A composition of ac4c modified polynucleotides and uses thereof

Abstract

The application discloses a kind of ac4C modified polynucleotide compositions and its application.The composition includes the mRNA of coding VEGFA and the mRNA of coding TFAM.The composition provided by the application can effectively enhance VEGFA, TFAM stability and improve protein expression, so as to promote infarction area angiogenesis, inhibit apoptosis, enhance mitochondrial function, reduce active oxygen generation, finally improve cardiac function and left ventricular conduction.Provide the basis for the application of ac4C modification in mRNA myocardial infarction treatment, with good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an ac4C-modified polynucleotide composition and its application. Background Technology

[0002] Cardiovascular disease is the number one killer threatening human health, and ischemic heart disease, especially myocardial infarction, is a common and extremely dangerous type of cardiovascular disease. [1] Ischemia and hypoxia lead to myocardial cell necrosis, and the non-regenerative nature of myocardial cells makes myocardial infarction repair extremely difficult. Chemically synthesized and modified messenger RNA (mRNA), as a novel gene expression vector, can achieve rapid, efficient, and pulsed expression of target proteins. [2] mRNA therapy shows promise as an effective method for repairing myocardial infarction. Studies have shown that expressing the target protein can promote the recovery of the infarcted area and improve cardiac function. [3-5] However, mRNA therapy faces challenges such as poor stability and low translation efficiency. Emerging mRNA modification technologies in recent years promise to provide new methods and tools for solving these problems.

[0003] RNA modification affects gene expression without altering the gene sequence. [6] These include m6A, m5C, m1A, ac4C, Ψ, O8G, and Nm, which play important roles in regulating transcription and translation, cell differentiation, tissue development, and tumor formation and metastasis. [7-10] N4-acetylated cytidine (ac4C) is an acetylation modification on cytidine, catalyzed by N-acetyltransferase 10 (NAT10). This modification is mainly enriched in the coding region (CDS), with a small amount distributed in the 5'UTR and 3'UTR regions. Studies have shown that ac4C mRNA modification can enhance mRNA stability and improve translation efficiency, but its specific mechanism remains unclear.

[11] No studies have yet explored the role and mechanism of precise ac4C modification of specific mRNA expression in the treatment of myocardial infarction. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides an ac4C-modified polynucleotide composition and its application.

[0005] Specifically, the present invention provides the following technical solutions to solve the above-mentioned technical problems: A first aspect of the present invention provides a polynucleotide composition comprising an mRNA encoding VEGFA and an mRNA encoding TFAM, wherein the mRNA is modified with ac4C.

[0006] In some implementations, the proportion of ac4C modification in the mRNA is 5%-30%, wherein the proportion of ac4C modification is the proportion of ac4C to all bases.

[0007] In some implementations, the proportion of ac4C modification in the mRNA is 10-20%.

[0008] In some implementations, the proportion of ac4C modification in the mRNA is 12-16.5%.

[0009] In some specific implementations, the proportion of ac4C modification in the mRNA encoding VEGFA is 12%.

[0010] In some specific implementations, the proportion of ac4C modification in the mRNA encoding TFAM is 16.5%.

[0011] In some embodiments, the mRNA further comprises one or more of the following modifications: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification, and 5-methylcytidine modification.

[0012] In some embodiments, the modification is N1-methyl-pseudouridine modification.

[0013] In some embodiments, the N1-methyl-pseudouridine modification ratio is 100%.

[0014] In some implementations, the mRNA also comprises one or more of a 5'-cap structure, a 5'UTR, a 3'UTR, and a poly(A).

[0015] In some embodiments, the 5'UTR comprises a nucleotide sequence as described in SEQ ID NO: 4.

[0016] In some embodiments, the 3'UTR comprises a nucleotide sequence as described in SEQ ID NO: 5.

[0017] In some embodiments, the length of the poly(A) is 50-250 adenosine A, preferably 120 adenosine A.

[0018] In some implementations, the 5'-cap structure is a Cap1 structure.

[0019] In some implementations, the 5'-cap structure is CAP3111 CAP GAG(3'0Me)m7(3'0MeG)(5')ppp(5')(2'0MeA)pG.

[0020] In some embodiments, the mRNA encoding VEGFA comprises a nucleotide sequence as shown in SEQ ID NO: 2.

[0021] In some embodiments, the mRNA encoding TFAM comprises a nucleotide sequence as shown in SEQ ID NO: 3.

[0022] In some embodiments, the mass ratio of the mRNA encoding VEGFA to the mRNA encoding TFAM is 1:0.5-2 or 0.5-2:1.

[0023] In some specific implementations, the mass ratio of the mRNA encoding VEGFA to the mRNA encoding TFAM is 1:1.

[0024] In some embodiments, the composition further includes a pharmaceutically acceptable carrier and / or excipients.

[0025] In some implementations, the vector is selected from viral vectors and non-viral vectors.

[0026] In some embodiments, the non-viral carrier is selected from lipid nanoparticles (LNPs), polymer carriers, and exosomes.

[0027] In some embodiments, the excipients are selected from one or more of buffers, osmotic pressure regulators, stabilizers, freeze-drying protectants, and preservatives.

[0028] In some implementations, the buffer is selected from Tris-HCl, HEPES, and phosphate-buffered saline (PBS).

[0029] In some embodiments, the osmotic pressure regulator is selected from sucrose, trehalose, and inorganic salts.

[0030] In some embodiments, the stabilizer or freeze-drying protectant is selected from polyethylene glycol (PEG), mannitol, lactose, sucrose, and trehalose.

[0031] A second aspect of the invention provides the use of the composition as described in the first aspect of the invention in the preparation of products for promoting angiogenesis and / or promoting the restoration of mitochondrial function.

[0032] A third aspect of the invention provides the use of the composition as described in the first aspect of the invention in the preparation of a medicament for treating and / or preventing cardiovascular diseases.

[0033] In some implementations, the cardiovascular disease includes myocardial infarction and cardiac fibrosis.

[0034] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0035] The reagents and raw materials used in this invention are all commercially available.

[0036] The positive and progressive effects of this invention are as follows: The ac4C-modified VEGFA and TFAM mRNA composition provided by this invention enhances the stability of VEGFA and TFAM and increases their protein expression, thereby promoting angiogenesis in the infarct area, inhibiting apoptosis, enhancing mitochondrial function, reducing reactive oxygen species production, and ultimately improving cardiac function and left ventricular conduction. Furthermore, RNA sequencing results indicate that the mechanism of action of ac4C-modified mRNA is closely related to the significant upregulation of Eef1a1. This invention provides an important method for the application of ac4C modification in the treatment of myocardial infarction using mRNA and lays an important foundation for expanding the application of mRNA modification technology in the treatment of cardiovascular diseases. Attached Figure Description

[0037] Figures 1-1 to 1-5 ac4C modification enhances the protein expression of GFP and mCherry mRNA. Figure 1-1 Fluorescence expression in H9C2 cells 24 hours after transfection with different proportions of ac4c-GFP mRNA. Figure 1-2 Transfection efficiency and fluorescence intensity were detected by flow cytometry 24 hours after H9C2 cells were transfected with different proportions of ac4c-GFP mRNA. Figure 1-3 Fluorescence expression of GFP, ac4c-GFP, mCherry, and ac4C-mCherry mRNA in H9C2 cells at 12 and 24 hours after transfection. Figure 1-5 The transfection efficiency and fluorescence intensity were detected by flow cytometry at 12, 24, 48, and 72 hours after transfection of H9C2 cells with EH) GFP, ac4c-GFP, mCherry, and ac4C-mCherry mRNA. Figure 1-4 Fluorescent expression of GFP, ac4c-GFP, mCherry, and ac4C-mCherry mRNA in 3T3 cells at 12 and 24 hours after transfection. Figure 1-5 Transfection efficiency and fluorescence intensity were detected by flow cytometry at 12, 24, 48, and 72 hours after transfection of 3T3 cells with JM) GFP, ac4c-GFP, mCherry, and ac4C-mCherry mRNA.

