A mitochondrial localization signal peptide, a high-squalene schizochytrium engineering bacteria, a method and an application

Abstract

The application belongs to the technical field of bioengineering and synthetic biology, and discloses a mitochondrion positioning signal peptide, a high-squalene Schizochytrium engineering bacterium, a method and application. The Schizochytrium engineering bacterium is obtained by introducing the MVA pathway into the mitochondrion through the mitochondrion positioning signal peptide, reducing the toxic accumulation of intermediate metabolites in the cytoplasm, reducing the loss of FPP to the competitive metabolic pathway, and improving the squalene synthesis flux. The application can improve the biomass and oil content of the engineering strain, and improve the overall fermentation performance. The strategy has good universality, and can be applied to the biosynthesis of other terpene compounds.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering and synthetic biology, and in particular to a mitochondrial localization signal peptide, a high-squalene-producing Schizochytrium engineered strain, method and application. Background Technology

[0002] Squalene (C 30 H 50 Squalene is an important natural acyclic triterpenoid compound, widely used in food, cosmetics, pharmaceuticals, health products, and personal care products due to its various biological activities, including antioxidant, anti-inflammatory, and potential anticancer properties. Therefore, developing green, safe, and sustainable microbial production systems has become a crucial direction for squalene research and industrial application.

[0003] Schizochytrium ( Schizochytrium Schizochytrium sp. is a type of FDA-approved oil-producing marine fungus with advantages such as high oil content, abundant supply of acetyl-CoA and NADPH, and naturally possessing the complete mevalonic acid (MVA) pathway. These advantages provide a solid foundation for the efficient biosynthesis and storage of squalene, demonstrating its great potential as a chassis strain for industrial squalene production. However, current research on squalene production by Schizochytrium sp. mainly focuses on optimizing fermentation conditions, while systemic regulation strategies based on metabolic engineering remain relatively limited. Therefore, the squalene yield still falls far short of the requirements for industrial applications.

[0004] Since the Microbial Aqueous Activated Metabolic Pathway (MVA) for terpene biosynthesis in Schizochytrium is located within the cytoplasm, most previous research has focused on metabolic regulation strategies through cytoplasmic engineering. However, increasing the production capacity of most terpenes, including squalene, is challenging due to the production of intermediate small molecules (such as IPP, DMAPP, and FPP) in the MVA pathway, which are toxic to Schizochytrium cells and inhibit cell growth. Besides cytoplasmic engineering, organelle engineering, with its highly specialized subcellular organelles, offers unique advantages such as abundant precursor and cofactor supply, metabolic pathway separation, and adaptive physiological and biochemical environments that promote enzyme and product storage. Organelle engineering is also accepted as another efficient method for microbial terpene biosynthesis.

[0005] As a multifunctional subcellular organelle in eukaryotic cells, mitochondria are the host for the TCA cycle, oxidative phosphorylation, amino acid and lipid metabolism, and heme synthesis. As the primary site of energy supply, mitochondria possess the following advantages: acetyl-CoA concentration approximately 20-30 times higher than in the cytoplasm; high redox potential; abundant ATP; sufficient redox cofactors; and compact space for concentrating substrates, enzymes, intermediates, and cofactors to accelerate enzymatic reactions. Since the MVA pathway for terpene biosynthesis in Schizochytrium is located in the cytoplasm, most previous research has focused on metabolic regulation strategies through cytoplasmic engineering. However, enhancing the production of most terpenes, including squalene, is challenging because the MVA pathway generates some intermediate small molecules (such as IPP, DMAPP, and FPP) that are toxic to Schizochytrium cells and inhibit cell growth. When the squalene synthesis pathway is located in the mitochondria, it can act as a partial barrier to the transfer of FPP from the mitochondria to the cytoplasm, minimizing the loss of FPP through competitive pathways and thus increasing squalene production. Reports indicate that introducing a portion of the MVA pathway into mitochondria can significantly promote the growth of *Saccharomyces cerevisiae* and increase mevalonic acid synthesis in the cytoplasm. Through a two-stage fermentation process, squalene production reached 21.10 g / L. Therefore, a combined strategy of cytoplasmic and mitochondrial engineering can be used to improve squalene production in *Schizochytrium*, providing new insights into the production of other terpenes.

[0006] Mitochondrial localization signal peptides have not been reported in the production of squalene by Schizochytrium. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of the prior art and provide a mitochondrial localization signal peptide, a high-squalene-producing Schizochytrium engineered strain, a method, and an application.

[0008] The technical solution adopted by this invention to solve its technical problem is: A mitochondrial localization signal peptide derived from a mitochondrial protein of Schizochytrium, wherein the signal peptide is located at the N-terminus of the protein and can be recognized by the mitochondrial transport system within Schizochytrium cells, and accurately introduces the target protein expressed therein into the mitochondria.

[0009] Furthermore, the mitochondrial localization signal peptide is the mitochondrial localization signal peptide of A3507, the sequence of which is SEQ ID NO.2.

[0010] The application of the mitochondrial localization signaling peptide as described above in the production of squalene.

[0011] A high-squalene-producing Schizochytrium engineered strain containing the mitochondrial localization signal peptide as described above, wherein the Schizochytrium engineered strain introduces the MVA pathway into the mitochondria through the mitochondrial localization signal peptide, thereby reducing the toxic accumulation of intermediate metabolites in the cytoplasm, reducing the loss of FPP to competing metabolic pathways, and increasing the squalene synthesis flux.

