Polypeptide rhisa1 from rhizopogon and application thereof in prevention and control of agricultural pests

Abstract

The application discloses a polypeptide Rhisa1 from Cibariaceae and application thereof in agricultural pest prevention and control, and belongs to the technical field of agricultural microbial gene resource mining and utilization. The amino acid sequence of the polypeptide Rhisa1 is shown as SEQ ID NO. 1, and the nucleotide sequence for coding the polypeptide is shown as SEQ ID NO. 2. The Rhisa1 polypeptide is obtained by recombinant expression and purification through an E. coli expression system, and the polypeptide is verified by artificial feed feeding method, micro-injection method and a tobacco transient expression system, and the polypeptide shows significant insecticidal activity on a plurality of common crop pests such as Myzus persicae, Chilo suppressalis and Plutella xylostella. Based on the novel insecticidal characteristics of the polypeptide, the Rhisa1 polypeptide can be directly used as an effective component of a biological insecticide for development of a novel insecticide product, and can also be used as a novel pest-resistant gene for cultivation of a pest-resistant transgenic crop.

Description

Technical Field

[0001] This invention belongs to the field of agricultural microbial gene resource mining and utilization technology. Specifically, it relates to a polypeptide Rhisa1 derived from Aspergillus oryzae, its encoding gene, recombinant vector, genetically engineered bacteria, and its application in pest control. Background Technology

[0002] Agricultural pests are a significant factor limiting global crop yields and quality. For a long time, chemical pesticides have dominated pest control, but the resulting environmental pollution, excessive pesticide residues in agricultural products, and pesticide resistance are becoming increasingly prominent problems. With the development of green agriculture and sustainable plant protection technologies, exploring naturally derived active molecules for the development of novel insecticides and the cultivation of new insect-resistant crop varieties is gradually becoming an important approach to integrated pest management.

[0003] In the field of biopesticides, the development of biopesticides, represented by peptide active molecules, has become an important direction for international pesticide innovation. Peptide insecticides are recognized as a cutting-edge field of green plant protection inputs due to their advantages such as high structural diversity, novel mechanisms of action, good environmental compatibility, and high target selectivity. Discovering novel insecticidal peptides from natural resources is the core path for developing next-generation biopesticides. Currently, a large number of insecticidal peptide resources have been discovered both domestically and internationally from natural enemies of pests such as spiders and plants. However, globally, there are only three types of commercially available peptide insecticide products: the Spear® series of peptide insecticides developed by Vestaron in the United States based on the spider venom peptide Hv1a, the BASINTM peptide insecticide developed based on the spider venom peptide Ta1b, and the Sero-X® mixed peptide extract insecticide developed by Innovate Ag in Australia based on leguminous plant cyclic peptides. Therefore, systematically discovering novel insecticidal peptides with independent intellectual property rights from new natural resources remains a competitive focus in the international biopesticide research and development field.

[0004] In the breeding of insect-resistant crop varieties, Bt transgenic insect-resistant crops have been widely adopted globally, achieving significant economic and ecological benefits. However, almost all existing commercially available insect-resistant genes originate from Bacillus thuringiensis, resulting in a high concentration of gene resources. Long-term, large-scale cultivation of crops with a single insect-resistant gene has led to field resistance in multiple target pests, seriously threatening the sustainable application of transgenic insect-resistant crops. Discovering novel insecticidal genes has become an urgent need in the global agricultural sector.

[0005] Microorganisms represent a vast, untapped treasure trove of insecticidal peptides. Currently reported microbial-derived insecticidal peptides are mostly secondary metabolites produced via non-ribosomal synthesis pathways (such as cyclic peptides like beautifier and chlorogenic acid), while small, disulfide-bonded insecticidal peptides, similar to those found in spider venom and synthesized by ribosomes and encoded by genes, are rarely reported in microorganisms. This invention relates to *Aspergillus oryzae* (…). Rhizopogon salebrosus ( ) is a type of ectomycorrhizal fungus, belonging to the order Boletales, family Aspleniaceae, phylum Basidiomycota. Its genome has been predicted to contain a gene encoding a small secretory polypeptide rich in cysteine, but there are no research reports on the biological activity and application of this polypeptide. Summary of the Invention

[0006] In response to the problems of extremely limited discovery of microbial insecticidal peptide resources and scarcity of insect-resistant transgenic crop gene resources in existing technologies, the purpose of this invention is to discover and identify a novel insecticidal peptide from microorganisms and provide its application in the development of biological insecticides and the breeding of insect-resistant crops, so as to expand the resource library of insecticidal active molecules and insect-resistant genes.