[0038] Figures 2-1 to 2-10 Ac4C modification of GFP mRNA enhances mRNA stability and protein translation efficiency. Figure 2-1 A) q-PCR results of GFP and ac4C-GFP mRNA in H9C2 cells 24 hours after transfection. Figure 2-3 B, Figure 2-2Fluorescence intensity curves of GFP and ac4C-GFP mRNA in H9C2 cells measured by flow cytometry within 0-96 hours, and mathematical modeling curves. Figure 2-1 The protein translation rate of GFP mRNA was calculated using a stochastic differential equation (SDE) mathematical model. Figure 2-3 Polyribosome map of H9C2 cells transfected with GFP and ac4C-GFP mRNA (E). Figure 2-4 The percentage of GFP and ac4C-GFP mRNA in the monoribosome and light polyribosome components of the polyribosome map. Figure 2-5 RNA-Seq analysis of H9C2 cells transfected with GFP and ac4C-GFP mRNA—clustering of differentially expressed genes. Figure 2-8 , Figure 2-9 ) GO function analysis bar charts and scatter plots. Figure 2-6 Scatter plot of KEGG pathway analysis. Figure 2-7 )Scatter plot of Reactome pathway analysis. Figure 2-10 The protein-protein interaction (PPI) network of differentially expressed genes (M). Figure 2-10 q-PCR validation of differentially expressed gene EEF1A1 (N). ns indicates p > 0.05. p < 0.05, p < 0.01, p < 0.001.

[0039] Figures 3-1 to 3-5 In vitro functional studies of ac4C modification of VEGFA and TFAM. Figure 3-1 A) q-PCR detection of VEGFA and ac4C-VEGFA mRNA in H9C2 cells 24 hours after transfection. Figure 3-1 The cumulative secretion curves and statistical results of VEGFA protein at 4, 8, 12, 24, 48, 72 and 96 hours after transfection of BC) H9C2 cells with VEGFA and ac4C-VEGFA mRNA. Figure 3-2 The migration-promoting ability of D)HUVECs transfected with Luc, VEGFA, and ac4C-VEGFA mRNA. Figure 3-2 The angiogenesis-promoting ability of E)HUVECs transfected with Luc, VEGFA, and ac4C-VEGFA mRNA. Figure 3-3 The F) 12-hour migration statistics. Figure 3-3 The number of branch points in the 6-hour angiogenesis experiment (G) was statistically analyzed. Figure 3-3 Statistics on the total tube length in the H) 6-hour angiogenesis experiment. Figure 3-3q-PCR detection of TFAM and ac4C-TFAM mRNA in H9C2 cells 24 hours after I) transfection. Figure 3-4 After establishing an H9C2 injury model using INR, different mRNA groups and mitochondria (Mito) were transfected. Mitochondrial membrane potential (TMRM) and reactive oxygen species (ROS) levels were measured 24 hours later. ac4C50-TFAM indicates 50% CTP replacement by ac4CTP, and ac4C97-TFAM indicates 97% CTP replacement by ac4CTP. Figure 3-5 Statistical graph of changes in mitochondrial membrane potential (TMRM) and reactive oxygen species (ROS). ns indicates p > 0.05. p < 0.05, p < 0.01, p < 0.001.

[0040] Figures 4-1 to 4-5 These are M-mode echocardiograms taken at different time points after myocardial infarction, demonstrating that ac4C-modified VEGFA and TFAM mRNA promote cardiac function recovery after myocardial infarction. The figures represent the parasternal left ventricular long-axis section. M-mode curves were obtained and measured using two-dimensional image guidance; length is 0-24 mm. Units are mm. Figure 4-1 , 4-2 Images 4-3 and 4-4 show M-mode echocardiograms of rats at different time points (1, 2, and 4 weeks after myocardial infarction induction, respectively). Figure 4-5 Analysis of left ventricular ejection fraction (LVEF) after myocardial infarction (B–D). Figure 4-5 Analysis of left ventricular fractional shortening (LVFS) after E–G myocardial infarction induction. ns indicates p > 0.05. p < 0.05, p < 0.01, p < 0.001.

[0041] Figures 5-1 to 5-3 ac4C modification of VEGFA and TFAM mRNA enhances left ventricular electrical conduction. Figure 5-1 Representative electrophysiological images of spontaneous left ventricular conduction after different treatments 4 weeks post-MI (red to blue gradient: bar chart represents the total time of a single heartbeat from the first to the last measurement); Figure 5-2 Representative images of left ventricular conduction dispersion after different treatments 4 weeks post-MI surgery; Figure 5-3 Quantitative analysis of conduction time (C), conduction velocity (D), and conduction dispersion (E) after different treatments 4 weeks post-MI surgery. ns indicates p > 0.05. p < 0.05, p < 0.01, p < 0.001.

[0042] Figures 6-1 to 6-3 ac4C modification of VEGFA and TFAM mRNA reduces cardiac fibrosis and maintains ventricular wall thickness. Figure 6-1 Representative images of cross-sections of the infarcted ventricle myocardium stained with hematoxylin-eosin and Masson's trichrome staining, 4 weeks after myocardial infarction surgery (A and B). Figure 6-1 In section B), the red box marks the boundary area, and the black box marks the infarct area. The scale bar is 1 millimeter. Figure 6-1 C) Magnified images of the junction and infarct area of ​​each group of Masson's trichrome staining, scale bar = 200 micrometers. Figure 6-3 (D) Analysis of infarct area in each group. Figure 6-3 (E) Comparison of left ventricular wall thickness in each group. Figure 6-2 Representative images of vimentin immunostaining in the left ventricle of infarcted rats from each group, scale bar = 25 micrometers. Figure 6-3 Analysis of G) vimentin-positive cells. p < 0.05, p < 0.01, p < 0.001.

[0043] Figures 7-1 to 7-3 ac4C-modified VEGFA and TFAM mRNA promotes angiogenesis in vivo. Figure 7-1 , Figure 7-2 Confocal microscopy images show the expression of α-SMA and CD31 in the infarct zone (IZ) and marginal zone (BZ). Scale bar = 100 µm; magnified area scale bar = 25 µm. Figure 7-3 CF) for infarct area ( Figure 7-3 C, D) and edge areas ( Figure 7-3 We analyzed the capillary density of E and F vessels that express only CD31, and the mature vessel density that expresses both CD31 and α-SMA. p < 0.05, p < 0.01, p < 0.001.

[0044] Figures 8-1 to 8-5 ac4C modification of VEGFA and TFAM mRNA reduces apoptosis and reactive oxygen species levels in the myocardial infarction area. Figure 8-1 , Figure 8-2 Representative cross-sectional images of TUNEL-stained ventricular myocardial tissue from the infarct area after different treatments, 4 weeks after myocardial infarction surgery (scale bar = 25 μm); Figure 8-3 , Figure 8-4Representative cross-sectional images of DHE-stained reactive oxygen species in the infarct area of ​​ventricular myocardial tissue after different treatments 4 weeks after myocardial infarction surgery (scale bar = 100 μm); Figure 8-5 (E) Comparison of apoptosis rates in the infarcted areas of rats in each group; Figure 8-5 Comparison of reactive oxygen species levels in the infarct area of ​​rats in each group (F). p < 0.05, p < 0.01, p < 0.001.

