Metal-organic framework materials for nucleic acid transformation, methods of making and use thereof

Abstract

The present application relates to the technical field of crystalline metal organic framework materials, biological orthogonal catalysis and nucleic acid chemical conversion, in particular to a kind of metal organic framework material for nucleic acid conversion, its preparation method and application.The repeated structural unit of the crystalline porous material of the metal organic framework material is [Zr6(μ3-OH)8(OH)8][Cu4I4(INA-R)4]2;It contains catalytic site consisting of iodine bridging tetranuclear copper cluster and amino functionalized pore environment, can catalyze the deprotection of RNA or sgRNA protected by dimethyl propargyl carbonate without additional reducing agent, restore nucleic acid activity;It can also catalyze the cycloaddition reaction of alkyne-modified nucleic acid and azide compound, realize nucleic acid inactivation.The material can be further used for in vivo CRISPR / Cas9 gene editing regulation and nucleic acid in situ activation.

Description

Technical Field

[0001] This invention relates to the fields of crystalline metal-organic framework materials, bioorthogonal catalysis, and nucleic acid chemical conversion technology, specifically to a class of metal-organic framework materials for nucleic acid conversion, their preparation methods, and applications. Background Technology

[0002] Chemical transformation of nucleic acid molecules is a crucial means of achieving gene editing regulation, precise release of nucleic acid drugs, and spatiotemporal intervention in biological processes. While traditional homogeneous copper catalytic systems can achieve alkyne-related deprotection or cycloaddition reactions, they typically rely on external reducing agents and are prone to problems such as metal valence state fluctuations, insufficient catalytic selectivity, and limited cell compatibility in complex biological environments.

[0003] Metal-organic frameworks (MOFs) are considered important candidate platforms for constructing artificial bioorthogonal catalytic systems due to their crystalline ordered channels, customizable pore chemistry, and molecularly definable catalytic sites. Compared with molecular catalysts and metal nanoparticles, MOFs not only stabilize catalytic sites but also enhance the controllability of substrate recognition and reaction processes through pore size and pore environment design.

[0004] However, there are still few existing crystalline MOF catalysts capable of achieving efficient nucleic acid conversion directly in complex biological environments without the need for external reducing agents. In particular, there is a lack of heterogeneous catalytic systems that combine valence stability, pore recognition ability, and cell / tissue applicability for efficient deprotection of protected RNA or sgRNA and controlled click inactivation of alkyne-modified nucleic acids.

[0005] Therefore, developing a novel MOF material that can stably maintain Cu(I) active centers in molecularly confined channels and regulate the proximity of nucleic acids to catalytic sites through amino-functionalized channel environments is of great significance for achieving efficient and biocompatible chemical transformation of nucleic acid molecules. Summary of the Invention

[0006] One objective of this invention is to provide a metal-organic framework material for nucleic acid conversion. The material has a crystalline ordered framework and molecularly defined channels, within which iodine-bridged tetranuclear copper cluster catalytic sites are orderly distributed. The channels are surrounded by a functionalized chemical environment that allows protected nucleic acids to preferentially accumulate near the catalytic sites and reduces product retention after the reaction. This enables efficient deprotection of protected nucleic acids and click conversion of alkyne nucleic acids without the need for external reducing agents.

[0007] The second objective of this invention is to provide a method for preparing the above-mentioned metal-organic framework material, which is simple in process and suitable for scale-up and subsequent nano-sizing.

[0008] The third objective of this invention is to provide applications of the aforementioned metal-organic framework materials.

[0009] The fourth objective of this invention is to provide another application of the aforementioned metal-organic framework material.

[0010] One of the technical solutions adopted to achieve the objective of this invention is: a type of metal-organic framework material for nucleic acid transformation, wherein the crystalline porous material of the repeating structural unit of the metal-organic framework material is [Zr6(μ3-OH)8(OH)8][Cu4I4(INA-R)4]2; Wherein, [Zr6(μ3-OH)8(OH)8] is a zirconium oxide cluster inorganic node; [Cu4I4] is an iodine-bridged tetranuclear copper cluster framework; and INA-R is an organic ligand formed by the deprotonation of 3-substituted isonicotinic acid (3 R C5H3N 4 COO The carboxylic acid terminus is coordinated with the [Zr6(μ3-OH)8(OH)8], and the pyridine nitrogen terminus is coordinated with the [Cu4I4] cluster, thereby forming a three-dimensional crystalline porous framework; the R is selected from NH2, CH3, OCH3, F, NO2.