[0007] To achieve the above objectives, the inventors, through extensive experimental research and tireless exploration, first discovered *Pseudomonas aeruginosa* (…). Rhizopogon salebrosus A small molecule polypeptide, named Rhisa1, was identified and obtained in [the study]. Based on the Escherichia coli expression system, the present invention prepared the target polypeptide and verified its significant insecticidal activity against a variety of common crop pests through feed feeding or microinjection. It can be further developed into a biological insecticide and / or insect-resistant crop for green control of field pests, and has broad application prospects in green agricultural production and integrated pest management.

[0008] Based on the above research findings, one of the objectives of this invention is to provide a Rhisa1 polypeptide, the amino acid sequence of which is shown in SEQ ID NO.1. It should be noted that the Rhisa1 polypeptide consists of 33 amino acids and has a molecular weight of approximately 3.62 kDa. This polypeptide is stably structured into a nodular three-dimensional structure by three pairs of disulfide bonds (C1-C4, C2-C5, C3-C6).

[0009] A second objective of this invention is to provide a gene encoding the Rhisa1 polypeptide as described above. More preferably, the coding sequence of the gene is shown in SEQ ID NO.2.

[0010] A third objective of this invention is to provide a recombinant vector containing the gene encoding the Rhisa1 polypeptide.

[0011] The fourth objective of this invention is to provide a genetically engineered bacterium containing the aforementioned recombinant vector.

[0012] The inventors discovered the insecticidal activity of Rhisa1 peptide against piercing-sucking pests (tobacco aphids) through artificial feed feeding; the insecticidal activity of Rhisa1 peptide against chewing pests (rice stem borer and diamondback moth) through micro-injection; and the insecticidal effect of Rhisa1 peptide after expression in plants through Agrobacterium-mediated transient expression technology.

[0013] Because the Rhisa1 polypeptide, after prokaryotic recombinant expression and purification, exhibits significant toxic effects against various agricultural pests, it can be directly used as an effective component of biological insecticides. The Rhisa1 polypeptide is synthesized by ribosomes and encoded by a gene; therefore, its encoding gene (SEQ ID NO.2) can be directly integrated into the plant genome, utilizing the plant's own protein synthesis system to continuously produce insecticidal polypeptides, achieving endogenous insect resistance. In other words, its encoding gene can be expressed in plants and confer insect resistance to crops, serving as a novel insect-resistant gene resource for insect-resistant crop breeding. Therefore, the fifth objective of this invention is to provide applications of the aforementioned Rhisa1 polypeptide, the aforementioned encoding gene, the aforementioned recombinant vector, or the aforementioned genetically engineered bacteria, wherein the application is selected from any one of the following:

[0014] A1) Its application in the preparation of insecticides for controlling pests;

[0015] A2) Application in the preparation of transgenic crops for pest control;

[0016] A3) Application in the preparation of transgenic microorganisms for pest control.

[0017] More preferably, the pests include tobacco aphids, rice stem borers, and diamondback moths.

[0018] A sixth objective of this invention is to provide a product for controlling pests, wherein the product contains an effective dose of the aforementioned Rhisa1 polypeptide. More preferably, the product is a spray formulation.

[0019] The seventh objective of this invention is to provide a method for controlling pests, wherein the method uses an effective dose of the above-mentioned Rhisa1 polypeptide or the above product to treat the pests.

[0020] More preferably, the treatment includes: preparing the Rhisa1 polypeptide into an insecticide for the control of pests.