[0045] Figure 9 This is an example diagram of the solution of the present invention. Detailed Implementation

[0046] To better understand this invention, some terms are first defined. Other definitions are listed throughout the detailed description section.

[0047] The term "mitochondrial function" refers to the functions performed by mitochondria. Mitochondria are primarily responsible for energy metabolism, oxidative phosphorylation, and cellular homeostasis regulation. Their core functions include: ATP synthesis: producing energy (ATP) through the electron transport chain (ETC) and oxidative phosphorylation (OXPHOS) to power cellular activities; Reactive oxygen species (ROS) regulation: mitochondria are the main source of ROS; appropriate amounts of ROS participate in signal transduction, while excessive amounts lead to oxidative stress; Calcium ion buffering: regulating intracellular calcium homeostasis and influencing apoptosis and metabolism; Generation of metabolic intermediates: participating in metabolic pathways such as fatty acid oxidation and the tricarboxylic acid cycle (TCA cycle); and apoptosis regulation: triggering programmed cell death by releasing molecules such as cytochrome C.

[0048] The term "promoting mitochondrial function recovery" refers to improving mitochondrial dysfunction caused by disease, aging, or damage through interventions, thereby restoring its energy metabolism and cellular protection capabilities.

[0049] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0050] Preparation Example 1: modRNA Synthesis

[0051] The synthesis of modRNAs was performed using methods conventional in the art. Briefly, a linear DNA template was used in a T7 RNA polymerase-mediated transcriptional reaction. During in vitro transcriptional synthesis, uracil was entirely replaced by N1-methyl-pseudouridine, and CTP was replaced by ac4CTP at ratios of 0%, 25%, 50%, 75%, 97%, and 100%, with EGFP mRNA at 0%, 25%, 50%, 75%, and 100% ac4CTP replacement, VEGFA mRNA at 50%, and TFAM mRNA at 97%. RNA purification was performed using an Ambion MEGAclear column, followed by removal of residual 5′-phosphate groups using Antarctic phosphatase (New England Biolabs). The purity and concentration of the modRNAs were assessed using a NanoDrop spectrophotometer (ThermoFisher Scientific, Waltham, Massachusetts, USA), and the RNAs were resuspended at a concentration of 2 µg / µL for later use.

[0052] The sequences of EGFP mRNA, VEGFA mRNA, and TFAM mRNA are shown in SEQ ID NO: 1-3, respectively. The mRNAs also include a 5'-cap structure (5' Cap), a 5' untranslated region (5' UTR), a 3' untranslated region (3' UTR), and a 3' poly(A) tail. The 5' UTR sequence is AGGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC (SEQ ID NO: 4), and the 3' UTR is 3'TGGCGCGCCTGCAGGAGCGCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG (SEQ ID NO: 5). The poly(A) is 120A, and the 5'-cap structure is a Cap1 structure, specifically CAP3111 CAP. GAG(3'0Me)m7(3'0MeG)(5')ppp(5')(2'0MeA)pG.

[0053] EGFP mRNA:Atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa(SEQ ID NO: 1)

[0054] VEGFA mRNA:Atgaactttctgctgtcttgggtgcattggagccttgccttgctgctctacctccaccatgccaagtggtcccaggctgcacccatggcagaaggaggagggcagaatcatcacgaagtggtgaagttcatggatgtctatcagcgcagctactgccatccaatcgagaccctggtggacatcttccaggagtaccctgatgagatcgagtacatcttcaagccatcctgtgtgcccctgatgcgatgcgggggctgctgcaatgacgagggcctggagtgtgtgcccactgaggagtccaacatcaccatgcagattatgcggatcaaacctcaccaaggccagcacataggagagatgagcttcctacagcacaacaaatgtgaatgcagaccaaagaaagatagagcaagacaagaaaatccctgtgggccttgctcagagcggagaaagcatttgtttgtacaagatccgcagacgtgtaaatgttcctgcaaaaacacagactcgcgttgcaaggcgaggcagcttgagttaaacgaacgtacttgcagatgtgacaagccgaggcggtga(SEQ ID NO: 2)

[0055] TFAM mRNA: (SEQ ID NO: 3)

[0056] The proportion of ac4C modification is calculated based on the percentage of ac4C-modified C bases in the CDS sequence of different mRNAs. For example, in the CDS of VEGFA mRNA, C bases account for 24% of all bases. If the proportion of ac4C-modified C bases is 50%, the last 12% of C bases are replaced with ac4C-modified C bases, and the remaining 12% are ordinary C bases. In the CDS of TFAM mRNA, C bases account for 17% of all bases. If the proportion of ac4C modification is 97%, then the last 16.5% of C bases are replaced with ac4C-modified C bases, and the remaining 0.5% are ordinary C bases.

[0057] Preparation Example 2: Cell Culture

[0058] H9C2 rat cardiomyocytes were purchased from the Cell Bank of the Chinese Academy of Sciences Type Culture Collection. Cells were cultured in DMEM medium (Gibco; Thermo Fisher Scientific) containing 10% heat-inactivated fetal bovine serum (FBS, Gibco; Thermo Fisher Scientific) and 1% penicillin-streptomycin (Gibco; Thermo Fisher Scientific) at 37°C under humid conditions of 5% CO2.

[0059] 3T3 cells (CRL1658, ATCC) were kindly provided by the Kunming Cell Bank, Chinese Academy of Sciences (Kunming, China). The 3T3 cells were cultured in DMEM supplemented with 10% FBS, 100 U / mL penicillin, 100 mg / mL streptomycin, and glutamine at 37°C and 5% CO2. After changing the medium, the cells began to proliferate rapidly, and were passaged and collected when the confluence reached 70%–80%.

[0060] Preparation Example 3: Electroporation and Flow Cytometry Evaluation

[0061] H9C2 and 3T3 cells were expanded in DMEM for 48 hours. Approximately 1 million H9C2 or 3T3 cells were centrifuged and resuspended in 50 µl MaxCyte buffer (Hyclone), with 4 µg GFP mRNA (2 µg / µL), 4 µg ac4C-GFP mRNA (2 µg / µL), 4 µg mCherry mRNA (2 µg / µL), or 4 µg ac4C-mCherry mRNA (2 µg / µL) added. The resuspended cells were added to one well of an OC100×2 MaxCyte electroporation cuvette and electroporated using the OC100×2 program. After transfection, the contents were transferred to a 6-well plate (Corning) and incubated for 20 minutes in a static incubator (5% CO2, 37°C). After 20 minutes, 2 ml of DMEM medium was added to the cells, and subsequent experiments were performed after 12, 24, 48, or 72 hours of culture.

[0062] The transfection efficiency of H9C2 and 3T3 cells was assessed by electroporation with GFP, ac4C-GFP, mCherry, and ac4C-mCherry modRNA. Digested cells were analyzed using a CytoFLEX LX flow cytometer (Beckman Coulter, California, USA) at 12, 24, 48, and 72 hours post-electropy.