[0011] Preferably, the R group is linked to the pyridine ring of the isonicotinic acid ligand and is located inside the pores of the metal-organic framework material, thereby forming an R-functionalized pore environment.

[0012] Preferably, the copper cluster framework is distributed in an orderly manner within the crystalline channels.

[0013] The present invention relates to a metal-organic framework material for nucleic acid transformation. The material has a crystalline ordered framework and molecularly defined channels, within which iodine-bridged tetranuclear copper cluster catalytic sites are orderly distributed. The channels are surrounded by an amino-functionalized chemical environment, enabling protected nucleic acids to preferentially accumulate near the catalytic sites and reducing product retention after the reaction.

[0014] The second objective of this invention is achieved by the following technical solution: a method for preparing the metal-organic framework material, wherein zirconium salt, copper source, iodine source and 3-substituted isonicotinic acid are dissolved in an organic solvent, and a solid product is obtained by solvothermal reaction, followed by separation, washing and activation to obtain the metal-organic framework material for nucleic acid conversion.

[0015] Preferably, the zirconium salt is at least one of zirconium tetrachloride, zirconium oxychloride and their hydrates; the copper source and iodine source are cuprous iodide; and the substituents of the 3-substituted isonicotinic acid are at least one of NH2, CH3, OCH3, F, and NO2.

[0016] Preferably, the molar ratio of the zirconium salt, cuprous iodide, and 3-substituted isonicotinic acid is 1 : 3.9 : (0.7–2.2); wherein the concentration of the zirconium salt in the solvent is 12.0–12.4 mmol / L.

[0017] Preferably, the reaction solvent is N,N-dimethylformamide.

[0018] Preferably, the reaction system may also contain an acid regulator, wherein the acid regulator is trifluoroacetic acid.

[0019] The amount of trifluoroacetic acid added per 1 mL of N,N-dimethylformamide is 0-32 μL, more preferably 0 μL, 24 μL or 32 μL.

[0020] Preferably, the temperature of the solvothermal reaction is 80-120°C, and the reaction time is 16-72 hours.

[0021] Preferably, the temperature of the solvothermal reaction is 100°C.

[0022] Preferably, the obtained solid product is washed and solvent-exchanged multiple times with N,N-dimethylformamide and acetone, and then activated by vacuum activation or supercritical carbon dioxide activation to obtain the target crystalline material.

[0023] The third objective of this invention is achieved through the following technical solution: an application of the metal-organic framework material, in which the metal-organic framework material is used as a catalyst for the deprotection transformation of protected nucleic acids, or as a catalyst for the click cycloaddition reaction between alkyne-modified nucleic acids and azide compounds to inhibit or shut down nucleic acid activity.

[0024] Preferably, the protected nucleic acid is RNA, sgRNA or a derivative thereof with a dimethylpropyne carbonate protecting group; the metal-organic framework material catalyzes the removal of the protecting group to restore the biological activity of the nucleic acid.

[0025] Preferably, the azide compound is at least one of biotinylated azide, polyethylene glycol azide, or fluorescently labeled azide.

[0026] The fourth objective of this invention is achieved through the following technical solution: an application of the metal-organic framework material, in which the material is used for intracellular CRISPR / Cas9 gene editing regulation for non-diagnostic and therapeutic purposes, thereby activating gene editing by catalyzing sgRNA deprotection or inactivating sgRNA by catalyzing click reaction.

[0027] Compared with the prior art, the present invention has the following advantages and beneficial effects: (1) The Cu(I) iodine-bridged tetranuclear copper clusters are fixed by crystalline MOF channels, which reduces the dependence on external reducing agents and improves the valence stability of active sites during the reaction process.

[0028] (2) By functionalizing the pore environment, the probability of protected nucleic acid approaching the catalytic site is increased, and the deprotected products leave the active region, thereby improving the nucleic acid conversion efficiency.

[0029] (3) It can both activate nucleic acids by deprotection and inactivate alkyne nucleic acids by click, making it suitable for bidirectional regulation of nucleic acid activity.