[0012] The method for constructing the high-squalene-producing Schizochytrium engineered strain as described above includes the following steps: (1) Construction of mitochondrial-targeting expression elements The mitochondrial localization signal peptide was fused with a key downstream enzyme gene of the MVA pathway and expressed. The mitochondrial localization signal peptide was fused with the N-terminus of the key enzyme to construct a mitochondrial-targeting recombinant plasmid, which was then placed under the regulation of a promoter recognizable by Schizochytrium to obtain the mitochondrial-targeting recombinant plasmid. (2) Construction of engineered strains The mitochondrial-targeting recombinant plasmid was randomly integrated into the genome of wild-type Schizochytrium using Agrobacterium-mediated transformation to obtain engineered Schizochytrium strains.

[0013] Furthermore, the key enzymes in step (1) include farnesyl pyrophosphate synthase (FPPS) and squalene synthase (SQS); the nucleotide sequence of farnesyl pyrophosphate synthase (FPPS) is shown in SEQ ID NO.4, and the nucleotide sequence of squalene synthase (SQS) is shown in SEQ ID NO.5. Alternatively, the promoter may be P2902.

[0014] Furthermore, in step (2), the wild-type Schizochytrium is Schizochytrium. Schizochytrium sp . HX-308, its accession number is CCTCC No. M209059.

[0015] The application of the high-squalene-producing Schizochytrium engineered strains described above in the fermentation production of squalene.

[0016] The method for producing squalene by fermentation using the engineered strain of Schizochytrium, which produces high levels of squalene as described above, includes the following steps: The third-generation seed culture of the high-squalene-producing Schizochytrium engineered strain was inoculated into the fermentation medium at a volume percentage of 5% and cultured at 30°C and 180 r / min for 120 h with shaking. Alternatively, the third-generation seed culture of the engineered strain of Schizochytrium, which produces high levels of squalene, can be inoculated into a fermenter containing fermentation medium at an inoculation rate of 10% by volume, and fermented for another 120 h at 30 °C and 300 rpm with stirring.

[0017] Furthermore, the cultivation method for the third-generation seed solution is as follows: A single colony of *Schizochytrium*, a high-squalene-producing engineered bacterium, was picked from solid culture medium using a sterile pipette tip and inoculated into a test tube containing 2 mL of seed culture medium. The colony was incubated at 30 °C and 180 rpm for 48 h to obtain the first-generation seed culture. 1 ml of the first-generation seed culture was then inoculated into a conical flask containing 50 ml of seed culture medium and incubated at 30 °C and 180 rpm for 48 h to obtain the second-generation seed culture. 1 ml of the second-generation seed culture was then inoculated into a conical flask containing 50 ml of seed culture medium and incubated at 30 °C and 180 rpm for 48 h to obtain the third-generation seed culture. Each generation was examined under a microscope to ensure it was free of contamination. The solid culture medium is formulated as follows: 7 g / L peptone, 7 g / L yeast extract, 60 g / L glucose, 15 g / L sea salt, 3% agar powder, 5% glycerol, with the remainder being pure water, and the pH adjusted to 6.0-6.5; all percentages mentioned above are mass percentages. The seed culture medium formula is as follows: glucose 60 g / L, sodium chloride 15 g / L, yeast powder 4 g / L, peptone 8 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 2 g / L, monosodium glutamate 15 g / L, glycerol 10 g / L, 0.2% vitamin B1, 0.2% vitamin B6, 0.2% vitamin B12, with the balance being pure water, adjusted to pH 6.0-6.5; all percentages mentioned above are mass percentages. Alternatively, the fermentation medium can be formulated as follows: glucose 100 g / L, sodium chloride 20 g / L, yeast extract 8 g / L, peptone 8 g / L, magnesium sulfate heptahydrate 1 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, calcium chloride 0.5 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 2 g / L, glycerol 10 g / L, 0.2% vitamin B1, 0.2% vitamin B6, 0.2% vitamin B12, with the remainder being pure water, adjusted to pH 6.0-6.5; all percentages are by mass.

[0018] The advantages and positive effects of this invention are as follows: 1. The engineered strain of this invention introduces the MVA pathway into mitochondria through a mitochondrial localization signal peptide, which can reduce the toxic accumulation of intermediate metabolites such as IPP, DMAPP and FPP in the cytoplasm, thereby reducing the loss of FPP to competing metabolic pathways and increasing the squalene synthesis flux.

[0019] 2. The engineered strain of this invention can significantly increase the squalene yield in Schizochytrium, with the squalene yield of the engineered strain reaching more than 2.96 times that of the wild-type strain.

[0020] 3. This invention can improve the biomass and lipid content of engineered strains, thereby enhancing overall fermentation performance. The strategy of this invention has good versatility and can be extended to the biosynthesis of other terpenoid compounds.

[0021] 4. This invention provides a method for the application of a mitochondrial localization signal peptide in the efficient production of squalene by Schizochytrium. By directing key downstream enzymes of the MVA pathway into the mitochondria, the accumulation of toxic intermediate metabolites (such as IPP, DMAPP, and FPP) in the cytoplasm is reduced, thereby: (1) Enhance the ability of Schizochytrium to synthesize squalene; (2) To mitigate the adverse effects of the high-throughput MVA pathway on cell growth; (3) Increase the biomass and lipid synthesis level of the strain. (4) To provide new engineering strategies for the efficient production of terpenoids from Schizochytrium and other eukaryotic microorganisms.