[0063] Preparation Example 4: Mathematical Model Establishment

[0064] Flow cytometry data at different time points were mathematically modeled, and the average fluorescence values ​​were fitted using a mathematical model to simulate the overall distribution of cell fluorescence at each time point. This method considers the inherent stochasticity of biological processes. The model parameters were fitted by aligning the simulated fluorescence distribution with the experimentally measured time-series distribution. The goodness of fit was visualized by overlaying the probability density functions of the simulated and experimental data at each time point.

[0065] Preparation Example 5: RNA Extraction and Quantitative PCR

[0066] H9C2 cells were collected at specified time points, and total RNA was extracted using Trizol reagent (Invitrogen) according to the manufacturer's instructions. 2–5 μg of RNA was used for reverse transcription using 200 units of Superscript II (Invitrogen) and oligo dT primers. The resulting cDNA was used for real-time quantitative PCR using SYBR Green premixed PCR solution (KaTaRa), following the reagent instructions. The reaction was performed on an ABI 7500 thermal cycler (Applied Biosystems) equipped with fluorescence detection. Primer sequences are as follows: GFP forward primer: 5′-ACGTAAACGGCCACAAGTTC-3′ (SEQ ID NO: 6) GFP reverse primer: 5′-AAGTCGTGCTGCTTCATGTG-3′ (SEQ ID NO: 7) VEGFA forward primer: 5′-CTGCCGTCCGATTGAGACC-3′ (SEQ ID NO: 8) VEGFA reverse primer: 5′-CCCCTCCTTGTACCACTGTC-3′ (SEQ ID NO: 9) Eef1a1 forward primer: 5′-CGTCAGAACGCAGGTGTTG-3′ (SEQ ID NO: 10) Eef1a1 reverse primer: 5′-ACGTGTCCGATTACGACGAT-3′ (SEQ ID NO: 11) GAPDH forward primer: 5′-AGGTCGGTGTGAACGGATTTG-3′ (SEQ ID NO: 12) GAPDH reverse primer: 5′-GGGGTCGTTGATGGCAACA-3′ (SEQ ID NO: 13)

[0067] Preparation Example 6: Analysis of Polyribosomes

[0068] H9C2 cells were transfected with GFP and ac4C-GFP modified RNA (modRNA) and cultured in 15 cm culture dishes to approximately 70% confluence. Before collection, cells were treated with 100 μg / ml actinomycin (CHX) at 37°C for 15 min, washed twice with ice-cold PBS buffer, and incubated on ice for 30 min with 1 mL of lysis buffer (containing 100 μg / ml CHX, 1× protease inhibitor mixture, and 40 U / ml RNasin). After centrifugation at 13,000 g for 10 min at 4°C, the supernatant was plated on a 10%–50% sucrose gradient and centrifuged at 36,000 rpm for 2.5 h at 4°C using a Beckman SW41Ti rotor. Peak components were collected using the A260 absorbance of a gradient workstation (Biocomp). mRNA bound to four or more ribosomes was used as the polysome component. RNA was extracted using TRIzol reagent (Invitrogen) and analyzed by RT-qPCR.

[0069] Preparation Example 7: RNA Sequencing

[0070] H9C2 cells were transfected with GFP and ac4C-GFP modRNA according to the above electroporation protocol. After 3 days of culture, total mRNA was extracted using Trizol (Life Technologies) and sent to Novogene (Beijing, China) for RNA sequencing. In short, mRNA was purified from total RNA using poly-T oligonucleotide magnetic beads, and fragmented at high temperature using divalent cations in a single-strand synthesis reaction buffer (5×). Single-stranded cDNA was synthesized using random hexamer primers and Moloney mouse leukemia virus reverse transcriptase (M-MuLV), followed by mRNA degradation with RNase H. Subsequently, double-stranded cDNA was synthesized using DNA polymerase I and deoxyribonucleoside triphosphates (dNTPs), and overhanging ends were converted to blunt ends using exonuclease and polymerase activities. After adenylation at the 3' end of the DNA fragment, a hairpin adapter was ligated for hybridization. cDNA fragments of 370-420 bp were screened using the AMPure XP system (Beckman Coulter, USA), amplified by PCR, and then purified again using AMPure XP magnetic beads to obtain libraries. After library construction, quantification was performed using a Qubit 2.0 fluorometer and an Agilent 2100 bioanalyzer, and qRT-PCR was used for verification to ensure quality. Qualified libraries were mixed according to the effective concentration and target data volume requirements and then sequenced using an Illumina NovaSeq 6000.

[0071] Preparation Example 8: Enzyme-Linked Immunosorbent Assay (ELISA)

[0072] The expression kinetics of VEGFA in H9C2 cells after electroporation were detected using a VEGFA ELISA kit (Linke Biotech, China). Conditioned culture medium was collected at 4, 8, 12, 24, 48, 72, and 96 hours after electroporation for VEGFA protein level analysis.

[0073] Preparation Example 9: Angiogenesis and Wound Healing Experiments

[0074] To evaluate the effect of conditioned medium containing H9C2 cells treated with luciferase-modified RNA, VEGFA-modified RNA, and ac4C-VEGFA-modified RNA on the tube-forming ability of human umbilical vein endothelial cells (HUVECs), HUVECs were collected and seeded in Matrigel (Corning International) coated 96-well plates, and cultured in 300 µL of the aforementioned conditioned medium. Tube formation was observed every 2 hours, and the lumen and branches were then counted using ImageJ software. All experiments were repeated five times.

[0075] In the scratch healing experiment, 5×10 5 HUVECs were seeded and cultured in six-well plates. After cell monolayers formed, mechanical scratches were created using a sterile 100 μL pipette tip, followed by the addition of conditioned medium containing HUVECs transfected with luciferase-modified RNA, VEGFA-modified RNA, and ac4C-VEGFA-modified RNA, respectively. Images were captured using a LEICA DMI3000B microscope at 0, 6, 12, and 24 hours and analyzed using Image-pro plus 6.0 software. Each experiment was performed in triplicate.

[0076] Preparation Example 10: Mitochondrial Isolation and Delivery

[0077] Collect H9C2 cells and wash once with PBS. Following the instructions of the Mammalian Cell Mitochondrial Isolation Kit (Thermo Fisher Scientific, USA), 2 × 10⁶ cells were isolated. 7 Mitochondria were isolated after centrifugation of individual cells. Cells were homogenized on ice using a glass Dounce tissue homogenizer in a separation reagent containing a protease inhibitor (EMD Millipore, USA). After centrifugation, the supernatant was discarded, and the total protein concentration of freshly isolated mitochondria was determined using a dicaprinic acid (BCA) kit (Pierce, USA) according to a bovine serum albumin standard curve. The average concentration was 2 × 10⁻⁶ cells / cm². 7Approximately 400 μg of mitochondria could be isolated from each donor cell. A damage model was established by treating H9C2 cells with 1 μM daunorubicin for 24 hours. 5 μg of mitochondria was gently mixed by pipetting and added to 1×10⁻⁶ cells seeded in standard culture medium. 5 In damaged H9C2 cells. After treatment with Mito for 24 hours, the recipient cells were washed twice with PBS, followed by mitochondrial membrane potential and reactive oxygen species assays.

[0078] Preparation Example 11: Mitochondrial Membrane Potential (ΔΨM) and Reactive Oxygen Species (ROS)

[0079] Cells were co-incubated with tetramethylrhodamine perchlorate (TMRM; Thermo Fisher Scientific, T-668, USA) (10 μM) and observed using an epifluorescence microscope. Cell fluorescence intensity was measured using ImageJ software. Mitochondria in normal cells showed bright red fluorescence after TMRM staining; the red fluorescence became diffuse or significantly weakened when the mitochondrial membrane potential dissipated.

