced in mouse tumors, while the proportion of cell death in this subset was significantly increased. Figure 11 The results (B) are consistent with those in the AOM / DSS induction model. Furthermore, the intestinal epithelium... Gsk3β Deletion significantly downregulates PD-L1 expression levels in T3 neutrophils. Figure 11 (C in the middle).

[0111] Correspondingly, the tumor microenvironment exhibits an enhanced anti-tumor immune response, manifested as follows: AKP ; Gsk3β IEC- / - Infiltrating CD8 in mouse tumors + The number of T cells increased significantly ( Figure 11 (in D), and these CD8 + The expression levels of cytotoxic effector molecules TNF and granzyme B in T cells were significantly increased. Figure 11 (E in the text).

[0112] The above results indicate that, AKP In a spontaneous colorectal cancer model, GSK3β deficiency in the intestinal epithelium also promoted T3 neutrophil death and downregulated PD-L1 expression, while enhancing CD8+ expression. + T cells provide an anti-tumor immune response and inhibit tumor development.

[0113] (4) Validation analysis of the inhibitory effect of GSK3β overexpression in intestinal epithelium on T3 neutrophil death

[0114] To verify the above findings in reverse at the functional gain level, pLenti- Gsk3β -puro vector (containing mouse) Gsk3β Stable MC38 cell lines obtained by lentiviral infection and screening were set as the experimental group (gene). Gsk3βThe overexpression group was used as the control group (empty vector group), and the MC38 stable cell line obtained by infection and screening with pLenti-puro empty vector lentivirus was used as the control group. Both groups of cells were injected orally into the rectum of mice to establish an orthotopic rectal tumor model. Results are as follows: Figure 12 As shown in A, Gsk3β The rectal tumor weight in the overexpression group was significantly higher than that in the control group, suggesting that... Gsk3β Overexpression can significantly promote tumor growth.

[0115] Flow cytometry analysis showed that Gsk3β In the overexpression group, the frequency of T3 neutrophils as a percentage of the total neutrophil count was significantly increased, while the proportion of cell death in this subset was significantly decreased. Figure 12 (B in the text). Furthermore, Gsk3β Infiltrative CD8 in tumors of the overexpression group + The number of T cells decreased significantly ( Figure 12 (in C), and these CD8 + The expression levels of cytotoxic effector molecules TNF and granzyme B in T cells were significantly reduced. Figure 12 (D in the middle).

[0116] The above results indicate that GSK3β overexpression inhibits T3 neutrophil death, increases their intratumoral density, and suppresses CD8+. + T cell infiltration and cytotoxicity promote the progression of colorectal tumors.

[0117] (5) Verification analysis of intestinal epithelial GSK3β maintaining T3 neutrophil survival and promoting the formation of an immunosuppressive microenvironment

[0118] To investigate the molecular mechanism by which intestinal epithelial GSK3β regulates the survival of T3 neutrophils, a lentiviral infection method was used to construct... Gsk3β Stable knockdown of the MC38 cell line. pLKO.1-sh Gsk3β -puro vector (targeting mice) Gsk3β The shRNA sequence is GCTAGGACAACCAATATTT (SEQ ID NO.1). HEK-293T cells were co-transfected with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G. Supernatant containing viral particles was collected and used to infect MC38 cells. Infected cells were then selected using puromycin (2 ng / μL, from Beyotime Biotechnology, catalog number ST551) to obtain... Gsk3β Stable knockdown cell lines as Gsk3β The knockdown group; pLKO.1-puro empty vector virus was packaged in the same manner and used to infect MC38 cells, which were then selected with puromycin and served as the shRNA negative control group. Both groups of cells were injected orally into the rectum of mice to establish an orthotopic rectal tumor model. Results are as follows: Figure 13 As shown in A, Gsk3β The rectal tumor weight in the knockdown group mice was significantly lower than that in the shRNA-negative control group, indicating intrinsic tumor cell activity. Gsk3β The absence of this substance can significantly inhibit tumor growth.

[0119] Flow cytometry analysis showed that Gsk3β The proportion of T3 neutrophil subset deaths in tumors was significantly increased in the knockdown group. Figure 13 (B in the middle), while tumor-invasive CD8 + The number of T cells increased significantly ( Figure 13 (in C), and these CD8 + The expression levels of cytotoxic effector molecules TNF and granzyme B in T cells were significantly increased. Figure 13 (in D), while depleted PD-1 + Tim-3 + CD8 + The proportion of T cells decreased significantly ( Figure 13 (E in the text).