[0021] Compared with the prior art, the present invention has the following advantages and advancements:

[0022] This invention provides a novel fungal-derived insecticidal peptide resource. For the first time, this invention has identified and extracted the insecticidal peptide Rhisa1 from the ectomycorrhizal fungus *Aspergillus oryzae*, filling a gap in this field. Peptide Rhisa1 was prepared using an *E. coli* expression system, and further verification using feed feeding, microinjection, or transient expression technology in plants demonstrated that Rhisa1 exhibits significant insecticidal activity against various common crop pests.

[0023] Specifically, the insecticidal activity of peptide Rhisa1 against tobacco aphids, rice stem borers, and diamondback moths was determined using an artificial feed feeding method. The results showed that the corrected mortality rate of second-instar nymphs of tobacco aphids treated with 205 mg / L Rhisa1 peptide reached 62.5% after 4 days. The insecticidal activity of peptide Rhisa1 against rice stem borers and diamondback moths was determined using a micro-injection method. The results showed that the corrected mortality rate of fourth-instar larvae of rice stem borers treated with 410 mg / L Rhisa1 peptide reached 53.3% after 5 days; the corrected mortality rate of second-instar larvae of diamondback moths treated with 410 mg / L Rhisa1 peptide reached 21.4% after 5 days. The insecticidal effect of Rhisa1 peptide expression on tobacco against tobacco aphids was determined using Agrobacterium-mediated transient expression technology. The results showed that the corrected mortality rate of tobacco aphids in the Rhisa1 peptide transient expression group was 54.17% after 5 days. The above results indicate that the Rhisa1 peptide has excellent insecticidal activity against a variety of pests, and that the Rhisa1 peptide can fold correctly in plants and maintain its insecticidal activity, thus possessing the potential for insect-resistant transgenic breeding.

[0024] Based on its broad-spectrum and highly effective insecticidal properties, the peptide Rhisa1 of this invention can be further developed into environmentally friendly biological insecticide products (such as spray formulations), and can also be used to cultivate insect-resistant transgenic crops or insect-resistant transgenic microorganisms for green control of field pests. Compared with traditional control methods that rely on chemical pesticides, the application of Rhisa1 peptide can effectively reduce environmental pollution, delay the development of pesticide resistance in pests, and has outstanding advantages such as strong sustainability, high target specificity, and good ecological compatibility, showing broad application prospects in green agricultural production and integrated pest management. Attached Figure Description

[0025] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This is a three-dimensional structure diagram of the Rhisa1 polypeptide predicted by Alphafold3 in Example 1 of the present invention.

[0027] Figure 2 This is an SDS-PAGE gel image of recombinant Rhisa1 polypeptide expressed in Escherichia coli in Example 1 of the present invention.

[0028] Figure 3 The insecticidal activity of Rhisa1 polypeptide against tobacco aphids in Example 2 of this invention (artificial feed feeding method).

[0029] Figure 4 The insecticidal activity of Rhisa1 polypeptide against rice stem borer in Example 2 of this invention (injection method).

[0030] Figure 5 This is the death phenotype of rice stem borer treated with Rhisa1 polypeptide in Example 2 of the present invention (injection method).

[0031] Figure 6 The insecticidal activity of Rhisa1 polypeptide against diamondback moth in Example 2 of this invention (injection method).

[0032] Figure 7 This is the death phenotype of diamondback moth treated with Rhisa1 polypeptide in Example 2 of the present invention (injection method).

[0033] Figure 8 This is a fluorescence image of tobacco infected with the polypeptide Rhisa1 Agrobacterium in Example 2 of the present invention.

[0034] Figure 9 The insecticidal effect of tobacco with transient expression of the polypeptide Rhisa1 against tobacco aphids in Example 2 of this invention (Agrobacterium-mediated method). Detailed Implementation

[0035] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0036] Example 1: Recombinant Expression and Purification of Rhisa1 Peptide

[0037] Based on extensive prior experimental research and through sequence retrieval and analysis using a self-built microbial genome database, the inventors of this invention have obtained an insecticidal agent. Rhizopogon salebrosusThe polypeptide Rhisa1, which is rich in cysteine, has the following coding sequence: tgtctcgaagagggcaagaaatgcaaacacaaccttaaatgctgctccggtcattgcatccttggcatctgcatcaccaagcacttagatctttcaagc (SEQ ID NO.2).