[0080] Cells were incubated with DCFH-DA (Yeasen, China, 50101ES01) (10 μM) for 30 minutes and then observed using an Olympus AX-70 fluorescence microscope. Cell fluorescence intensity was measured using ImageJ software. Enhanced green fluorescence indicated increased superoxide production.

[0081] Preparation Example 12: Animal Model of Myocardial Infarction and Treatment of Myocardial Infarction with Naked Injection of mRNA

[0082] The experiment used male Sprague-Dawley rats (200-250 g) provided by Shanghai Jihui Laboratory Animal Co., Ltd. All animal experiments were approved by the Laboratory Animal Welfare and Ethics Committee of Shanghai Children's Medical Center (Approval No.: SCMC-LAWEC-2019-009). Naked delivered modified RNA (modRNA) was dissolved in a mixture of 10 µL of nuclease-free aqueous solution (0.3 g / mL) containing sucrose and 10 µL of citrate buffer (0.1 M [pH 7]; Kawasaki Sigma, Japan), and then mixed with 200 µg of modRNA dissolved in physiological saline to a total volume of 120 µL. Rats were randomly divided into seven groups: (1) sham-operated group; (2) myocardial infarction (MI) model group; (3) luciferase group (120 µL of a mixture containing 10 µL sucrose, 10 µL citrate and 200 µg [100 µL] luciferase modRNA was injected into the left ventricular marginal zone after MI); (4) ac4C-VEGFA group (120 µL of a mixture containing 200 µg [100 µL] ac4C-VEGFA modRNA was injected after MI); (5) ac4C-TFAM group (120 µL of a mixture containing 200 µg [100 µL] ac4C-TFAM modRNA was injected after MI); (6) dual-genome group (120 µL of a mixture containing 200 µg [50 µL] VEGFA modRNA and 200 µg [50 µL] TFAM modRNA was injected after MI); (7) ac4C-dual-genome group (120 µL of a mixture containing 200 µg [50 µL] VEGFA modRNA and 200 µg [50 µL] TFAM modRNA was injected after MI). (A mixture of 50 µL ac4C-VEGFA modRNA and 200 µL ac4C-TFAM modRNA in 120 µL). The rat MI model was established using previous methods: under continuous isoflurane anesthesia, the left anterior descending coronary artery was permanently ligated using 6-0 sutures after thoracotomy. Intraoperative electrocardiogram monitoring confirmed successful establishment of the MI model.

[0083] In the treatment group, mRNA was injected at three fixed sites in the infarct border area 10 minutes after ligation of the left anterior descending coronary artery. Modified cells were provided to surgeons only by number, without specific grouping information. To avoid immune rejection, all rats received methylprednisolone at 5 mg / kg / day and tacrolimus at 0.25 mg / kg / day every 12 hours from one day before myocardial infarction until the day of sacrifice.

[0084] Preparation Example 13: Echocardiographic Detection

[0085] To compare cardiac function among the groups, ultrasound examinations were performed at 1, 2, and 4 weeks after induction of myocardial infarction. Anesthesia was maintained with isoflurane, and transthoracic ultrasound examinations were conducted by technicians unaware of the group assignments. Left ventricular systolic and diastolic motions were recorded using a Vevo 3100 imaging system (Visualsonics, Toronto, Canada) and an MS-250 probe, and left ventricular end-systolic volume (LVESV) and end-diastolic volume (LVEDV) were automatically calculated. Left ventricular ejection fraction (LVEF) and fractional shortening (LVFS) were calculated using the following formulas to assess cardiac function: LVEF (%) = ((LVEDV-LVESV) / LVEDV)×100%, LVFS (%) = ((LVIDd-LVIDs) / LVIDd)×100%.

[0086] Preparation Example 14: Cardiac Electrical Conduction Function Testing

[0087] Four weeks after myocardial infarction, rats were anesthetized with endotracheal intubation and isoflurane for maintenance anesthesia. After thoracotomy, an 8×8 microelectrode array (MappingLab Inc., UK) was placed on the epicardial surface to record electrical activity. Active waveforms were amplified by a filter amplifier (MappingLab Inc., UK) and transmitted to a computer, where all activation times were digitized and activation maps were plotted. The point of maximum negative slope of the waveform was taken as the activation time, and conduction time (CT), conduction velocity (CV), and non-uniformity index were analyzed using EMapScope 4.0 software (MappingLab Inc., UK).

[0088] Preparation Example 15: Histological and Immunohistochemical Staining

[0089] Four weeks after myocardial infarction, heart tissue was harvested and stained with hematoxylin and eosin (Solarbio, China) and Masson's trichrome (Solarbio, China). ImageJ was used to calculate the proportion of scar tissue and the thickness of the left ventricular wall.

[0090] Staining was performed using the one-step TUNEL apoptosis detection kit (Servicebio) according to the instructions: after hydration with xylene and graded ethanol, the sections were stained with TUNEL reagent, counterstained with DAPI, and imaged using a laser confocal microscope (TSC SP8, Leica).

[0091] Superoxide in fresh frozen heart sections (10 μm) was detected using dihydroethidium (DHE, 10 μM; MKL-D807594) and observed under a fluorescence microscope (excitation 546 nm, detection 590 nm). Fluorescence intensity of retinal sections was quantified using ImageJ software (National Institutes of Health), and data were normalized to normoxic mouse values. 2.16 Metabolomics and Proteomics Analysis

[0092] The rat heart samples were divided into two groups: one for non-targeted metabolomics analysis and the other for proteomics research. For cardiac metabolite extraction, tissue samples were homogenized in liquid nitrogen, and the homogenate was resuspended in 500 μL of pre-cooled 80% methanol solution, vortexed for 4 minutes. After incubating the suspension on ice for 5 minutes, it was centrifuged at 15,000g for 20 minutes at 4°C. A portion of the supernatant was diluted with mass spectrometry-grade water to a final methanol concentration of 53%, and centrifuged again at 15,000g for 20 minutes at 4°C. The resulting supernatant was analyzed by ultra-high performance liquid chromatography-tandem mass spectrometry (UHPLC-MS / MS). Detection was performed using a Vanquish ultra-high performance liquid chromatography system coupled with an Orbitrap Q Exactive HF-X mass spectrometer (Thermo Fisher Scientific).

[0093] Preparation Example 16: Statistical Analysis

[0094] All data are expressed as mean ± standard deviation (SD). The Shapiro-Wilk test was used to assess the normality of the data distribution before statistical analysis. Depending on the data type, Student's t-test, one-way ANOVA combined with Tukey's post-hoc test, or two-way ANOVA combined with Bonferroni's multiple comparison test (GraphPad Software, San Diego, USA) were used. All results were from at least three independent experiments, and a p-value < 0.05 was considered statistically significant.

[0095] Example 1: ac4C modification enhances the protein expression levels of GFP and mCherry mRNA.

[0096] By preparing and transfecting GFP mRNA containing different proportions of ac4C-modified cytidine triphosphate (ac4CTP-0%, 25%, 50%, 75%, and 100%), the results showed that 50% ac4CTP was the optimal proportion, and this proportion was used in subsequent experiments. Figure 1-1 , Figure 1-2To investigate the effect of ac4C modification on mRNA protein expression, H9C2 cells were electroporated with GFP, ac4C-GFP, mCherry, and ac4C-mCherry mRNA, respectively, and flow cytometry analysis was performed at different time points. The results showed no significant difference in transfection efficiency at different time points, but at 12 and 24 hours, the protein expression level of ac4C-GFP was significantly higher than that of unmodified GFP, and the protein expression level of ac4C-mCherry was also significantly higher than that of unmodified mCherry. Figure 1-3 , Figure 1-4 as well as Figure 1-5 EH). Similar results were also observed in 3T3 cells (EH). Figure 1-5 (IM). The above results indicate that ac4C modification can significantly improve mRNA translation efficiency and enhance protein expression levels.