[0120] The above results indicate that intrinsic GSK3β in tumor cells promotes the progression of colorectal tumors by maintaining the survival of T3 neutrophils and creating an immunosuppressive tumor microenvironment.

[0121] In summary, intestinal epithelial GSK3β maintains T3 neutrophil survival, creates an immunosuppressive tumor microenvironment, and inhibits CD8+. + T-cell anti-tumor immunity drives the progression of colorectal tumors. This suggests that GSK3β is a key factor in the regulation of T3 neutrophil survival and function, and a potential target for immune intervention in colorectal cancer.

[0122] Example 6: Clinical correlation analysis of GSK3β expression with T3 neutrophil infiltration and patient prognosis in human colorectal cancer.

[0123] To assess the clinical relevance between intrinsic tumor GSK3β and T3 neutrophils in human colorectal cancer, spatial transcriptome data of colorectal cancer were first analyzed (data source: GSM8594561). Data analysis was performed in a Python environment (version 3.9.23) using core libraries such as numpy (version 1.26.4), pandas (version 2.3.1), scanpy (version 1.10.3), and cell2location (version 0.1.4). For deconvolution analysis, paired scRNA-seq data (containing four technical replicates) from the same patient were obtained from the GEO database. After merging, quality control was performed based on gene count, total count, percentage of mitochondrial genes, and percentage of erythrocyte-specific genes. The count matrix was standardized and logarithmically transformed. After identifying hypervariable genes, principal component analysis was used for dimensionality reduction. A K-nearest neighbor graph was constructed, and BBKNN was used to integrate the replicate samples. Unsupervised clustering was performed, cell populations were annotated based on marker genes, and neutrophil subsets were divided into three differentiation states. After quality control, the spatial transcriptome data retained 4,215 spots and 18,039 genes. After standardization, dimensionality reduction and clustering, cell2location was used for deconvolution analysis to estimate the cell type abundance of each spot.

[0124] Spatial transcriptomic analysis revealed significantly increased GSK3β expression in the tumor core compared to the tumor periphery. Notably, T3 neutrophils were primarily located in the tumor core, while CD8... + T cells are enriched at the tumor periphery ( Figure 14 (A) Correlation analysis showed a strong spatial consistency between tumor GSK3β expression and T3 neutrophil infiltration, supporting their clinical relevance in human colorectal cancer tissues.

[0125] To further validate the above relationships, tumor intrinsic gene expression profiles were reconstructed from the TCGA-COAD and TCGA-READ datasets using BayesPrism. Raw sequencing data were aligned to the hg38 reference genome using TopHat2 software (version 2.1.1), quantified using Gfold software (version 1.1.4), and then differentially expressed genes were analyzed using limma (version 3.62.2) and edgeR (version 4.4.2). The first 2,500 differentially expressed genes were included in subsequent analyses. Functional enrichment analysis was performed using the DAVID web server and gene set enrichment analysis.

[0126] Correlation analysis showed a significant positive correlation between tumor-specific GSK3β expression levels and T3 neutrophil phenotypic scores. Figure 14 (B in the text). Regarding clinical prognosis, patients with high tumor-specific GSK3β expression had significantly poorer overall survival (…). Figure 14(C in the text); Consistent with this, higher T3 neutrophil characteristic scores are strongly associated with an increased risk of death (C in the text). Figure 14 In contrast, neither the T1 nor T2 neutrophil characteristic scores showed significant prognostic value (D). Figure 14 (E and F in the text).

[0127] The above results indicate that intrinsic GSK3β expression in human colorectal cancer is significantly positively correlated with T3 neutrophil infiltration, and high expression of both is closely related to poor prognosis in patients, thus establishing GSK3β and T3 neutrophils as potential biomarkers for prognostic assessment of colorectal cancer patients.

[0128] Example 7: Functional validation of GSK3β-mediated regulation of T3 neutrophil polarization based on patient-derived organoids

[0129] (1) Validation analysis of T3 neutrophil polarization driven by high expression of GSK3β in patient-derived colorectal cancer organoids

[0130] The collection of human tissue samples in this study strictly adhered to the ethical principles outlined in the Declaration of Helsinki. Ten organoid models were derived from primary tumor tissue of ten colorectal cancer patients (aged 40-80 years), provided by the Second Affiliated Hospital of Soochow University. The use of all human tissues was approved by the Biomedical Research Ethics Committee of Soochow University, and all patients signed informed consent forms.

