Anti-reovirus sigma c protein monoclonal antibody and its epitope and application

Abstract

The application discloses an anti-reovirus sigma C protein monoclonal antibody and an epitope and application thereof, and belongs to the field of veterinary biological technology and immunology. The monoclonal antibody can recognize a linear B cell epitope on the sigma C protein, the epitope is located in the N-terminal region of the sigma C protein, the core amino acid sequence is leucine at the 72nd position, aspartic acid at the 73rd position and aspartic acid at the 74th position, and the complete epitope sequence is TLDDV, wherein threonine at the 71st position and valine at the 75th position are non-essential residues. The application further comprises a hybridoma cell strain 4B secreting the antibody and an indirect ELISA detection kit comprising the antibody as a detection antibody. The monoclonal antibody is high in specificity and good in sensitivity, and can recognize the sigma C protein in a recombinant expression state and a natural infection state. The monoclonal antibody 4B and the identified linear epitope provided by the application provide important tools and theoretical basis for serological detection of type I avian reovirus, antigen drift monitoring, vaccine research and development and virus protein function research.

Description

Technical Field

[0001] This invention belongs to the fields of veterinary biotechnology and immunology, and particularly relates to a monoclonal antibody against avian reovirus σC protein, its epitope, and its application. Background Technology

[0002] Avian reovirus (ARV) is one of the important pathogens affecting poultry farming. According to the latest classification by the International Committee on Taxonomy of Viruses, ARV belongs to the family Spikereoviridae and the genus Orthoreovirus. ARV is a non-enveloped, double-capsidd virus. Its genome consists of 10 double-stranded RNA segments, divided into three types of genes: L (L1-L3), M (M1-M3), and S (S1-S4), which encode λ, μ, and δ proteins, respectively. The S1 gene segment has polycistronic expression characteristics and can encode the non-structural proteins p10 and p17, as well as the coat protein σC.

[0003] The σC protein has attracted widespread attention due to its location at a critical juncture in viral invasion and immune recognition. Encoded by the open reading frame at the 3′ end of the S1 gene, σC is a small capsid protein / viral adsorption protein of ARV, mediating viral binding to host cell receptors and triggering the invasion process. More importantly, σC is one of the most important neutralizing antigens of ARV, capable of inducing the production of type I specific neutralizing antibodies, and is therefore often considered a core target for ARV antigenic typing, serological detection, and candidate vaccine design. However, σC is also one of the most variable proteins in ARV, and its amino acid differences can directly affect antibody recognition and cross-protective efficacy. Since the σC protein is directly exposed on the surface of viral particles, its antigenic epitopes are the main targets for recognition and attack by the host immune system; therefore, even small changes in the amino acid sequence can cause immune escape, leading to a decrease in the protective efficacy of existing vaccines.

[0004] On the one hand, σC monoclonal antibodies can be used to analyze the antigenic epitope composition of prevalent ARV strains, compare antigenic differences between classic vaccine strains and emerging variants, and serve for virus typing, antigenic drift monitoring, and vaccine compatibility assessment. On the other hand, obtaining highly specific and genotype-biased σC monoclonal antibodies also helps establish antigen capture ELISA, immunofluorescence, Western blot, and rapid on-site detection methods, providing tools to support the early diagnosis and epidemiological surveillance of ARV. Therefore, the preparation, identification, and epitope analysis of ARV σC monoclonal antibodies not only help elucidate the antigenic variation patterns of ARV but also lay the foundation for the development of novel diagnostic agents and precision immunization strategies.

[0005] Although some monoclonal antibodies targeting the σC protein have been reported, research on the antigenic epitopes in the N-terminal region of the σC protein is still insufficient, especially the fine identification of N-terminal linear B-cell epitopes using truncation methods combined with Western blotting. If monoclonal antibodies against the ARV σC protein can be innovatively prepared, and if the presence of novel linear antigenic epitopes in the N-terminus of the σC protein can be identified using truncation methods combined with Western blotting, the fine localization and characterization of these novel epitopes could provide a new perspective for the study of the immunological characteristics of ARV and lay a solid foundation for the development of novel diagnostic tools and vaccine design based on N-terminal epitopes. In particular, if the immunodominant epitopes in the 72-74 amino acid region of the ARV σC protein can be identified experimentally for the first time, it will provide new molecular targets for the precise prevention and control of ARV. Summary of the Invention

[0006] The purpose of this invention is to provide a monoclonal antibody against avian reovirus σC protein, its epitope and application, in order to solve the technical problems in the prior art such as insufficient understanding of the linear epitope of σC protein at the N-terminus, lack of highly specific and genotype-biased detection antibodies.