[0097] Example 2: ac4C modification enhances GFP mRNA stability and protein translation efficiency

[0098] To investigate the mechanism of ac4C modification on GFP mRNA, its effect on mRNA stability was evaluated using q-PCR. The results showed that ac4C significantly improved the stability of GFP mRNA. Figure 2-1 A). Based on flow cytometry fluorescence intensity data of GFP and ac4C-GFP mRNA within 0-96 hours ( Figure 2-3 B and Figure 2-2 )(in Figure 2-2 The mathematical modeling curves representing the fluorescence intensity of GFP and ac4C-GFP mRNA in H9C2 cells within 0-96 hours as measured by flow cytometry are shown. In the figure, raw1-3 represent the control group GFP mRNA, Fit raw1-3 represents the fluorescence intensity fitted curve based on the flow cytometry detection of GFP mRNA, and ac4c1-3 represents the fluorescence intensity fitted curve based on the flow cytometry detection of ac4C-GFP mRNA. The horizontal axis represents the flow cytometry detection time point, and the vertical axis represents the flow cytometry detection fluorescence intensity. A mathematical model was established, and the translation efficiency of GFP mRNA was calculated to be 0.0699 ± 0.0102, while that of ac4C-GFP mRNA reached 0.1339 ± 0.0080. The translation efficiency of ac4C-GFP was significantly higher than that of the GFP group, and the difference was statistically significant (p < 0.01). Figure 2-1 D).

[0099] To further verify the effect of ac4C modification on translation efficiency, we performed polyribosome analysis. The results showed that the proportion of ac4C-GFP mRNA in the polyribosome fraction was significantly higher than that in the GFP group (…). Figure 2-3 Furthermore, the levels of ac4C-GFP in monoribosomes and light polyribosomes were significantly higher than those in the control group (p < 0.01). Figure 2-4 This indicates that ac4C-GFP mRNA can bind more ribosomes, thereby improving protein translation efficiency.

[0100] The mechanism of ac4C modification was investigated using RNA-Seq sequencing. In the experimental group, pathways such as "formation of the translation initiation complex" and "nucleocytoplasmic transport" were significantly upregulated. Figures 2-5 to 2-9 () Figure 2-5 Gene clusters representing significant differences in transcriptome sequencing after ac4C modification are shown in the image. The gene clusters are as follows: ac4C modification resulted in high expression of genes such as Mki67, mt-ND1, eEF1A1, and EIF4E; ac4C modification resulted in low expression of genes such as Lum, Col1a1, Rps27a, and Rps18; and significantly increased expression of genes such as EEF1A1, Rps27a, Rps18, and Eif4e. Figure 2-10 (M). q-PCR validation further confirmed that the EEF1A1 gene, which encodes the α subunit of the elongation factor 1 complex and plays a key role in the translational elongation stage, was significantly overexpressed in the ac4C-GFP group (p < 0.05). Figure 2-10 In summary, ac4C modification enhances mRNA stability and improves protein translation efficiency by upregulating the key gene EEF1A1 in the translation elongation stage.

[0101] Example 3: In vitro functional study of ac4C-modified VEGFA and TFAM mRNA

[0102] To verify the effect of ac4C on VEGFA mRNA stability and protein translation efficiency, q-PCR results showed that ac4C-VEGFA mRNA exhibited significantly higher stability than VEGFA mRNA (p < 0.05). Figure 3-1 (A). ELISA results further revealed that at multiple time points after transfection (4, 8, 12, 24, 48, 72, and 96 hours), the amount of protein secreted by ac4C-VEGFA was higher than that of VEGFA mRNA, and the difference was statistically significant. Figure 3-1 The effect of ac4C-VEGFA on HUVECs was then evaluated using a scratch assay. Compared with the Luc group and the VEGFA group, ac4C-VEGFA significantly enhanced the migration ability of HUVECs. Figure 3-2 D, Figure 3-3 Furthermore, angiogenesis experiments showed that ac4C-VEGFA significantly promoted the formation of tubular structures (F). Figure 3-2The number of nodes and the total pipe length of E both increased significantly ( Figure 3-3 (G, H).

[0103] To investigate the effect of ac4C on TFAM mRNA stability and protein translation efficiency, q-PCR confirmed that ac4C-TFAM mRNA was significantly more stable than TFAM mRNA (p < 0.05). Figure 3-3 (I). By establishing a damaged H9C2 cell model, we examined the effects of TFAM on mitochondrial membrane potential (MMP) and reactive oxygen species (ROS). MMP staining showed decreased MMP in damaged H9C2 cells, while mitochondrial transplantation (Mito) significantly restored MMP. Notably, ac4C97-TFAM mRNA showed a more significant improvement effect than ac4C50-TFAM mRNA and Mito. Figure 3-4 J, Figure 3-5 ROS staining results showed elevated ROS levels in damaged H9C2 cells, and Mito transplantation significantly reduced ROS. Furthermore, ac4C-TFAM mRNA significantly reduced ROS levels in damaged H9C2 cells, with ac4C97-TFAM mRNA showing even significantly lower ROS levels than the Mito group (p < 0.05). Figure 3-4 K, Figure 3-5 (M). Given that the experimental results of ac4C97-TFAM are better than those of ac4C50-TFAM, all subsequent experiments related to ac4C-TFAM will use ac4C97-TFAM.

[0104] The above results indicate that ac4C can significantly enhance the stability of VEGFA and TFAM mRNA and exhibit stronger pro-angiogenic and mitochondrial repair capabilities in vitro, which lays the foundation for the precise modification of mRNA by ac4C to treat myocardial infarction.

[0105] Example 4: ac4C-modified VEGFA and TFAM mRNA promotes cardiac function recovery after myocardial infarction.

[0106] To explore the therapeutic potential of ac4C-modified VEGFA and TFAM mRNA for myocardial infarction (MI), we established a rat MI model. The effects of different treatment groups on left ventricular (LV) function were assessed by echocardiography. Seven groups were established: sham operation group, MI group, Luc control group, ac4C-VEGFA group, ac4C-TFAM group, Dual dual-factor group, and ac4C-Dual dual-factor modification group. Echocardiography was performed at weeks 1, 2, and 4 after MI modeling and cell therapy. Figures 4-1 to 4-4 ).