[0038] The amino acid sequence of the polypeptide Rhisa1 is: CLEEGKKCKHNLKCCSGHCILGICITKHLDLSS (SEQ ID NO. 1). It consists of 33 amino acid residues and has a molecular weight of 3.62 kDa. Its three-dimensional structure was predicted using AlphaFold3, as shown below. Figure 1 As shown, this polypeptide is a nodular structure composed of three pairs of disulfide bonds, arranged in the order of C1-C4, C2-C5, and C3-C6. NCBI BLAST analysis did not find any sequences similar to the Rhisa1 polypeptide.

[0039] Rhisa1 peptide samples were prepared using an *E. coli* protein expression system. Specifically, the coding sequence of the peptide Rhisa1 was optimized using *E. coli* preferred codons, and the gene sequence was chemically synthesized by Wuhan Aoke Biotechnology Co., Ltd. The resulting plasmid was cloned into the GST-tagged prokaryotic expression vector PGEX-4T-1 to construct a recombinant plasmid. The recombinant plasmid was transformed into *E. coli* SHuffle T7 Express E. coli B competent cells, plated on LB agar plates containing Amp resistance, and incubated upside down at 37°C for 12–16 h. Single colonies were picked and cultured in LB liquid medium containing Amp at 37°C with shaking. The bacterial culture was then sent for sequencing to confirm the sequence correctness. The validated strain was then used for a small-scale expression test: inoculated at a 1:100 ratio into fresh LB agar and incubated at 37°C until OD200. 600 Approximately 0.6-0.8 g of IPTG was added to a final concentration of 0.1 mM, and the mixture was induced overnight at 16°C. After SDS-PAGE confirmed the expression of the target protein in the supernatant, scale-up culture was performed. Bacterial cells were collected, resuspended in Lysis Buffer, and sonicated on ice (200 W, 3 s on, 5 s off, total 15 min). The supernatant was collected by centrifugation at 4°C. The supernatant was passed through a GST affinity chromatography column, washed sequentially with Wash Buffer until Coomassie Brilliant Blue did not change color, and then eluted with Elution Buffer. The eluent was placed in a dialysis bag with a molecular weight cutoff of 7 kDa and dialyzed at 4°C to remove reduced glutathione, with the dialysis buffer changed 3 times during the process. Finally, the protein concentration was determined using the BCA method. SDS-PAGE analysis showed that the purified product exhibited a single target band at approximately 30 kDa (i.e., the GST-Rhisa1 fusion protein). Figure 2 The concentration was measured to be 410 mg / L.

[0040] Example 2: Application of Rhisa1 peptide

[0041] 1. Insecticidal activity assay of Rhisa1 peptide against tobacco aphid

[0042] The insecticidal activity of purified Rhisa1 peptide against tobacco aphids was determined by artificial feed feeding. The peptide sample was added to the aphid artificial feed at a 1:1 ratio to prepare a liquid tobacco aphid artificial feed sample containing 205 mg / L of the target peptide. 100 μL of the liquid was pipetted into a double-walled plexiglass tube (3 cm high, 2.5 cm diameter) with a double-layered parafilm at one end. Second-instar tobacco aphid nymphs were transferred into the tube, and the other end was sealed with black cloth. Ten nymphs were used per replicate, for a total of three replicates. A 1:1 mixture of PBS buffer and tobacco aphid artificial feed at twice the concentration was used as a control. The insects were incubated in a culture room at 21±1℃, 50±10% humidity, and a 16h:8h light-dark cycle. Insect mortality was observed over 4 days. Results are as follows: Figure 3 As shown, the mortality rate of the control group after 4 days was 20.00%, while the mortality rate after 4 days of treatment with Rhisa1 peptide 205 mg / L was 70.00%, and the corrected mortality rate was 62.50%, which was significantly different from the control group. χ 2 =13.53, P = 0.0002). The results show that the feeding treatment with the Rhisa1 polypeptide of the present invention has very high insecticidal activity against tobacco aphids.