[0007] To achieve the above objectives, the present invention provides a linear B-cell epitope of the isolated type I avian reovirus σC protein, wherein the core amino acid sequence of the epitope consists of leucine at position 72, aspartic acid at position 73, and aspartic acid at position 74 of the σC protein.

[0008] Furthermore, the amino acid sequence of the epitope is TLDDV at positions 71 to 75, where mutations at threonine at position 71 and valine at position 75 have no significant effect on binding activity and are considered non-essential residues. This epitope is located in the N-terminal region of the σC protein and is a newly discovered and precisely identified immunodominant linear epitope. It is highly conserved across different type I avian reovirus strains, exhibits genotypic bias, and can serve as a core target for avian reovirus immunological detection and vaccine design.

[0009] This invention also provides the application of the above-mentioned linear B-cell epitopes in the preparation of avian reovirus detection reagents or vaccines.

[0010] The present invention also provides a monoclonal antibody that specifically binds to the σC protein of avian reovirus type I, wherein the core amino acid sequence of the epitope specifically recognized by the monoclonal antibody is composed of leucine at position 72, aspartic acid at position 73, and aspartic acid at position 74 of the σC protein.

[0011] In a preferred embodiment, the monoclonal antibody is mouse monoclonal antibody 4B, whose heavy chain is IgG2a subtype and whose light chain is Kappa chain.

[0012] Furthermore, the monoclonal antibody specifically recognizes the epitope amino acid sequence of TLDDV at positions 71 to 75 of the σC protein, wherein mutations at threonine at position 71 and valine at position 75 have no significant effect on binding activity. This monoclonal antibody was obtained by immunizing Balb / c female mice with recombinant ARV σC protein as an immunogen, fusing spleen cells with SP2 / 0 myeloma cells, and then performing subclonal selection. It specifically recognizes the linear B-cell epitope on the σC protein, exhibiting good antigen specificity and sensitivity, and can recognize both recombinantly expressed σC protein and naturally expressed σC protein in virus-infected cells.

[0013] This invention also provides an indirect ELISA detection kit for avian reovirus type I, the kit containing an effective amount of detection antibody, which is the aforementioned monoclonal antibody. This kit exhibits good specificity and sensitivity and can be used for laboratory detection of avian reovirus, virus isolation and identification, strain titer determination, and detection of virus distribution in tissue samples after challenge.

[0014] The present invention also provides the application of the above-mentioned monoclonal antibody in the preparation of immunoassay reagents or kits for detecting type I avian reovirus.

[0015] In a preferred embodiment, the immunoassay reagent or kit is based on enzyme-linked immunosorbent assay (ELISA), Western blotting, or immunofluorescence assay. This application can be widely and effectively used for the detection of avian reovirus, determination of viral load, and evaluation of antibody titer, and has significant application value in avian reovirus vaccine development, determination of viral titer for testing, and evaluation of immunization efficacy.

[0016] The present invention also provides the application of the above-mentioned monoclonal antibody in the identification or testing of compositions containing type I avian reovirus antigen, wherein the compositions are vaccine products or virus cultures.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention is the first to experimentally identify the immunodominant linear epitope in the 72-74 amino acid region of the N-terminus of the ARV σC protein, filling a gap in the study of epitopes in this region and providing a new molecular target for understanding the antigenic structure and variation patterns of the σC protein.

[0018] The monoclonal antibody 4B prepared in this invention exhibits high specificity, good sensitivity, and low background value. It can recognize a linear epitope on the σC protein, and this epitope is highly conserved in type I avian reoviruses (ARVs) and shows genotype bias. It can be effectively applied to the isolation, detection, and virulence titer determination of ARVs. The detection method based on this antibody is characterized by high specificity, accuracy, and sensitivity, and can be widely used for the determination of type I ARV virus content and antibody titer evaluation. It has significant application value in the development of ARV vaccines, the determination of virus titers for testing, and the evaluation of immunization effects. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 The image shows the agarose gel electrophoresis results of the PCR amplification products of the σC gene.