[0022] 5. This invention enables the reconstruction of the mevalonate (MVA) pathway in Schizochytrium, achieving the application of efficient biosynthesis of squalene. Attached Figure Description

[0023] Figure 1 The images show the plasmid pZPK-A0287EGFP-G418 and plasmid pZPK-A3507EGFP-G418 in this invention. Figure 2 The plasmid pZPK- in this invention FPPS -G418 and plasmid pZPK- SQS -Nourse map; Figure 3 The plasmid pZPK-A3507- in this invention FPPS -G418 and plasmid pZPK-A3507- SQS -Nourse map; Figure 4 This is a comparison of the unit fluorescence intensity of the wild-type strain and the engineered strains SQ-12 and SQ-11 in this invention; Figure 5 A diagram showing changes in mitochondria in an engineered strain, observed using a laser confocal microscope. Figure 6 This is a graph showing the squalene yields of wild-type, engineered strain SQ-9, and engineered strain SQ-10 in this invention. Figure 7 This is a graph showing the oil yield and biomass of the wild-type, engineered strain SQ-9, and engineered strain SQ-10 in this invention; Figure 8 This is a graph showing the squalene production of wild-type and engineered bacteria in a 5 L fermenter in this invention.

[0024] Schizochytrium in this invention Schizochytrium sp. HX-308 is a strain in the prior art, which has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC No. M209059, as disclosed in Chinese patent publication CN116478835A. It is currently stored at -80 ℃ in 50% (v / v) glycerol. Detailed Implementation

[0025] The present invention will be further described below with reference to the embodiments. The embodiments described below are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.

[0026] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.

[0027] This invention mainly includes the following aspects: 1. Screening and identification of mitochondrial localization signal peptides A mitochondrial localization signal peptide derived from a Schizochytrium mitochondrial protein, located at the N-terminus of the protein, is recognized by the mitochondrial transport system within Schizochytrium cells, accurately introducing the target protein expressed in fusion into the mitochondria. First, two candidate mitochondrial localization signal peptides were predicted using the SignalP 6.0 model. Then, these signal peptides were fused with enhanced green fluorescent protein (EGFP) at the N-terminus to construct expression vectors. The recombinant vectors were introduced into wild-type Schizochytrium strains using Agrobacterium-mediated transformation to obtain engineered strains. The mitochondrial localization ability of the signal peptides was verified using fluorescence microscopy and confocal scanning laser microscopy, combined with the mitochondrial-specific dye MitoTracker Red CMXRos. The mitochondrial localization signal peptide, designated A3507 (nucleotide sequence SEQ ID NO. 2), was confirmed to accurately locate the target protein within the mitochondria of Schizochytrium.

[0028] 2. Construction of mitochondrial-targeting expression elements The A3507 mitochondrial localization signal peptide is fused with a key downstream enzyme gene of the MVA pathway for expression. Preferably, the key enzyme includes, but is not limited to, farnesyl pyrophosphate synthase (FPPS) and squalene synthase (SQS). The mitochondrial localization signal peptide is fused to the N-terminus of the key enzyme to construct a mitochondrial-targeting recombinant plasmid, which is then regulated by a promoter recognizable by Schizochytrium.

[0029] 3. Construction of engineered strains The mitochondrial-targeting recombinant plasmid was randomly integrated into the genome of wild-type *Schizochytrium* using Agrobacterium-mediated transformation to obtain a mitochondrial engineered bacterium named SQ-10. As a control, a recombinant plasmid without mitochondrial localization signal peptides, expressing only FPPS and SQS in the cytoplasm, was constructed and randomly integrated into the genome of wild-type *Schizochytrium* using Agrobacterium-mediated transformation to obtain a cytoplasmic engineered bacterium named SQ-9. Preferably, the wild-type strain is *Schizochytrium* (…). Schizochytrium sp . HX-308 was previously isolated in our laboratory. This strain is currently deposited at the China Center for Type Culture Collection (CCTCC) under accession number M209059, and is stored at -80 °C in 50% (v / v, volume percentage) glycerol.

[0030] 4. Fermentation culture and squalene production Seed culture: Engineered Schizochytrium strains SQ-9 and SQ-10 and wild-type Schizochytrium were inoculated into 50 ml of seed culture medium to obtain first-generation seeds. 1 ml of the first-generation seeds was then inoculated into 50 ml of seed culture medium to obtain second-generation seeds. 1 ml of the second-generation seeds was then inoculated into 50 ml of seed culture medium to obtain third-generation seeds. Each generation was examined under a microscope to ensure it was free of contamination. Finally, after confirming no contamination, the cultured seed culture was inoculated into fermentation medium for subsequent fermentation.

[0031] Fermentation broth culture: Take 5 ml of third-generation seed liquid and inoculate it into 100 ml of fermentation medium. During the culture, take samples every 24 hours to measure sugar and supplement sugar. After 120 hours of fermentation, record the total sugar consumption and collect the cells to extract oil.

[0032] The culture conditions are 30 ℃ and shaking culture at 180 r / min.

[0033] Furthermore, the method for collecting bacterial cells to extract lipids includes: 1) After the fermentation culture is completed, add 1 M NaOH solution to adjust the pH to about 12, add 0.01-0.1% cell wall breaking enzyme, and shake at 40~60 ℃ and 150 r / min for 10 h; 2) Cool to room temperature and add an equal volume of anhydrous ethanol to the fermentation broth to inactivate the cell wall-breaking enzyme; 3) Add an equal volume of n-hexane to the fermentation broth for extraction, collect the upper organic phase, and repeat the above operation 3-4 times until the supernatant is clear; 4) Pour the organic phase into a rotary evaporator flask and place it on a rotary evaporator at 55 °C and 25 r / min to evaporate the solvent, obtaining the oil. Weigh the oil. The mass of the empty rotary evaporator flask is m1, and the mass of the oil and the rotary evaporator flask after drying is m2. Therefore, the oil content is m = m2 - m1.