[0131] To further validate the effect of intrinsic GSK3β on T3 neutrophil polarization in clinically relevant models, we minced surgically resected colorectal cancer tissue, dissociated it at 37°C using a mild dissociation reagent (StemCell, catalog number 100-0485), collected crypt cells, mixed them with matrix gel (Corning, catalog number 356231), and seeded them into 24-well plates. We then added organoid complete culture medium (Danwang Medical, catalog number K212M11) for culturing to establish patient-derived colorectal cancer organoids with different levels of endogenous GSK3β expression. Figure 15 (A in the middle).

[0132] Subsequently, conditioned media from organoids of various origins were collected and used to treat human neutrophils. The expression levels of T3 neutrophil characteristic genes were detected by qPCR. The results showed that conditioned media from organoids with high GSK3β expression could effectively induce the expression of T3 neutrophil characteristic genes. Figure 15 (B in the middle).

[0133] The above results indicate that in a patient-derived colorectal cancer organoid model, intrinsic GSK3β overexpression in tumor cells can drive neutrophil polarization toward the T3 phenotype.

[0134] (2) Validation analysis of the inhibition of T3 neutrophil polarization by GSK3β in silent patient-derived colorectal cancer organoids

[0135] To further verify the regulatory role of tumor-intrinsic GSK3β on T3 neutrophil polarization, we treated four patient-derived colorectal cancer organoids with high GSK3β expression in two ways: one was an empty vector lentivirus infection as an shRNA negative control group. GSK3β Knockdown group, infected with targeted human-derived vaccines GSK3β Lentiviral strains of shRNA (target sequence CTACACAGTGCAATTGCCTC (SEQ ID NO.2); virus preparation method is detailed in Part (5) of Example 5) were obtained after screening with puromycin. GSK3β Stable knockdown of organoids ( Figure 16 (A in the middle).

[0136] Conditioned culture media from each group of organoids were collected and co-cultured with human neutrophils to simulate the tumor microenvironment. The expression levels of T3 neutrophil-specific genes in the co-culture system were then detected. Results showed that... GSK3β After induction with conditioned medium in the knockdown group, the expression level of the T3 characteristic gene in human neutrophils was significantly lower than that in the shRNA negative control group. Figure 16 B in the text indicates that... GSK3β Silent organoid-derived conditioned medium can inhibit neutrophil polarization toward the T3 phenotype.

[0137] Flow cytometry analysis further showed that, after GSK3β After induction with conditioned medium in the knockdown group, the expression level of VEGFA in T3-like neutrophils was significantly downregulated. Figure 16 The C in the figure is consistent with the recently reported characteristic of T3 neutrophils having the highest VEGFA transcript levels.

[0138] The above results indicate that GSK3β in silent organoids can reshape the regulatory effect of conditioned medium on neutrophil differentiation, thereby inhibiting neutrophil polarization toward the T3 phenotype.

[0139] In summary, in a patient-derived colorectal cancer organoid model, tumor-intrinsic GSK3β overexpression drives neutrophil polarization towards the T3 phenotype, while silencing GSK3β reverses this effect. These findings further confirm the crucial role of GSK3β in regulating T3 neutrophil differentiation.

[0140] Example 8: Pharmacological verification of the function of GSK3β in inhibiting T3 neutrophil polarization and anti-tumor immunity.

[0141] (1) Validation analysis of ticaglucosidase inhibiting GSK3β and reducing the proportion of T3 neutrophils

[0142] To evaluate the effect of pharmacological inhibition of GSK3β on T3 neutrophil polarization, we first isolated mouse bone marrow-derived neutrophils (BMDNs). Femurs and tibias of 12-week-old C57BL / 6J mice were collected, and the bone marrow was washed with HBSS buffer containing 0.38% sodium citrate. Granulocytes were then collected by Percoll density gradient centrifugation (Cytiva, catalog number 17089101). Subsequently, immunomagnetic bead purification was performed using a Ly6G sorting kit (BioLegend, catalog number 480124), and cell purity and viability were assessed by flow cytometry. The isolated neutrophils were cultured for 24 hours in medium containing recombinant mouse granulocyte colony-stimulating factor (rmGM-CSF, MCE, catalog number HY-P7361, final concentration 10 ng / mL). Figure 17 (A in the middle).