[0021] Figure 2 The image shows the agarose gel electrophoresis results of bacterial culture PCR identification of the pCold-σC recombinant plasmid.

[0022] Figure 3 The image shows the results of screening positive transformants for Rosetta(DE3) competent cells transformed with the pCold-σC recombinant plasmid.

[0023] Figure 4 The image shows the SDS-PAGE analysis results of σC recombinant protein induced expression.

[0024] Figure 5 The image shows the SDS-PAGE analysis results of the purified σC recombinant protein.

[0025] Figure 6 The image shows the Western blot results of the purified σC recombinant protein.

[0026] Figure 7 The image shows the results of indirect ELISA assay of serum titers in immunized mice.

[0027] Figure 8 The image shows the results of indirect ELISA assay for the ascites titer of 4B monoclonal antibody.

[0028] Figure 9 The image shows the results of Western blot identification of the 4B monoclonal antibody.

[0029] Figure 10 The image shows the results of the identification of the monoclonal antibody subtype 4B.

[0030] Figure 11 The image shows the Western blot results of the detection of native σC protein in ARV-infected cells using monoclonal antibody 4B.

[0031] Figure 12 A schematic diagram of the design of the truncated form of the σC protein.

[0032] Figure 13 The image shows the Western blot screening results of the reaction between the truncated σC protein and monoclonal antibody 4B.

[0033] Figure 14 The image shows the results of Western blot screening for further localization of epitopes in the truncated form of the σC protein.

[0034] Figure 15 This is a Western blot result of the reaction between the alanine scanning mutant and monoclonal antibody 4B. Detailed Implementation

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] All raw materials used in this invention are not particularly limited in their source; they can be purchased from the market or prepared using conventional methods known to those skilled in the art.

[0037] There are no particular restrictions on the purity of any of the raw materials used in this invention. However, this invention preferably uses raw materials of analytical grade or purity commonly used in the field of chemical synthesis.

[0038] Unless otherwise stated, the experimental methods used in the following examples were performed in accordance with standard molecular biology and immunology procedures. The technical terms and key reagents used in the examples are explained below.

[0039] The pCold vector mentioned in this invention is a highly efficient fusion protein expression vector widely used in prokaryotic systems. It carries an ampicillin resistance gene and is generally recommended to use Escherichia coli DH5α or TOP10 as the cloning host and Escherichia coli BL21(DE3) or BL21(DE3)pLysS as the expression host.

[0040] Balb / c female mice are standard laboratory animals in the fields of immunology and tumor research. The myeloma cell line derived from them is widely used in cell fusion experiments. This strain has a special susceptibility to mineral oil-induced plasmacytoma and has a significant advantage in plasmacytoma induction efficiency compared with other commonly used inbred strains. As a cell model that can stably secrete a single immunoglobulin, plasmacytoma has irreplaceable value in antibody research.

[0041] SPF-grade laboratory animals are laboratory animals that are further excluded from specific pathogen infection based on clean-grade animals. These animals do not carry potential pathogenic microorganisms that may interfere with experimental results.

[0042] EcoR I restriction endonuclease is the first restriction endonuclease isolated from Escherichia coli strains. It can specifically recognize the GAATTC sequence and cut between the G and A sites to form a DNA fragment with a 5' overhang.

[0043] Sal I restriction endonuclease is obtained through genetic engineering. It can specifically recognize the GTCGAC sequence and generate sticky ends. Because the recognition sequence has a low frequency of occurrence in the genome, it shows a unique advantage in gene mapping studies.

[0044] Indirect immunofluorescence is a detection method based on the principle of antigen-antibody specific reaction. First, a specific antibody binds to the target antigen in the sample. Then, a fluorescently labeled secondary antibody binds to the primary antibody. Finally, the specific fluorescence signal is observed through a fluorescence microscope to detect the antigen or antibody.

[0045] Indirect ELISA is a classic non-competitive binding assay for detecting antibodies. Its basic principle is to immobilize the antigen on a solid-phase carrier, allowing the antibody to bind to it to form a complex, and then add an enzyme-labeled secondary antibody for detection. The qualitative and quantitative analysis of the target antibody is achieved through a colorimetric reaction.