[0034] The transformants obtained through transformation are grown on solid culture medium. After plate culture, single colonies are picked and inoculated into seed culture medium for activation. The pH of the plate culture medium is 6.0 to 6.5.

[0035] The solid culture medium is formulated as follows: peptone 7 g / L, yeast extract 7 g / L, glucose 60 g / L, sea salt 15 g / L, agar powder 3%, glycerol 5%, with the remainder being pure water, adjusted to pH 6.0-6.5. All percentages are by mass.

[0036] The seed culture medium formula is as follows: glucose 60 g / L, sodium chloride 15 g / L, yeast extract 4 g / L, peptone 8 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 2 g / L, monosodium glutamate 15 g / L, glycerol 10 g / L, 0.2% vitamin B1, 0.2% vitamin B6, 0.2% vitamin B12, with the balance being pure water, adjusted to pH 6.0-6.5. All percentages are by mass.

[0037] The fermentation medium formula is as follows: glucose 100 g / L, sodium chloride 20 g / L, yeast extract 8 g / L, peptone 8 g / L, magnesium sulfate heptahydrate 1 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, calcium chloride 0.5 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 2 g / L, glycerol 10 g / L, 0.2% vitamin B1, 0.2% vitamin B6, 0.2% vitamin B12, with the balance being pure water, adjusted to pH 6.0-6.5. All percentages are by mass.

[0038] The wild-type strain and the engineered strain were cultured using the fermentation conditions suitable for Schizochytrium. The carbon source supply was controlled by a batch feeding method, which ensured cell growth while achieving efficient accumulation of squalene.

[0039] The culture media used in the following examples are as follows: The solid culture medium formulation is as follows: 7 g / L peptone, 7 g / L yeast extract, 60 g / L glucose, 15 g / L sea salt, 3% agar powder, 5% glycerol, and the balance being pure water, adjusted to pH 6.0-6.5. If screening with G418 antibiotic, add an additional 300 mg / mL cefotaxime sodium and 500 mg / L or 1000 mg / L G418 when pouring the plates. All percentages mentioned above are mass percentages.

[0040] The seed culture medium formula is as follows: glucose 60 g / L, sodium chloride 15 g / L, yeast extract 4 g / L, peptone 8 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 2 g / L, monosodium glutamate 15 g / L, glycerol 10 g / L, 0.2% vitamin B1, 0.2% vitamin B6, 0.2% vitamin B12, with the balance being pure water, adjusted to pH 6.0-6.5. All percentages mentioned above are by mass.

[0041] The fermentation medium formula is as follows: glucose 100 g / L, sodium chloride 20 g / L, yeast extract 8 g / L, peptone 8 g / L, magnesium sulfate heptahydrate 1 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, calcium chloride 0.5 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 2 g / L, glycerol 10 g / L, 0.2% vitamin B1, 0.2% vitamin B6, 0.2% vitamin B12, with the balance being pure water, adjusted to pH 6.0-6.5. All percentages mentioned above are by mass.

[0042] Example 1: Construction of a mitochondrial localization signal peptide expression vector The construction method of plasmid pZPK-A3507EGFP-G418 is the same as that of plasmid pZPK-A0287EGFP-G418. Taking pZPK-A3507EGFP-G418 as an example: using pZPK as the vector plasmid (selected by the marker G418, whose sequence is SEQ ID NO.6), the vector plasmid is first linearized using Hind III restriction endonuclease to serve as the backbone. The EGFP fragment (originally derived from a jellyfish) is obtained using primers EGFP-F / R. Aequorea victoriaAn enhanced variant of the green fluorescent protein (EGFP) is used, the encoding gene of which can be obtained through commercial plasmids or artificial synthesis. The EGFP sequence is SEQ ID NO.1. A heterologous EGFP fragment was ligated to the plasmid backbone via Gibson assembly. This was then transformed into competent DH5α cells of *E. coli*, resulting in multiple transformants. Then, we used validation primers (the validation primers are related to the promoter and terminator; the entire expression cassette is promoter-EGFP-terminator, i.e., P2902-EGFP-CYC1. The validation primers can be located on the promoter preceding EGFP and the terminator following it. PCR validation was performed using the validation primers, and the correctness was determined based on the primer length and gel electrophoresis results). Samples with correctly validated colonies were sent to Sangon Biotech for sequencing. Finally, the correctly sequenced pZPK-EGFP-G418 plasmid was extracted using a plasmid extraction kit for subsequent experiments. A Hind III restriction site was added between promoter P2902 (the same promoter P2902 described in Chinese Patent Publication CN117210341A) and green fluorescent protein EGFP via a loop P (with HindIII-F / R primers). The pZPK-EGFP-G418 plasmid was then cleaved using HindIII restriction enzyme to obtain the plasmid backbone. Next, the A3507 fragment (SEQ ID NO.2) obtained using primers A3507-F / R was ligated to the plasmid backbone using Gibson assembly to obtain plasmid pZPK-A3507EGFP-G418. The above operation was repeated to obtain plasmid pZPK-A0287EGFP-G418. The sequence of the A0287 fragment is SEQ ID NO.3. The constructed plasmid map is shown below. Figure 1 As shown in Table 1, the primers used were transformed using the Agrobacterium-mediated transformation method described in Chinese Patent Publication CN114426985A, integrating the gene into the wild-type Schizochytrium HX 308 genome. Selection was performed using G418 resistance (concentration can be found in Chinese Patent Publication CN120966922A). The engineered strain obtained by introducing plasmid pZPK-A3507EGFP-G418 was SQ-11, and the engineered strain obtained by introducing plasmid pZPK-A0287EGFP-G418 was SQ-12.