[0043] 2. Insecticidal activity assay of Rhisa1 peptide against rice stem borer

[0044] The insecticidal activity of Rhisa1 peptide against rice stem borer was determined using a microinjection method. A 410 mg / L peptide solution was injected into fourth-instar rice stem borer larvae using a microinjector, with the injection site being the mid-thorax and dorsal region of the larvae. PBS buffer was used as a control. The injection volume per larva was 100 nL, and the injection flow rate was 20 nL / s. The larvae were transferred to a 5 cm diameter petri dish containing rice stem borer-specific feed. Ten larvae were used in each treatment, with three replicates totaling 30 larvae. The larvae were cultured in a room at 27 ± 1 °C, 50% ± 10% humidity, and a photoperiod of 16:8 (L:D) h. Mortality was observed for 1-5 days after treatment. The criterion for mortality was the absence of spontaneous reaction when lightly touched with a brush. Results showed that the mortality rate in the control group was only 13.33% after 5 days. The mortality rate after 5 days of Rhisa1 peptide treatment reached 60%, with a corrected mortality rate of 53.3%, which was significantly different from the control group. χ 2 =14.31, P= 0.0002)( Figure 4 After treatment with Rhisa1 peptide, the larvae of the rice stem borer showed obvious phenotypes such as blackening at the injection site and shrinkage of the larvae. Figure 5 The results show that the Rhisa1 polypeptide of the present invention has high insecticidal activity against rice stem borer.

[0045] 3. Insecticidal activity assay of Rhisa1 peptide against diamondback moth

[0046] The insecticidal activity of Rhisa1 peptide against diamondback moth was determined using a microinjection method. A 410 mg / L peptide solution was injected into second-instar diamondback moth larvae using a microinjector, with the injection site being the mid-thorax and dorsal region of the larvae. PBS buffer was used as a control. The injection volume per larva was 100 nL, and the injection flow rate was 20 nL / s. The larvae were transferred to a glass bottle containing cabbage leaves. Ten larvae were used in each treatment, with three replicates totaling 30 larvae. The larvae were incubated in a room at 27 ± 1℃, 50% ± 10% humidity, and a photoperiod of 16:8 (L:D) h. Mortality was observed for 1-5 days after treatment. The criterion for mortality was the absence of spontaneous reaction when lightly touched with a brush. Results showed that the mortality rate after 5 days was 6.67% in the control group, 26.67% after 5 days of Rhisa1 peptide treatment, and 21.43% after correction, which was significantly different from the control group. χ 2 =4.26, P = 0.039)( Figure 6 After treatment with Rhisa1 peptide, diamondback moth larvae died, exhibiting phenotypic characteristics such as shrunken body. Figure 7 The results showed that the Rhisa1 polypeptide had significant insecticidal activity against the diamondback moth.

[0047] 4. Determination of the insect resistance effect of tobacco leaves transiently expressing Rhisa1 peptide against tobacco aphids.

[0048] The insecticidal effect of the target peptide against tobacco aphids was determined using Agrobacterium-mediated transient expression technology. Specifically, the Rhisa1 peptide gene sequence was synthesized by Wuhan Aoke Biotechnology Co., Ltd., and a 6×His tag sequence (HHHHHH) was introduced at the C-terminus. After the synthesized product was cleaved at SmaI and SacI restriction sites, it was subcloned into the plant expression vector PBI121-35S to construct a recombinant expression plasmid. The recombinant plasmid was transformed into Agrobacterium GV3101 competent cells using the liquid nitrogen freeze-thaw method (5 min on ice, 5 min in liquid nitrogen, 5 min in 37℃ water bath, 5 min on ice). After thawing, the cells were plated on LB agar plates containing Rif (1:2000) and Kan (1:1000) resistance and incubated upside down at 28℃ for 2–3 days. Single colonies were picked and cultured by shaking, and the plasmid was extracted, transformed into Escherichia coli DH5α, and sequence verification was performed. Expand the culture of correctly sequenced positive clones, collect the bacterial cells, resuspend them in MMA buffer (containing Mes, MgCl2, and acetylsuccinone), and adjust the OD. 600 The concentration was increased to 0.5, and then mixed with Agrobacterium-containing bacterial suspension carrying the P19 silencing repressor at a 1:1 ratio. The mixture was incubated at room temperature in the dark for 1 hour. Healthy 4-week-old *Nicotiana benthamiana* plants with good growth were selected, and the recombinant Agrobacterium-containing bacterial suspension was injected into the leaf tissue via needle-free injection. Simultaneously, *Agrobacterium-containing* expressing GFP was injected as a negative control. *Nicotiana benthamiana* plants were cultured in the dark for 48 hours after injection, and the expression of the target gene was examined by observing GFP fluorescence. Figure 8 Tobacco leaves of good growth and uniform size, collected 48 h after infection, were placed in petri dishes containing 2% agar, with 10 second-instar tobacco aphid nymphs inoculated into each dish. Leaves injected with Agrobacterium GFP were used as negative controls, and each treatment was replicated three times. The petri dishes were placed in a culture chamber at 24 ± 1℃, 50% ± 10% relative humidity, and a photoperiod of 16L:8D. The number of tobacco aphid deaths was recorded daily for 5 consecutive days, and the mortality rate and corrected mortality rate were calculated.