[0046] HRP-goat anti-mouse IgG is a horseradish peroxidase-labeled goat anti-mouse IgG antibody. As a universal reagent in immunochemical detection, it can be prepared by covalently linking HRP to antibody molecules via sodium periodate oxidation.

[0047] FITC 488-labeled goat anti-mouse IgG is a fluorescent secondary antibody suitable for immunofluorescence detection. FITC 488, as a high-performance green fluorescent dye, has advantages such as high brightness, good photostability, and low background interference.

[0048] In ELISA-related reagents, the coating solution is used for antigen dilution. In this invention, a 100 ng / mL recombinant σC protein PBS solution is used and stored at 4°C for later use. The PBST washing buffer consists of 8.0 g NaCl, 0.2 g KCl, 2.9 g Na2HPO4·12H2O, 0.2 g KH2PO4, and 0.5 mL Tween-20, and is diluted to 1000 mL with ultrapure water. The concentration of Tween-20 is recommended to be controlled within the range of 0.05% to 0.2%, as excessively high concentrations may cause the coated antigen to detach, affecting the detection sensitivity. The blocking and diluting solutions are prepared by fully dissolving 5 g of skim milk powder in 100 mL of PBST solution. The PBS buffer was prepared by accurately weighing 8.0 g NaCl, 0.20 g KCl, 1.42 g Na₂HPO₄, and 0.27 g KH₂PO₄, dissolving them in 800 mL of deionized water, adjusting the pH to 7.4 with concentrated hydrochloric acid, and finally bringing the volume to 1 L. After autoclaving, the solution was stored at room temperature. The substrate chromogenic solution consisted of 8 mg OPD powder, 4.86 mL of 0.1 mol / L citric acid solution, 5.14 mL of disodium hydrogen phosphate solution, and 50 μL of 30% hydrogen peroxide. The stop solution was 2 mol / L sulfuric acid solution. The 5% BSA blocking solution was prepared by completely dissolving 5 g bovine serum albumin in PBS buffer and bringing the volume to 100 mL. After adjusting the pH to 7.4, the solution was filtered through a 0.45 μm filter for sterilization and stored at 4 °C. This solution effectively blocked non-specific binding sites and improved the signal-to-noise ratio in Western blotting, ELISA, and immunohistochemistry experiments.

[0049] In cell culture and fusion-related materials, SP2 / 0 cells, a mouse myeloma cell line, are a standard fusion partner in the preparation of monoclonal antibodies. By fusing immunized mouse spleen cells with these cells, hybridoma cells with both antibody secretion capacity and unlimited proliferation characteristics can be obtained. Feeder cells are helper cells added during cell culture to promote the growth and reproduction of low-density cells. They play an important role in the survival and proliferation of hybridoma cells during cell fusion and monoclonal screening.

[0050] HAT selective medium is prepared by mixing 98 mL of complete DMEM medium with 2 mL of 50×HAT stock solution. In this selective system, unfused myeloma cells die due to the blockade of DNA de novo synthesis by aminopterin and the lack of HGPRT enzyme. Although unfused B lymphocytes have HGPRT enzyme, their in vitro survival ability is limited. Only hybridoma cells can inherit the advantages of both and grow selectively in HAT medium.

[0051] The basic formulation of incomplete DMEM medium is as follows: 134 g of DMEM powder is dissolved in 10,000 mL of ultrapure water, and 1.6 million units of sodium penicillin, 1 million units of streptomycin sulfate, 960,000 units of gentamicin sulfate, and 37 g of NaHCO3 are added. The pH is adjusted to 6.8-7.0 with 1 mol / L HCl, and after filtration and sterilization, it is aliquoted and stored. Complete DMEM medium is prepared by adding 10% fetal bovine serum, 1% L-glutamine solution, 0.1 mL of insulin (20 U / mL), 0.5 mL of sodium pyruvate (100 mmol / L), and 0.025 mL of 2-mercaptoethanol to the incomplete DMEM medium. If high-quality serum is used, the latter three components can be omitted as appropriate.