[0143] Subsequently, AOM / DSS-induced samples were collected. Gsk3β IEC+ / + control group and Gsk3β IEC- / - The culture supernatant of colorectal cancer organoids from the experimental group mice was used to incubate the aforementioned bone marrow-derived neutrophils. Figure 17 (A) The results showed that, compared with the control group organoid supernatant, the experimental group organoid supernatant induced a significantly lower proportion of T3 neutrophils (A). Figure 17 (B in the middle).

[0144] Mouse organoids from both genotypes were further treated with ticaglucosidib (5 μM, Merck, catalog number SML0339). The results showed that, compared to the PBS-treated control group organoids, the supernatant from the ticaglucosidib-treated control group organoids further reduced the proportion of T3 neutrophils; while... Gsk3β IEC- / - In the experimental group of organoids, no significant additional effects were observed with ticaglucosidib treatment. Figure 17 (B in the middle).

[0145] The above results indicate that pharmacological inhibition of GSK3β can reduce the proportion of T3 neutrophils, suggesting that ticaglucosidib may weaken its pro-tumor effect by inhibiting GSK3β activity.

[0146] (2) Validation analysis of the in vivo antitumor efficacy of ticaglucosidib in inhibiting GSK3β

[0147] To evaluate the in vivo antitumor efficacy of ticaglucosidib, an AOM / DSS-induced colorectal cancer model was used to... GSK3β IEC+ / + control group and Gsk3β IEC- / - Mice in the experimental group were injected intraperitoneally with ticaglucosidab (25 mg / kg) every other day. After treatment, colon tissue was collected for analysis. Figure 18 (A) The results showed that ticaglucosidib treatment significantly reduced Gsk3β IEC+ / + Tumor burden in mice, but for Gsk3β IEC- / - No significant effect on mice ( Figure 18 (B in the middle).

[0148] Flow cytometry analysis showed that after treatment with ticaglucosidase... Gsk3β IEC+ / + In mouse tumors, the proportion of T3 neutrophils among tumor-infiltrating neutrophils was significantly reduced, while the proportion of cell death in this subset was significantly increased; while... Gsk3β IEC- / - The above effects were not observed in mice. Figure 18 (C in the middle).

[0149] In conclusion, ticaglucosidib can effectively reduce the proportion of T3 neutrophils and promote their death by inhibiting GSK3β activity, thereby inhibiting the growth of colorectal tumors, providing experimental evidence for GSK3β as an immune intervention target for colorectal cancer.

[0150] Example 9: Teglucaxibuxil targeting GSK3β to enhance CD8 + Validation analysis of T-cell anti-tumor immunity

[0151] To evaluate the effect of ticaglucosidib on CD8 in the tumor microenvironment + The effect of T cells on anti-tumor immune response was investigated by flow cytometry analysis of tumor tissues from mice in the above experiments, and CD8+ was detected. + T-cell infiltration and functional status. Results showed that ticaglucosidib treatment significantly increased... Gsk3β IEC+ / + Infiltrating CD8 in mouse tumors + The number of T cells ( Figure 19 (A in the middle), increase CD8 + Expression level of granzyme B in T cells ( Figure 19 (B in the middle), while reducing depleted PD-1 + CD8 + The proportion of T cells ( Figure 19 (C) in the text. And... Gsk3β IEC- / - In mice, ticaglucosidib treatment did not cause significant changes in the above indicators. Figure 19 (A to C in the original text).

[0152] The above results indicate that ticaglucosidib enhances CD8 expression by targeting GSK3β in the intestinal epithelium. + By enhancing the infiltration and cytotoxic functions of T cells and inhibiting their depletion and differentiation, T cells exert anti-tumor immunomodulatory effects.

[0153] Example 10: Validation Analysis of GSK3β Deletion Combined with Immune Checkpoint Inhibitors to Enhance Anti-tumor Immune Response

[0154] To investigate whether inhibiting GSK3β could enhance the efficacy of immune checkpoint blockade (ICB) in colorectal cancer, a colorectal cancer model was established using the AOM / DSS chemical induction method. Gsk3β IEC+ / + Mice served as the control group. Gsk3β IEC- / - Mice were in the experimental group and were either given immune checkpoint blockade therapy with anti-PD-1 antibody (BioXcell, catalog number BE0146) combined with anti-CTLA-4 antibody (BioXcell, catalog number BE0164) (10 mg / kg each, intraperitoneal injection, twice a week), or given isotype control IgG (BioXcell, catalog number BE0083). Colon tissue was collected for analysis after treatment. Figure 20 (A in the middle).