[0043] Table 1 Primer sequences

[0044] Example 2: Screening of mitochondrial localization signal peptides Mitochondria, rich in acetyl-CoA, ATP, and various essential cofactors, and capable of confining target metabolic pathways to compact compartments, are a promising subcellular platform for terpene synthesis. Therefore, we investigated a strategy for efficient squalene synthesis using mitochondria from Schizochytrium fungi. To ensure accurate localization of the target protein in mitochondria, we first used the SignalP 6.0 model to predict the signal peptide of known genes, fused the signal peptide with a fluorescent protein, and then verified its localization by monitoring fluorescence values ​​and performing localization staining. Based on this, the discovered signal peptide was labeled to the N-terminus of the gene to target the MVA pathway. FPPS, SQS Genes were introduced into mitochondria to reduce the toxicity of intermediate small molecule products (such as IPP, DMAPP, and FPP) in the MVA pathway to Schizochytrium cells. We first transformed two predicted mitochondrial localization signal peptides (numbered A3507 and A0287, respectively) into wild-type Schizochytrium HX 308 (control group), obtaining engineered strains SQ-11 and SQ-12, respectively. Figure 4 As shown, the fluorescence intensity of engineered bacteria SQ-12 was 7303.61 AU / OD600, which is 8.30 times that of the control group (880.42 AU / OD600); the fluorescence intensity of engineered bacteria SQ-11 was 15687.72 AU / OD600, which is 17.82 times that of the control group (880.42 AU / OD600). Therefore, engineered bacteria SQ-11 has a stronger fluorescence intensity and is better observed using a confocal scanning laser microscope.

[0045] Example 3: Validation of mitochondrial localization signal peptide Next, mitochondrial staining agents combined with confocal scanning laser microscopy (CSLM) will be used to observe whether the A3507 mitochondrial localization signal peptide can truly achieve its localization purpose. Figure 5As shown, staining with mitochondrial dye (MitoTracker Red CMXRos mitochondrial dye, purchased from Thermo Fisher Scientific, staining steps detailed in the kit instructions) revealed a large number of dispersed mitochondria in the engineered strain SQ-11. Similar morphological features were also observed in the corresponding green fluorescent protein (GFP) image. Overlay analysis of the A3507GFP expression image with the Mito Tracker-stained image showed that the fluorescence of the mitochondrial localization signal peptide overlapped with the fluorescence of the staining agent, indicating co-localization. Therefore, it can be concluded that the A3507 localization signal peptide successfully introduced EGFP into the mitochondria. To further demonstrate this, a control was set up: strain HX308::EGFP, expressing only cytoplasmic EGFP (i.e., without adding the signal peptide before the green fluorescent protein, with the rest of the construction method consistent with the previous one). Its fluorescence image showed uniformly diffuse overlapping fluorescence without obvious small, round bright spots. Therefore, this control result indirectly proves the localization function and accuracy of the A3507 signal peptide. Next, the A3507 mitochondrial localization signal peptide was fused to the N-terminus of the MVA downstream pathway gene, thereby introducing the MVA downstream pathway into the mitochondria to reduce the toxicity of intermediate small molecule products in the MVA pathway to Schizochytrium cells, thus achieving efficient production of squalene.

[0046] Example 4: Application of mitochondrial localization signal peptide The validated mitochondrial localization signal peptide was linked to the MVA gene ( FPPS and SQS The plasmid pZPK-A3507- is constructed by fusing the N-terminus of the plasmid. FPPS -G418 and pZPK-A3507 -SQS -Nourse (the sequence of Nourse is SEQ ID NO.7). Both plasmids were constructed in the same way; the following section will use pZPK-A3507- FPPS -G418 is used as an example. Using pZPK as the vector plasmid (selection marker G418), the vector plasmid was first linearized using Hind III restriction endonuclease, serving as backbone 1. *Schizochytrium* was used as the starting point. Schizochytrium Using the genome of sp. HX 308 as a template, PCR was performed using pre-designed primers (see Table 2) to obtain... FPPS Fragment (its sequence is SEQ ID NO.4). Endogenous [materials] are assembled using Gibson [assembly]. SQS The fragment was ligated to plasmid backbone 1. It was then transformed into *E. coli* competent cells DH5α, resulting in multiple transformants. The colonies were then validated by PCR using validation primers. Samples with correctly validated colonies were sent to Sangon Biotech for sequencing. Finally, the correctly sequenced pZPK- FPPS- The G418 plasmid was extracted using a plasmid extraction kit for subsequent experiments (plasmid map shown). Figure 2 (As shown). In promoter P2902 and FPPS HindIII restriction sites are added via a loop P, and pZPK- is then used with HindIII restriction enzymes. FPPS The G418 plasmid was cut to obtain plasmid backbone 2. Then, the obtained A3507 fragment was ligated to plasmid backbone 2 using Gibson assembly to obtain plasmid pZPK-A3507-. FPPS -G418 (plasmid map as shown) Figure 3 (As shown). Next, repeat the above steps to obtain plasmid pZPK-A3507-. SQS- The primers used for Nourse (selection marker: Nourse) are shown in Table 2 below. Transformation was performed using the Agrobacterium-mediated transformation method as described in Chinese Patent Publication CN114426985A, integrating the gene into the Schizochytrium genome. Using wild-type Schizochytrium HX-308 as the substrate strain, pZPK-A3507- FPPS -G418 was transformed into Agrobacterium and integrated into the genome. G418 resistance was used for screening to obtain the engineered strain SQ-8. Then, using SQ-8 as the chassis strain, pZPK-A3507- SQS - Nourse was used for Agrobacterium transformation, allowing the gene to be integrated into the genome of the engineered strain SQ-8. Straining was performed using Nourse resistance to obtain the engineered strain SQ-10. Simultaneously, as a control, plasmid pZPK- was used... FPPS -G418 was integrated into the genome of wild-type Schizochytrium HX-308 using the same Agrobacterium-mediated transformation method. G418 resistance was selected to obtain engineered strain SQ-7. Then, using SQ-7 as the chassis strain, plasmid pZPK- SQS -Nourse (This plasmid construction method is similar to pZPK-) FPPS- (As illustrated above, G418 is consistent with this). Agrobacterium transformation was performed to integrate the gene into the genome of engineered strain SQ-7. Then, the strain SQ-9 was obtained through Nourse resistance screening.