[0052] HT culture medium is RPMI-1640 medium supplemented with 2% HT, 10% fetal bovine serum, and 1% penicillin-streptomycin solution. Limiting dilution is a standard technique for monoclonal cell screening. The specific procedure involves counting the cells to be cloned, then serially diluting them with HT culture medium to an appropriate concentration. 0.1 mL is seeded into each well of a 96-well plate to ensure the theoretical seeding density reaches a single-cell level. After culturing for 7-10 days, positive wells with single-clonal growth are screened. This process is repeated 3-5 times until a 100% positive monoclonal cell line is obtained.

[0053] Example 1 This embodiment details the preparation, identification, and precise localization of the antigenic epitope of the monoclonal antibody against type I avian reovirus σC protein.

[0054] 1. Construction of ARV S1133σC recombinant expression plasmid and protein purification Specific primers containing EcoRI and SalI restriction sites were designed based on the ARV σC gene sequence. The upstream primer σCF was: GCGAATTCATGGCGGGTCTCAATCCAT, and the downstream primer σCR was: GCGTCGACTTAGGTGTCGATGCCGGTACG. Using the cDNA obtained from reverse transcription as a template, the σC gene fragment was amplified by PCR. The amplification results were detected by agarose gel electrophoresis, and specific bands were visible (see...). Figure 1 Subsequently, the recovered σC gene fragment and pCold plasmid were double-digested using the rapid digestive enzymes EcoRI and SalI, respectively, and the digestion products were purified and recovered. The digested target fragment and vector were ligated overnight at 16°C using T4 DNA ligase. The next day, the ligation product was transformed into E. coli DH5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C. Single colonies were then picked for colony PCR identification. Positive clones yielded amplification products of the expected size (see...). Figure 2The positive bacterial culture was sent to a sequencing company for sequencing. Sequencing and sequence alignment results further confirmed that the inserted fragment sequence was consistent with the ARV σC gene reference sequence in the NCBI database, indicating that the pCold-σC recombinant plasmid had been successfully constructed.

[0055] The pCold-σC recombinant plasmid was transformed into E. coli Rosetta (DE3) competent cells, and positive transformants were picked after plating (see [link to article]). Figure 3 After IPTG induction, bacterial cells were collected for SDS-PAGE analysis. The results showed that the recombinant σC protein was mainly expressed in inclusion body form, with a molecular weight of approximately 36 kDa, consistent with the theoretical size. Subsequent steps included washing, dissolving, purifying, and dialysis refolding of the inclusion bodies to obtain purified recombinant σC protein, which showed a single band in SDS-PAGE analysis (see [link to SDS-PAGE analysis]). Figure 4 and Figure 5 The purified protein was identified by Western blot, confirming the successful acquisition of the pCold-σC recombinant protein, which was specifically recognized by the anti-His tag antibody (see [link to article]). Figure 6 ).

[0056] 2. Preparation and characterization of monoclonal antibodies against avian reovirus σC protein 2.1 Immunizing mice SPF-grade BALB / c mice were immunized with purified σC protein. The initial immunization dose was 400 μg per mouse, administered subcutaneously at multiple sites after thorough emulsification of the σC protein with an equal volume of Freund's complete adjuvant. A second immunization was administered 14 days after the initial immunization, with each mouse injected with 200 μg of σC protein, emulsified with Freund's incomplete adjuvant. A third immunization was administered 10 days later, following the same procedure as the second immunization. Blood samples were collected 10 days after the third immunization, and serum titers were determined using an indirect ELISA method. Mice with the highest serum titers were selected for a pulse immunization (serum titer results are shown in [link to results]). Figure 7 The shock immunization involved intraperitoneal injection of 200 μg of unadjuvanted σC protein.

[0057] 2.2 Cell Fusion Three days after the initial immunization, cell fusion experiments were performed. First, feeder cells were prepared: Approximately 6-week-old SPF-grade female BALB / c mice were sacrificed after collecting negative serum. The mice were then surface-sterilized by immersing in 75% ethanol for 30 min. Subsequently, the spleen was dissected under aseptic conditions, and excess connective tissue was removed. The spleen was placed in a cell strainer, and an appropriate amount of incomplete DMEM medium was added for gentle grinding to prepare a spleen cell suspension. Grinding was repeated until the spleen tissue was essentially white. The cell suspension was collected and washed three times with incomplete medium, centrifuged at 1000 rpm for 10 min each time. After discarding the supernatant, the cells were resuspended in complete medium and seeded into 96-well cell culture plates as feeder cells, and cultured at 37°C in a 5% CO2 incubator for later use.