[0155] The results showed that immune checkpoint blockade therapy could moderately inhibit tumor growth; while Gsk3β IEC- / - In mice, Gsk3β The absence of combined immune checkpoint blockade therapy can further enhance the anti-tumor effect. Figure 20 (B in the text). Flow cytometry analysis showed that those who received immune checkpoint blockade therapy... Gsk3β IEC- / - The most significant decrease in T3 neutrophil density was observed in mouse colon tumors. Figure 20 (C in the tumor microenvironment), while CD8 in the tumor microenvironment + The number of infiltrating T cells increased significantly ( Figure 20 (in D), and CD8 + The expression levels of cytotoxic effector molecules TNF and granzyme B in T cells were significantly increased. Figure 20 (E in the text).

[0156] The above results indicate that GSK3β deficiency can enhance CD8 by reducing T3 neutrophil polarization. + T-cell-mediated anti-tumor immunity can enhance the efficacy of immune checkpoint blockade in colorectal cancer.

[0157] Example 11: Validation Analysis of the Synergistic Enhancement of Antitumor Immunity by Ticagrapecilb Combined with Immune Checkpoint Blockade

[0158] To evaluate the antitumor efficacy of the GSK3β inhibitor ticaglucosidib in combination with immune checkpoint blockade (ICB), the following methods were used: AKP A spontaneous colorectal cancer mouse model was developed according to... Figure 21 The patients were administered medication in groups according to the regimen shown in A, and colon tissue was taken for analysis after the treatment was completed.

[0159] The results showed that ticagludec combined with ICB therapy had a superior tumor-suppressive effect compared with either monotherapy. Figure 21 (B in the original text). Flow cytometry analysis showed that the reduction in the proportion of T3 neutrophils in colon tumors was most significant in the ICB combined with ticagludec treatment group, and the level of T3 neutrophil death was the highest. Figure 21 (C in the text). Furthermore, although ICB monotherapy can moderately increase CD8... + T-cell infiltration and function, but ticagludec combined with ICB therapy can significantly increase tumor-invasive CD8 cells. + The proportion of T cells and the increase of CD8 + The frequency of TNF-positive and granzyme B-positive subsets in T cells ( Figure 21 (D to F in the middle).

[0160] The above results indicate that ticaglucosidib can reduce T3 neutrophil polarization and promote their death by inhibiting GSK3β, and synergistically enhance CD8+ with ICB treatment. + T-cell-mediated anti-tumor immune responses provide experimental evidence for the combined use of GSK3β inhibitors and immune checkpoint blockade in the treatment of colorectal cancer.

[0161] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. Application of ticaglucosidib in the preparation of drugs for the treatment of colorectal cancer.

2. The application according to claim 1, characterized in that, The colorectal cancer treatment drug reduces the proportion of T3 neutrophils in the tumor microenvironment and promotes the death of T3 neutrophils.

3. The application according to claim 1, characterized in that, The colorectal cancer includes KRAS Mutant colorectal cancer.

4. The application according to claim 3, characterized in that, The KRAS-mutant colorectal cancer includes KRAS G12D type colorectal cancer, KRAS G12V type colorectal cancer or KRAS G12C type colorectal cancer.

5. Application of ticaglucosidab in combination with immune checkpoint inhibitors in the preparation of drugs for the treatment of colorectal cancer.

6. The application according to claim 5, characterized in that, The immune checkpoint inhibitors include antibodies against programmed death receptor 1 and / or antibodies against cytotoxic T-lymphocyte-associated protein 4.

7. The application according to claim 6, characterized in that, The colorectal cancer treatment drug increases the number of cytotoxic T lymphocyte-positive cells in the tumor microenvironment.

8. A pharmaceutical composition for treating colorectal cancer, characterized in that, The pharmaceutical composition includes ticaglucosidib.

9. The pharmaceutical composition according to claim 8, characterized in that, The pharmaceutical composition further includes an anti-programmed death receptor 1 antibody and / or an anti-cytotoxic T-lymphocyte-associated protein 4 antibody.

10. The pharmaceutical composition according to claim 8, characterized in that, The pharmaceutical composition may also include a pharmaceutically acceptable carrier or excipient.

Images