[0047] Table 2 Primer Sequences

[0048] Seed culture: Using a sterile pipette tip, pick a single colony with good growth from the solid culture medium (before seed culture, activate the strain on a plate to obtain single colonies), inoculate it into a test tube containing 2 mL of seed culture medium, and incubate at 30 ℃ and 180 rpm for 48 h to obtain the first generation seed. Take 1 ml of the first generation seed and inoculate it into a conical flask containing 50 ml of seed culture medium, and incubate at 30 ℃ and 180 rpm for 48 h to obtain the second generation seed. Take 1 ml of the second generation seed and inoculate it into a conical flask containing 50 ml of seed culture medium, and incubate at 30 ℃ and 180 rpm for 48 h to obtain the third generation seed. Each generation is examined under a microscope to ensure no contamination. Finally, after confirming no contamination, inoculate the cultured seed culture into the fermentation medium for subsequent fermentation.

[0049] Fermentation broth culture: Take 5 ml of the third-generation seed liquid and inoculate it into an Erlenmeyer flask containing 100 ml of fermentation medium. During the culture, take samples every 24 h to measure sugar and supplement sugar. After fermentation for 120 h, record the total sugar consumption and collect the cells to extract oil.

[0050] The culture conditions are 30 ℃ and shaking culture at 180 r / min.

[0051] The transformants obtained through transformation are grown on a solid culture medium. After plate culture (30℃, 48 h), single colonies are picked and inoculated into a seed culture medium for activation. The pH of the solid culture medium is 6.0 to 6.5.

[0052] The solid culture medium formulation is as follows: peptone 7 g / L, yeast extract 7 g / L, glucose 60 g / L, sea salt 15 g / L, agar powder 3%, glycerol 5%, with the remainder being pure water, adjusted to pH 6.0-6.5. All percentages mentioned above are mass percentages.

[0053] The seed culture medium formula is as follows: glucose 60 g / L, sodium chloride 15 g / L, yeast extract 4 g / L, peptone 8 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 2 g / L, monosodium glutamate 15 g / L, glycerol 10 g / L, 0.2% vitamin B1, 0.2% vitamin B6, 0.2% vitamin B12, with the balance being pure water, adjusted to pH 6.0-6.5. All percentages mentioned above are by mass.

[0054] The fermentation medium formula is as follows: glucose 100 g / L, sodium chloride 20 g / L, yeast extract 8 g / L, peptone 8 g / L, magnesium sulfate heptahydrate 1 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, calcium chloride 0.5 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 2 g / L, glycerol 10 g / L, 0.2% vitamin B1, 0.2% vitamin B6, 0.2% vitamin B12, with the balance being pure water, adjusted to pH 6.0-6.5. All percentages mentioned above are by mass.

[0055] After fermentation, the extraction of oils and other substances is carried out according to the following steps: (1) Accurately pipette a quantitative amount of fermentation broth into a bottle with a stopper, adjust the pH to 12 with 1 mol / L sodium hydroxide aqueous solution, mix well, and then add 0.01-0.1% of cell wall breaking enzyme by volume ratio of fermentation broth. Shake at 40~60 ℃ and 150 r / min for 10 h. (2) Add anhydrous ethanol at a ratio of 1:1 to the volume of the fermentation broth to precipitate the protein; (3) Add hexane in a 1:1 ratio of fermentation liquid volume, shake well, let stand to separate into layers, take the upper organic phase and place it in a pre-weighed and dry round-bottom conical flask, wash with hexane about 3 times until the upper organic phase is colorless and transparent. (4) The obtained upper liquid was extracted by rotary evaporation. Before rotary evaporation, the rotary evaporation flask was weighed and M1 was recorded. Rotary evaporation was carried out at 55 ℃ and 20 r / min until no more condensed water dripped. (5) After rotary steaming, place it in an oven to dry the excess moisture to a constant weight M2. Then the oil content is M = M2 - M1.