[0058] Preparation of immune spleen cells: Selected mice were anesthetized after a pulse immunization, and blood was collected from behind the orbit to obtain positive serum. After blood collection, the mice were euthanized, and the spleens were separated under aseptic conditions. Spleen cell suspensions were prepared by grinding the cells as described above.

[0059] Cell fusion procedure: Spleen cells and SP2 / 0 cells were washed three times with incomplete culture medium, centrifuged at 1000 rpm for 10 min each time, and the supernatant was discarded. Then, spleen cells and SP2 / 0 cells were mixed at a 5:1 ratio, washed again, and centrifuged to remove as much supernatant as possible. The centrifuge tubes were gently tapped to evenly disperse the cells on the tube walls. The centrifuge tubes containing cells were placed in a 37°C water bath. Over 1 min, 1 mL of preheated PEG 4000 (37°C) was slowly added dropwise, while gently agitating the tubes to promote cell fusion, followed by incubation for 1 min. Then, over 2 min, 10 mL of preheated DMEM medium containing 10% ZETA serum was slowly added to terminate the fusion reaction. After incubation for 10 min, the cells were centrifuged at 1000 rpm for 10 min. The supernatant was discarded, and the cells were gently resuspended in 3 mL of selection medium.

[0060] 2.3 Screening of positive hybridoma cells The selection medium was DMEM containing 15% ZETA serum, 5% growth factors, 1% penicillin-streptomycin, and 2% HAT. Resuspended fusion cells were slowly added to a culture dish containing the selection medium and mixed thoroughly. Then, 100 μL of the mixture was seeded into pre-prepared feeder cell culture plates and incubated at 37°C in a 5% CO2 incubator. Movement was minimized for days 1-2. From day 3 onwards, hybridoma cell colony formation was observed regularly. On day 4, the culture medium was changed, discarding 100 μL of the old medium and adding an equal volume of fresh HAT selection medium. The culture medium was continuously changed over the next few days. When cell colonies had grown to approximately one-third of the bottom area of ​​the well and the medium began to turn yellow, the supernatant was collected. Antibody secretion was detected by indirect ELISA, and positive wells were selected for subcloning screening.

[0061] 2.4 Subclonal screening of positive hybridoma cells Subclonal screening was performed using the limiting dilution method. Feeder cell layers were prepared in advance, and the density was adjusted to 1 × 10⁻⁶. 6 Cells were gently dispersed by pipetting from the positive wells, counted, and then diluted with HT medium to a gradient concentration of 1, 2, 5, and 10 cells per 100 μL. These cells were then seeded into 96-well plates and cultured at 37°C with 5% CO2. When the cell clones reached 1 / 3 to 1 / 2 of the well area (usually 7-9 days post-seeding), the cell supernatant was collected and antibody secretion was detected using an indirect ELISA. Positive monoclonal clones that continuously secreted antibodies were selected for subclonal culture; this process was repeated once. The resulting hybridoma cell line, named 4B, stably secreted monoclonal antibodies against ARV σC protein.

[0062] 2.5 Preparation of Monoclonal Antibodies 8-10 week old BALB / c mice were selected, and each mouse was injected intraperitoneally with 400 μL of ascites adjuvant. 15 days later, hybridoma cell line 4B, which was in the logarithmic growth phase, was washed with serum-free culture medium, and approximately 1 × 10⁻⁶ cells were injected intraperitoneally into each mouse. 6 Cells. After injection, observe abdominal signs in mice daily. After 10-15 days, when the mice's abdomens are significantly distended and exhibit typical ascites symptoms, collect ascites fluid by abdominal puncture with a syringe. Centrifuge the collected ascites fluid at 4°C and 12000 rpm for 10 minutes, and collect the clear supernatant. Antibody titer is determined using an indirect ELISA method (results are shown in [link to results]). Figure 8 ), qualified samples were repackaged and frozen at -80℃ for later use.