[0049] The results showed that the mortality rate of the GFP control group after 5 days was 20.00%, while the mortality rate of the Rhisa1 peptide treatment group after 5 days was 63.33%, with a corrected mortality rate of 54.17%, which was significantly different from the control group. χ 2 =12.08, P = 0.0005) Figure 9 The results showed that the Rhisa1 polypeptide has high insect resistance breeding value against tobacco aphids.

[0050] In summary, this invention is the first to utilize *Gnaphalium affine*. Rhizopogon salebrosusA novel polypeptide, Rhisa1, with broad-spectrum insecticidal activity was identified and obtained. Based on an *E. coli* expression system, the target polypeptide was obtained and its insecticidal activity against various common crop pests, including tobacco aphids, rice stem borers, and diamondback moths, was verified. Furthermore, a transient expression system in tobacco revealed that Rhisa1 exhibited high insecticidal activity against tobacco aphids. Based on its broad-spectrum, high-efficiency, and novel insecticidal properties, this polypeptide can be directly used as an active ingredient in biological insecticides for the development of novel insecticide products, or it can be used as a novel insect-resistant gene for breeding insect-resistant transgenic crops. This invention is the first to discover and identify Rhisa1, an insecticidal polypeptide, from the ectomycorrhizal fungus *Aspergillus*. Compared with relying on traditional insect-resistant genes, the application of Rhisa1 polypeptide can effectively delay the development of insecticide resistance in pests, possessing significant advantages such as strong sustainability, high target specificity, and good ecological compatibility, and has broad application prospects in green agricultural production and integrated pest management.

Claims

1. A Rhisa1 polypeptide, characterized in that, The amino acid sequence of the polypeptide is shown in SEQ ID NO.

1.

2. A gene encoding the Rhisa1 polypeptide as described in claim 1.

3. The gene encoding the Rhisa1 polypeptide according to claim 2, characterized in that, The coding sequence of the gene is shown in SEQ ID NO.

2.

4. A recombinant vector, characterized in that, The gene encoding the Rhisa1 polypeptide as described in claim 2 or 3.

5. A genetically engineered bacterium, characterized in that, It includes the recombinant vector as described in claim 4.

6. The application of the Rhisa1 polypeptide of claim 1, the encoding gene of claim 2, the recombinant vector of claim 4, or the genetically engineered bacteria of claim 5, wherein the application is selected from any one of the following: A1) Application in the preparation of insecticides for controlling pests, wherein the pests are tobacco aphids, rice stem borers, or diamondback moths; A2) Application in the preparation of transgenic crops for the control of pests, wherein the pest is the tobacco aphid; A3) Application in the preparation of transgenic microorganisms for the control of pests, wherein the pests are tobacco aphids, rice stem borers or diamondback moths.

7. A product for controlling pests, characterized in that, The product contains an effective dose of the Rhisa1 polypeptide as described in claim 1.

8. A method for controlling pests, characterized in that, The pests are treated with an effective dose of the Rhisa1 polypeptide as described in claim 1 or the product as described in claim 7.

9. The method according to claim 8, characterized in that, The treatment includes: preparing the Rhisa1 polypeptide into an insecticide for the control of pests.

Images