[0056] After oil extraction, the oil is methylated according to the following steps (preparation for gas chromatography): (1) Add 0.6 mL of 1 M potassium hydroxide methanol solution to a 2 mL centrifuge tube, and add 20 μL of the obtained oil to it and mix well; (2) The mixture was shaken at 1500 rpm for 7 h at room temperature. The reaction was terminated by adding 50 μL of concentrated sulfuric acid. (3) Add 1 mL of n-hexane for extraction, and shake at 1500 rpm for 5 h; (4) Then centrifuge at 12000 rpm for 5 min, take the upper n-hexane phase, filter it through an organic filter membrane to remove impurities, add it to a gas chromatography vial, and then perform gas chromatography detection. Gas chromatography test method: Gas chromatography analysis conditions: Use DB-23 (60 m 0.25 mm 0.25 μm column; FID detector selected; high-purity nitrogen used as carrier gas; split ratio 30 / 1; injection port temperature set to 250 °C; detector temperature set to 280 °C; injection volume 1 μL; temperature program: initially, the gas chromatographic column temperature was set to 100 °C, first increasing to 196 °C at a rate of 25 °C / min. Subsequently, the program increased to 220 °C at a rate of 2 °C / min and held at 220 °C for 12 min. Gas column flow rate set to 3.0 mL / min; make-up flow rate set to 30 mL / min; hydrogen flow rate set to 40 mL / min; and air flow rate set to 400 mL / min.

[0057] Biomass determination: Take 2 mL of fermentation broth fermented for 120 h, centrifuge at 5000 rpm for 5 min, discard the supernatant, wash once with 2 mL of sterile water, dry at 110 ℃ to constant weight, and finally weigh and calculate.

[0058] Squalene standard samples were prepared to obtain the standard curve equation, and the yield of squalene was calculated based on the gas chromatogram analysis results.

[0059] The fermentation time was 120 h. After fermentation, the squalene content, biomass, and lipid content of wild-type HX-308, engineered strain SQ-9, and engineered strain SQ-10 were measured. The results are as follows: Figure 6 and Figure 7 As shown in the results, the squalene yield of the wild-type strain was 1.86 g / L, that of the engineered strain SQ-9 was 3.77 g / L, and that of the engineered strain SQ-10 was 5.50 g / L, representing 2.02 times and 2.96 times that of the wild-type strain, respectively. Furthermore, the squalene yield of the engineered strain SQ-10, which produced the mitochondrial localization signal peptide, was 1.46 times that of SQ-9. Combining lipid yield and biomass, the biomass of SQ-10 reached 116 g / L, an increase of 10.82% compared to SQ-9, but a decrease of 1.7% compared to the wild-type; the lipid yield of SQ-10 reached 43.33 g / L, an increase of 20.36% compared to SQ-9, but a decrease of 6.52% compared to the wild-type. This indicates that the mitochondrial localization signal peptide can effectively alleviate the toxicity of small molecules to cells in the MVA pathway, increasing squalene yield with minimal impact on normal cellular metabolic activities.

[0060] Example 5: Fermentation culture of engineered Schizochytrium strain SSQ-10 in a 5 L fermenter using fed-batch fermentation The SQ-10 seed culture was inoculated into a 5 L fermenter at an inoculum of 10% (v / v, volume percentage), and fermentation was continued for 120 h at 30 ℃ and 300 rpm with stirring. The results are as follows. Figure 8As shown in the figure, the wild-type Schizochytrium produced 2.12 g / L of squalene, while the engineered strain SQ-10 produced 5.83 g / L, which is 2.75 times that of the wild-type. This demonstrates the feasibility of the mitochondrial localization signal peptide strategy and suggests its potential for further industrialization.

[0061] The relevant sequences in this invention are as follows: SEQ ID NO.1 (EGFP): SEQ ID NO.2(A3507MTS): ATGCTGAGCACGATGCAGGTGTTCCGCGCCCGCATGGTCGCGTCGAGCGCCGCCCAGCGCGGCCTCGCCACCAGCGCCCTCAAGGACAAGCTCACCGAGGTCGTCCCCAAGGAGCAGGAAAAGTTCAAGAAGATCAAGGCTGAGTACGGC SEQ ID NO.3(A0287MTS): ATGCTGACGACGCGGAATGCGCGCGCGGCGCAGAGGCTGGCGGGCCTCGGCGCCGCCGCAAAGAGACCACGAGAGGGACGAAGACTCGCGGGCGCTGCCGCTCGCGCGTTCTCGTCGGCTGGCTTTCCCGAACACGTCCGCATCGTGGAG SEQ ID NO.4( FPPS ): SEQ ID NO.5( SQS ): SEQ ID NO.6(G418): TCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCAT SEQ ID NO.7(Nourse): TTAGGGGCAGGGCATGCTCATGTAGAGCGCCTGCTCGCCGTCCGAGGCGGTGCCGTCGTACAGGGCGGTGTCCAGGCCGCAGAGGGTGAACCCCATCCGCCGGTACGCGTGGATCGCCGGTGCGTTGACGTTGGTGACCTCCA GCCAGAGGTGCCCGGCGCCCCGCTCGCGGGCGAACTCCGTCGCGAGCCCCATCAACGCGCGCCCGACCCCGTGCCCCCGGTGCTCCGGGGCGACCTCGATGTCCTCGACGGTCAGCCGGCGGTTCCAGCCGGAGTACGAGACG ACCACGAAGCCCGCCAGGTCGCCGTCGTCCCCGTACGCGACGAACGTCCGGGAGTCCGGGTCGCCGTCCTCCCCGTCGTCCGATTCGTCGTCCGATTCGTCGTCGGGGAACACCTTGGTCAGGGGCGGGTCCACCGGCACCTC CCGCAGGGTGAAGCCGTCCCCGGTGGCGGTGACGCGGAAGACGGTGTCGGTGGTGAAGGACCCATCCAGTGCCTCGATGGCCTCGGCGTCCCCCGGGACACTGGTGCGGTACCGGTAAGCCGTGTCGTCAAGAGTGGTACCCAT Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.