[0107] The results showed that LV function in all groups of rats decreased significantly one week after MI surgery, but there was no statistically significant difference in the degree of decrease among the groups at this time. Figure 4-5 (B). Regardless of whether cell transplantation was received, there were no significant differences in LV ejection fraction (LVEF) and LV short axis shortening rate (LVFS) among the groups during the first week postoperatively. Figure 4-5 (B, E). But by week 2, the LVEF and LVFS of the ac4C-Dual group rats had significantly increased ( Figure 4-5 (C, F). By week 4, the ac4C-Dual group showed the most significant efficacy: LVEF increased from 37.22%±1.753% to 47.09%±1.161%, and LVFS increased from 18.52%±0.8036% to 24.71%±0.7470%. Other treatment groups also showed improvement trends: ac4C-VEGFA group: LVEF increased from 35.66%±1.067% to 41.55%±0.8226%, LVFS increased from 17.75%±0.6279% to 21.43%±0.4604%; ac4C-TFAM group: LVEF increased from 34.59%±3.179% to 40.20%±1.211%, LVFS improved from 17.16%±1.782% to 20.56%±0.6872%; Dual group: LVEF increased from 35.07%±1.602% to 43.12%±1.418%, LVFS improved from 17.53%±0.8488% to 22.48%±0.8447%. Figure 4-5 (D and G). Notably, the ac4C-Dual group showed significantly better efficacy than the unmodified Dual group and other single-modification groups. This result confirms that the ac4C-Dual group exhibits good therapeutic effects through a two-factor action, providing important evidence for the treatment of myocardial infarction.

[0108] Example 5: ac4C-modified VEGFA and TFAM mRNA enhance left ventricular electrical conduction.

[0109] To assess changes in left ventricular electrical conduction following surgical and therapeutic interventions for myocardial infarction (MI), left ventricular electrical conduction was measured 4 weeks post-MI surgery. Compared to the sham surgery group, all groups exhibited conduction disturbances. Figure 5-1 ), and the dispersion of electrical activity increased significantly 4 weeks after MI surgery ( Figure 5-2 By week four, compared to the MI and Luc groups, rats treated with ac4C-VEGFA, ac4C-TFAM, Dual, or ac4C-Dual exhibited more ordered conduction (Figure 5A) and reduced electrical activity dispersion. Figure 5-2 ).

[0110] Four weeks after MI surgery and intervention, quantitative analysis was performed on conduction time (CT), conduction velocity (CV), and electrical activity dispersion in each group. Results showed that CT was prolonged, CV was significantly reduced, and conduction dispersion increased after MI. Four weeks of treatment with ac4C-VEGFA, ac4C-TFAM, Dual, or ac4C-Dual resulted in shortened left ventricular CT, increased CV, and decreased conduction dispersion. Figure 5-3 Notably, after 4 weeks of ac4C-TFAM treatment, although conduction velocity (CV) did not change significantly compared to the MI and Luc groups, left ventricular conduction time (CT) and electrical conduction dispersion both improved. The improvement in left ventricular conduction was most significant in the ac4C-Dual group compared to other groups. The efficacy of the ac4C-Dual group was significantly better than that of the unmodified Dual group, indicating that precise ac4C modification plays an important role in enhancing left ventricular electrical conduction.

[0111] Example 6: ac4C-modified VEGFA and TFAM mRNA reduce cardiac fibrosis and maintain ventricular wall thickness

[0112] Heart tissue was harvested 4 weeks after myocardial infarction treatment. Hematoxylin-eosin staining showed that, compared with other groups, the proportion of regenerated cardiac tissue in the ac4C-Dual treatment group was significantly increased. Figure 6-1 Masson staining revealed that the scar area in the left ventricle of rats in the ac4C-Dual group was significantly reduced, while the ventricular wall thickness remained well maintained. Figure 6-1 (B and C). Quantitative analysis of the left ventricular infarction area and ventricular wall thickness in each group of rats also verified this result. Figure 6-3 D and E). Vimentin staining showed that 4 weeks after myocardial infarction, a large number of fibroblasts were present in the infarct area of ​​each group. Figure 6-2 However, compared to the MI group, the ac4C-Dual group had fewer infiltrating fibroblasts. Figure 6-2 , Figure 6-3 (G). Overall, ac4C-Dual can reduce cardiac fibrosis, improve ventricular remodeling, and maintain ventricular wall thickness.

[0113] Example 7: ac4C-modified VEGFA and TFAM mRNA promote angiogenesis in vivo

[0114] To verify the ability of ac4C-Dual to promote angiogenesis in the transplanted area and to explore whether it could more effectively promote angiogenesis in the infarct area, we performed a CD31 and α-SMA immunofluorescence double staining experiment. The staining results showed that compared with the myocardial infarction (MI) group and the Luc group, the number of vessels in the infarct area was significantly increased in the mRNA treatment group (Figure 7A). Among them, ac4C-VEGFA was superior to ac4C-TFAM in promoting angiogenesis, indicating that VEGFA plays a more crucial role in angiogenesis than TFAM. Notably, in rats treated with Dual and ac4C-Dual, we observed that most of the newly formed vessels in the myocardial infarction area simultaneously expressed CD31 and α-SMA, suggesting the formation of mature vessels (…). Figure 7-1 , Figure 7-3 (C, D). Compared with other groups, the ac4C-Dual group showed significantly increased capillary density and mature vessel density in both the infarct area and the infarct margin. Furthermore, compared with the unmodified Dual group, the ac4C-Dual group showed significantly increased mature vessel density in both the infarct area and the infarct margin. Figure 7-2 , Figure 7-3 (E, F).

[0115] Example 8: ac4C-modified VEGFA and TFAM mRNA reduced apoptosis and reactive oxygen species levels in the myocardial infarction area.

[0116] To investigate apoptosis and reactive oxygen species (ROS) after myocardial infarction, we first assessed apoptosis in the infarct area. Apoptosis in the infarct area was significantly reduced in the ac4C-Dual group. TUNEL staining results showed that, compared with the Luc control group, the proportion of apoptotic cells in the infarct area decreased in all four treatment groups (ac4C-VEGFA, ac4C-TFAM, Dual, and ac4C-Dual) after 4 weeks of treatment. Figure 8-1 Specifically, the apoptosis rate in the Luc control group was 12.062±2.716%, while in the ac4C-VEGFA group (6.165±1.509%), ac4C-TFAM group (5.834±1.938%), Dual group (4.773±1.277%), and ac4C-Dual group (4.601±1.428%), the number of apoptotic cells in the infarct area was significantly reduced in the treatment groups compared to the control group. Figure 8-3 In addition, ROS staining was performed on the infarct area 3 days after myocardial infarction treatment. Figure 8-2 The results showed that there was no significant difference between the ac4C-VEGFA group and the Luc group, while the ac4C-TFAM group, Dual group, and ac4C-Dual group significantly reduced the ROS level of cells in the infarct area, indicating that TFAM plays a key role in reducing ROS levels in the myocardial infarction area. Figure 8-4Furthermore, the ac4C-Dual group showed a significantly better ROS-reducing effect than the Dual group, further demonstrating the therapeutic effect of ac4C-modified mRNA in treating myocardial infarction.

[0117] This invention employs a dual-factor combination of ac4C-modified VEGFA and TFAM mRNA for the treatment of acute myocardial infarction (MI). Experimental results show that ac4C-Dual effectively promotes cardiac function recovery and improves left ventricular conduction. Histological analysis shows that this treatment reduces fibrosis area, increases neovascularization density, and alleviates ventricular remodeling. This study confirms that the combined use of ac4C and mRNA can promote multidimensional repair after myocardial infarction.

[0118] To enhance the therapeutic efficacy of ac4C-modified VEGFA and TFAM mRNA and improve the prognosis of myocardial infarction, this study used ac4C modification to enhance mRNA stability and translation efficiency. Previous studies have demonstrated that intra-infarct injection of VEGFA can significantly increase vascular density, reduce tissue necrosis, and improve cardiac function.

[12] Multiple clinical studies have also verified that local application of VEGFA can improve myocardial perfusion and function in patients with end-stage angina pectoris, and bring about sustained symptom relief.