[0063] 2.6 Detection and Identification of Ascites Monoclonal Antibody of Strain 4B 2.6.1 Specificity assay of monoclonal antibody 4B The specificity of monoclonal antibody 4B was detected by Western blot. The specific method was as follows: LMH cells were transfected with the constructed recombinant plasmid myc-ARV-σC for 24 hours. Cells were then harvested and lysed at 4°C for 10 min using RIPA lysis buffer containing 1× protease inhibitor and phosphatase inhibitor. The supernatant was collected by centrifugation, and 5× SDS-PAGE loading buffer was added. The cells were then denatured by incubation at 95°C for 10 min. An untransfected cell control was also included. After separation by SDS-PAGE electrophoresis, the samples were semi-dry transferred to an NC membrane under constant current of 0.35 A for 35 minutes. The transferred membrane was washed with PBST and blocked at room temperature for 1 hour in blocking buffer containing 5% skim milk. Monoclonal antibody 4B ascites fluid was diluted 1:10000 with blocking buffer as the primary antibody and incubated overnight at 4°C on a shaker. The following day, the sample was washed three times with PBST for 10 minutes each time, and then incubated at room temperature for 1 hour with HRP-labeled goat anti-mouse secondary antibody (1:10000 dilution). After washing, the sample was developed with ECL chemiluminescent substrate and exposed in a chemiluminescent imaging system.

[0064] Western blotting results confirmed that both the purified recombinant σC protein and the transfected σC protein could be specifically recognized by monoclonal antibody 4B, indicating that the prepared monoclonal antibody has good antigen specificity and can be used for subsequent experiments (see...). Figure 9 ).

[0065] 2.6.2 Identification of Monoclonal Antibody 4B Ig Type Subtype identification of monoclonal antibody 4B was performed according to the instructions of the mouse antibody subtype identification kit from Bio-Long Technology Co., Ltd. σC protein was diluted to 5 μg / mL with PBS, and 100 μL was coated onto each well of an ELISA plate. The plate was incubated overnight at 4°C. The coating solution was discarded, and the plate was washed twice with PBST. 100 μL of 5% skim milk powder solution was added to each well, and the plate was blocked at 37°C for 2-3 hours. The blocking solution was discarded, and the plate was washed three times with PBST. The ascites fluid of the monoclonal antibody to be tested was diluted 1:1000 with PBST, and 100 μL was added to each well. The plate was incubated at 37°C for 1 hour. After washing, 100 μL of each of the eight HRP-labeled secondary antibodies provided in the kit was added to two wells, and the plate was incubated at 37°C for 30 minutes. After washing, TMB chromogenic buffer was added, and the plate was incubated at 37°C in the dark for 20 minutes. Finally, stop solution was added, and the OD values ​​were read using an ELISA reader. 450 nm value. The positive criterion is OD. 450 The nm value is greater than 0.8 and higher than the negative control OD. 450 nm value +0.15; negative criterion is OD 450 The nm value is less than 0.15 (less than 0.05 is calculated as 0.05).

[0066] The identification results showed that the heavy chain of the 4B monoclonal antibody was IgG2a subtype, and the light chain was a Kappa chain (see...). Figure 10 ).

[0067] 2.6.3 Detection of virus-infected cells using monoclonal antibody 4B To verify whether monoclonal antibody 4B could recognize native viral proteins, a Western blot assay was performed on virus-infected cells. LMH cells were seeded in 12-well plates. When the cells reached approximately 90% confluence, the old culture medium was discarded, and the cells were gently washed twice with sterile PBS. ARV S1133 virus solution was diluted with serum-free medium and added to each well. The cell culture plates were incubated at 37°C in a 5% CO2 incubator for 1–2 hours, with gentle shaking once during this period. After adsorption, the virus solution was discarded, and the cells were washed twice with PBS to remove unadsorbed virus. The medium was replaced with 2% serum, and the cells were cultured for approximately 12 hours. Cells were then collected and Western blot analysis was performed using monoclonal antibody 4B as the primary antibody.

[0068] The results showed that the 4B monoclonal antibody could effectively detect avian reovirus σC protein in infected cells, demonstrating its ability to recognize natural antigens (see [link to study]. Figure 11 ).

[0069] 2.6.4 Identification of the antigenic epitope recognized by monoclonal antibody 4B To identify the recognition epitope of monoclonal antibody 4B in ARV σC protein, a combination of truncated expression and point mutation was used for epitope localization.