Claims

1. A mitochondrial localization signal peptide derived from Schizochytrium mitochondrial protein, characterized in that: The signal peptide is located at the N-terminus of the protein and can be recognized by the mitochondrial transport system in Schizochytrium cells, accurately introducing the target protein expressed with it into the mitochondria. The mitochondrial localization signal peptide is the mitochondrial localization signal peptide of A3507, and its sequence is SEQ ID NO.

2.

2. The application of the mitochondrial localization signal peptide as described in claim 1 in the production of squalene.

3. A highly squalene-producing Schizochytrium engineered strain containing the mitochondrial localization signal peptide as described in claim 1, characterized in that: The engineered Schizochytrium strain introduces the MVA pathway into the mitochondria via a mitochondrial localization signal peptide, reducing the toxic accumulation of intermediate metabolites in the cytoplasm, decreasing the loss of FPP to competing metabolic pathways, and increasing the squalene synthesis flux.

4. The method for constructing the high-squalene-producing Schizochytrium engineered strain according to claim 3, characterized in that: Includes the following steps: (1) Construction of mitochondrial targeted expression elements The mitochondrial localization signal peptide was fused with a key downstream enzyme gene of the MVA pathway and expressed. The mitochondrial localization signal peptide was fused with the N-terminus of the key enzyme to construct a mitochondrial-targeting recombinant plasmid, which was then placed under the regulation of a promoter recognizable by Schizochytrium to obtain the mitochondrial-targeting recombinant plasmid. (2) Construction of engineered strains The mitochondrial-targeting recombinant plasmid was randomly integrated into the genome of wild-type Schizochytrium using Agrobacterium-mediated transformation to obtain engineered Schizochytrium strains.

5. The construction method according to claim 4, characterized in that: The key enzymes in step (1) include farnesyl pyrophosphate synthase (FPPS) and squalene synthase (SQS); the nucleotide sequence of farnesyl pyrophosphate synthase (FPPS) is shown in SEQ ID NO.4, and the nucleotide sequence of squalene synthase (SQS) is shown in SEQ ID NO.

5. Alternatively, the promoter may be P2902.

6. The construction method according to claim 4 or 5, characterized in that: In step (2), the wild-type Schizochytrium is Schizochytrium. Schizochytrium sp . HX-308, its accession number is CCTCC No. M209059.

7. The application of the high-squalene-producing Schizochytrium engineered strain as described in claim 3 in the fermentation production of squalene.

8. A method for producing squalene by fermentation using the engineered strain of Schizochytrium as described in claim 3, characterized in that: Includes the following steps: The third-generation seed culture of the high-squalene-producing Schizochytrium engineered strain was inoculated into the fermentation medium at a volume percentage of 5% and cultured at 30°C and 180 r / min for 120 h with shaking. Alternatively, the third-generation seed culture of the engineered strain of Schizochytrium, which produces high levels of squalene, can be inoculated into a fermenter containing fermentation medium at an inoculation rate of 10% by volume, and fermented for another 120 h at 30 °C and 300 rpm with stirring.

9. The method according to claim 8, characterized in that: The cultivation method for the third-generation seed solution is as follows: A single colony of *Schizochytrium*, a high-squalene-producing engineered bacterium, was picked from solid culture medium using a sterile pipette tip and inoculated into a test tube containing 2 mL of seed culture medium. The colony was incubated at 30 °C and 180 rpm for 48 h to obtain the first-generation seed culture. 1 ml of the first-generation seed culture was then inoculated into an Erlenmeyer flask containing 50 ml of seed culture medium and incubated at 30 °C and 180 rpm for 48 h to obtain the second-generation seed culture. 1 ml of the second-generation seed culture was then inoculated into an Erlenmeyer flask containing 50 ml of seed culture medium and incubated at 30 °C and 180 rpm for 48 h to obtain the third-generation seed culture. Each generation was examined under a microscope to ensure it was free of contamination. The solid culture medium is formulated as follows: 7 g / L peptone, 7 g / L yeast extract, 60 g / L glucose, 15 g / L sea salt, 3% agar powder, 5% glycerol, with the remainder being pure water, and the pH adjusted to 6.0-6.5; all percentages are by mass. The seed culture medium formula is as follows: glucose 60 g / L, sodium chloride 15 g / L, yeast powder 4 g / L, peptone 8 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 2 g / L, monosodium glutamate 15 g / L, glycerol 10 g / L, 0.2% vitamin B1, 0.2% vitamin B6, 0.2% vitamin B12, with the balance being pure water, adjusted to pH 6.0-6.5; all percentages are by mass. Alternatively, the fermentation medium formula is as follows: glucose 100 g / L, sodium chloride 20 g / L, yeast powder 8 g / L, peptone 8 g / L, magnesium sulfate heptahydrate 1 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, calcium chloride 0.5 g / L, dipotassium hydrogen phosphate 1 g / L, potassium dihydrogen phosphate 2 g / L, glycerol 10 g / L, 0.2% vitamin B1, 0.2% vitamin B6, 0.2% vitamin B12, with the balance being pure water, adjusted to pH 6.0-6.5; all percentages are by mass.

Images