[13] This evidence suggests that VEGFAs play a central role in promoting angiogenesis. However, while VEGFAs can promote angiogenesis, they cannot address the decreased energy metabolism and mitochondrial damage following myocardial infarction. The mitochondrial DNA transcription factor TFAM can promote ATP synthesis and increase mitochondrial content by upregulating mitochondrial DNA expression. Studies have shown that TFAM can accelerate the recovery of cardiac function after myocardial infarction. [14,15] Furthermore, ac4C modification can enhance mRNA stability and protein translation efficiency.

[16] This study innovatively applies ac4C-modified VEGFA and TFAM to the treatment of myocardial infarction, simultaneously promoting angiogenesis and mitochondrial repair.

[0119] This invention is the first to demonstrate a combination therapy regimen of precisely modified ac4C, VEGFA, and TFAM. ac4C-Dual significantly promotes the recovery of cardiac function after acute myocardial infarction. We believe that precisely modified ac4C mRNA has broad application prospects in the future treatment of heart failure, and this technology will drive the in-depth development of cell therapy in this field.

[0120] References: [1] Virani SS, Alonso A, Benjamin EJ, et al. Heart disease and strokestatistics-2020 update: A report from the american heart association [J].Circulation, 2020,141(9):e139-e596. [2] Fu W, Liu Z, Feng B, et al. Electrospun gelatin / pcl and collagen / plcl scaffolds for vascular tissue engineering [J]. Int J Nanomedicine, 2014,9(2335-2344. [3] Zangi L, Lui KO, von Gise A, et al. Modified mrna directs thefate of heart progenitor cells and induces vascular regeneration aftermyocardial infarction [J]. Nat Biotechnol, 2013,31(10):898-907. [4] Ylä-Herttuala S, Baker AH. Cardiovascular gene therapy: Past,present, and future [J]. Mol Ther, 2017,25(5):1095-1106. [5] Ylä-Herttuala S, Bridges C, Katz MG, et al. Angiogenic genetherapy in cardiovascular diseases: Dream or vision? [J]. Eur Heart J, 2017,38(18):1365-1371. [6] He C. Grand challenge commentary: Rna epigenetics? [J]. Nat ChemBiol, 2010,6(12):863-865. [7] Davalos V, Blanco S, Esteller M. Snapshot: Messenger rnamodifications [J]. Cell, 2018,174(2):498-498.e491. [8] Nelson J, Sorensen EW, Mintri S, et al. Impact of mrna chemistryand manufacturing process on innate immune activation [J]. Sci Adv, 2020,6(26):eaaz6893. [9] Shi J, Yang C, Zhang J, et al. Nat10 is involved in cardiacremodeling through ac4c-mediated transcriptomic regulation [J]. Circ Res,2023,133(12):989-1002.

[10] Wang G, Zhang M, Zhang Y, et al. Nat10-mediated mrna n4-acetylcytidine modification promotes bladder cancer progression [J]. ClinTransl Med, 2022,12(5):e738.

[11] Ma W, Tian Y, Shi L, et al. N-acetyltransferase 10 repressesuqcr11 and uqcrb independently of ac4c modification to promote heartregeneration [J]. Nat Commun, 2024,15(1):2137.

[12] Oduk Y, Zhu W, Kannappan R, et al. Vegf nanoparticles repair theheart after myocardial infarction [J]. Am J Physiol Heart Circ Physiol, 2018,314(2):H278-h284.

[13] Sarkar N, Rück A, Källner G, et al. Effects of intramyocardialinjection of phvegf-a165 as sole therapy in patients with refractory coronaryartery disease--12-month follow-up: Angiogenic gene therapy [J]. J InternMed, 2001,250(5):373-381.

[14] Kunkel GH, Kunkel CJ, Ozuna H, et al. Tfam overexpressionreduces pathological cardiac remodeling [J]. Mol Cell Biochem, 2019,454(1-2):139-152.

[15] Kunkel GH, Chaturvedi P, Tyagi SC. Mitochondrial pathways tocardiac recovery: Tfam [J]. Heart Fail Rev, 2016,21(5):499-517.

[16] Li J, Yushanjiang F, Fang Z, et al. Nat10-mediated rna ac4cacetylation contributes to the myocardial infarction-induced cardiac fibrosis[J]. J Cell Mol Med, 2024,28(21):e70141. While specific embodiments of the present invention have been described above, those skilled in the art should understand that these are merely illustrative examples, and various changes or modifications can be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.

Claims

1. A polynucleotide composition, characterized in that, The composition comprises mRNA encoding VEGFA and mRNA encoding TFAM, wherein the mRNA contains ac4C modification.

2. The composition according to claim 1, characterized in that, The mRNA contains 5%-30% ac4C modification, preferably 10-20%; more preferably 12-16.5%; wherein the ac4C modification ratio is the proportion of ac4C to all bases. Preferably, the proportion of ac4C modification in the mRNA encoding VEGFA is 12%; and / or, the proportion of ac4C modification in the mRNA encoding TFAM is 16.5%.

3. The composition according to claim 1 or 2, characterized in that, The mRNA further comprises one or more of the following modifications: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification, and 5-methylcytidine modification; the modification is preferably N1-methyl-pseudouridine modification, and the proportion of N1-methyl-pseudouridine modification is preferably 100%.

4. The composition according to any one of claims 1-3, characterized in that, The mRNA also includes one or more of the following: a 5'-cap structure, a 5'UTR, a 3'UTR, and poly(A); Preferably, the polynucleotide satisfies at least one of the following conditions: (i) The 5'UTR contains the nucleotide sequence as described in SEQ ID NO: 4; (ii) The 3'UTR contains the nucleotide sequence as described in SEQ ID NO: 5; (iii) The length of the poly(A) is 50-250 adenosine A, preferably 120 adenosine A; (iv) The 5'-cap structure is a Cap1 structure, and the 5'-cap structure is preferably CAP3111 CAP GAG(3'0Me)m7(3'0MeG)(5')ppp(5')(2'0MeA)pG.

5. The composition according to any one of claims 1-4, characterized in that, The mRNA encoding VEGFA contains the nucleotide sequence shown in SEQ ID NO: 2; and / or, the mRNA encoding TFAM contains the nucleotide sequence shown in SEQ ID NO:

3.

6. The composition according to any one of claims 1-5, characterized in that, The mass ratio of the mRNA encoding VEGFA to the mRNA encoding TFAM is 1:0.5-2 or 0.5-2:1, preferably 1:

1.

7. The composition according to any one of claims 1-6, characterized in that, The composition also includes a pharmaceutically acceptable carrier and / or excipients; Preferably, the vector is selected from viral vectors and non-viral vectors, and the non-viral vector is selected from lipid nanoparticles (LNPs), polymer carriers, and exosomes; and / or, The excipients are selected from one or more of the following: buffers, osmotic pressure regulators, stabilizers, freeze-drying protectants, and preservatives.

8. Use of the composition according to any one of claims 1-7 in the preparation of products for promoting angiogenesis and / or promoting the restoration of mitochondrial function.

9. Use of the composition according to any one of claims 1-7 in the preparation of a medicament for treating and / or preventing cardiovascular diseases.

10. The application as described in claim 9, characterized in that, The cardiovascular diseases mentioned include coronary heart disease, arrhythmia, structural heart disease, heart failure, peripheral vascular disease, hypertension-related diseases, and congenital heart disease; Preferably, the cardiovascular disease is ischemic heart disease, such as myocardial infarction or cardiac fibrosis.

Images