[0070] First, eukaryotic mutant plasmids of the σC protein were constructed. Different truncated fragments of the σC gene were cloned into the EcoRI-linearized pCMV-Myc-N vector using homologous recombination reagent to construct Myc tag fusion expression plasmids. The σC protein was initially divided into two overlapping fragments: Myc-σC-N (1–200 aa) and Myc-σC-C (101–327 aa). Subsequently, the N-terminal region was further truncated into three fragments with a 50 aa overlap region: Myc-σC-NA (1–100 aa), Myc-σC-NB (51–150 aa), and Myc-σC-NC (101–200 aa). Based on the preliminary reaction results, the candidate epitope region was further localized to 51–100 aa, and a series of truncated mutants (F1–F9) with adjacent fragments differing by 5 amino acids were constructed. The specific sequences are shown in Table 1. The core epitope was ultimately confined to a 5-amino acid region, and single-point mutation analysis was performed on each amino acid within this region. The primer sequences used are detailed in Table 1. All recombinant plasmids were transfected into 293T cells. 24 h after transfection, cell lysate supernatants were collected, and Western blot was used to detect the expression products and their reactivity with the 4B monoclonal antibody. Simultaneously, anti-Myc tag antibody was used to monitor expression levels.

[0071] Table 1 Primer sequences used for constructing σC protein and its mutants Epitope identification experiments were conducted using a progressively more precise strategy. First, the epitope identified by monoclonal antibody 4B was determined using a σC truncated plasmid to be located in the N-terminal 71-75 aa region (see schematic diagram of the truncated plasmid design). Figure 12 Representative response results are shown in Figure 13 and 14 Based on this, single-point alanine scanning mutations were performed on amino acids 71-75, constructing T71A, L72A, D73A, D74A, and V75A mutants. Western blot results showed that the mutations in L72A, D73A, and D74A completely lost their reactivity with monoclonal antibody 4B, while the other mutants could still bind (see...). Figure 15 Therefore, it was determined that the core sequence of the linear B-cell epitope recognized by monoclonal antibody 4B is leucine at position 72 (L72), aspartic acid at position 73 (D73), and aspartic acid at position 74 (D74). The complete linear amino acid sequence containing this epitope is as follows: 71 TLDDV 75 (Among them, the mutations at position 71 (threonine T71) and position 75 (valine V75) have no significant effect on binding activity and are non-essential residues).

[0072] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A linear B-cell epitope of isolated type I avian reovirus σC protein, characterized in that, The core amino acid sequence of the epitope consists of leucine at position 72, aspartic acid at position 73, and aspartic acid at position 74 of the σC protein.

2. The linear B-cell epitope according to claim 1, characterized in that, The amino acid sequence of the epitope is TLDDV at positions 71 to 75 of the σC protein. Mutations at threonine at position 71 and valine at position 75 have no significant effect on binding activity and are non-essential residues.

3. The use of the linear B-cell epitope as described in claim 1 or 2 in the preparation of avian reovirus detection reagents or vaccines.

4. A monoclonal antibody that specifically binds to the σC protein of avian reovirus type I, characterized in that, The core amino acid sequence of the epitope specifically recognized by the monoclonal antibody consists of leucine at position 72, aspartic acid at position 73, and aspartic acid at position 74 of the σC protein.

5. The monoclonal antibody according to claim 4, characterized in that, The monoclonal antibody is mouse monoclonal antibody 4B, whose heavy chain is the IgG2a subtype and whose light chain is the Kappa chain.

6. The monoclonal antibody according to claim 4, characterized in that, The monoclonal antibody specifically recognizes the epitope amino acid sequence TLDDV at positions 71 to 75 of the σC protein, wherein mutations at threonine at position 71 and valine at position 75 have no significant effect on binding activity.

7. An indirect ELISA detection kit for detecting avian reovirus type I, characterized in that, The kit contains an effective amount of detection antibody, which is a monoclonal antibody as described in any one of claims 4 to 6.

8. The use of the monoclonal antibody according to any one of claims 4 to 6 in the preparation of an immunoassay reagent or kit for detecting type I avian reovirus.

9. The application according to claim 8, characterized in that, The immunoassay reagents or kits are based on enzyme-linked immunosorbent assay (ELISA), Western blotting, or immunofluorescence assay for detection.

10. The use of the monoclonal antibody according to any one of claims 4 to 6 in identifying or testing a composition containing type I avian reovirus antigen, wherein the composition is a vaccine product or a virus culture.

Images