[0030] (4) It can catalyze nucleic acid conversion in cells, providing a novel heterogeneous biological orthogonal catalytic platform for CRISPR / Cas9 regulation.

[0031] (5) The preparation method of the present invention is simple and suitable for scale-up and subsequent nano-sizing. Attached Figure Description

[0032] Figure 1 This is a schematic diagram of the structure of the MOF material of the present invention, wherein the gray polyhedron is the [Zr6(μ3-OH)8(OH)8] zirconium oxide cluster inorganic node, the orange sphere is Cu, the blue sphere is I, the dark gray is C, the red is O, and the light blue is N; Figure 2 The PXRD pattern (λ = 1.54056 Å) of MOF-248-NH2 prepared in Example 1 of this invention was obtained from testing and single-crystal simulation. Figure 3 The image shows the atomic thermal vibration diagram (30% probability) of the single crystal of MOF-248-NH2 prepared in Example 1 of this invention. In the diagram, Cu, I, Zr, C, N, and O atoms are marked with yellow, purple, sky blue, gray, dark blue, and red, respectively. Figure 4 XPS and AES spectra of MOF-248-NH2 prepared in Example 1 of this invention; Figure 5 The N2 adsorption-desorption isotherm and pore size distribution of MOF-248-NH2 prepared in Example 1 of this invention are shown below. Figure 6 The PXRD pattern (λ = 1.54056 Å) of MOF-248-CH3 prepared in Example 3 of this invention was obtained from testing and single-crystal simulation. Figure 7 The image shows the atomic thermal vibration diagram (30% probability) of the single crystal of MOF-248-CH3 prepared in Example 3 of this invention. In the diagram, Cu, I, Zr, C, N, and O atoms are marked with yellow, purple, sky blue, gray, dark blue, and red, respectively. Figure 8XPS and AES spectra of MOF-248-CH3 prepared in Example 3 of this invention; Figure 9 The PXRD pattern (λ = 1.54056 Å) of MOF-248-OCH3 prepared in Example 4 of this invention was obtained from testing and single-crystal simulation. Figure 10 The atomic thermal vibration diagram (30% probability) of MOF-248-OCH3 prepared in Example 4 of this invention is shown. In the diagram, Cu, I, Zr, C, N, and O atoms are marked with yellow, purple, sky blue, gray, dark blue, and red, respectively. Figure 11 XPS and AES spectra of MOF-248-OCH3 prepared in Example 4 of this invention; Figure 12 The PXRD pattern (λ = 1.54056 Å) of MOF-248-F prepared in Example 5 of this invention was obtained from testing and single-crystal simulation. Figure 13 The atomic thermal vibration diagram (30% probability) of MOF-248-F prepared in Example 5 of the present invention is shown. In the diagram, Cu, I, Zr, C, N, O and F atoms are marked with yellow, purple, sky blue, gray, dark blue, red and green, respectively. Figure 14 XPS and AES spectra of MOF-248-F prepared in Example 5 of this invention; Figure 15 The PXRD pattern (λ = 1.54056 Å) of MOF-248-NO2 prepared in Example 6 of this invention was obtained from testing and single-crystal simulation. Figure 16 XPS and AES spectra of MOF-248-NO2 prepared in Example 6 of this invention; Figure 17 This is a schematic diagram of the reaction catalyzed by the MOF-248 derivative of this invention to deprotect protected RNA; Figure 18 The graph shows the performance of the DMProc-RNA deprotection reaction of MOF-248 derivatives with different pore chemical environments in Example 7 of the present invention, where A is the deprotection conversion rate of the 21 nt RNA model strand, B is the deprotection conversion rate of the 32 nt RNA model strand, C is the deprotection conversion rate of the 64 nt RNA model strand, and D is the deprotection conversion rate of the 91 nt RNA model strand. Figure 19 The initial copper concentration and residual copper content in the supernatant after reaction of MOF-248 derivatives with different pore chemical environments are shown. Figure 20To illustrate the chemical deprotection and gene editing function recovery of DMProc-sg-SLX4IP catalyzed by MOF-248-NH2 in HeLa-OC cells in Example 8, where A represents the comparison of the CRISPR / Cas9 gene editing capabilities of sg-SLX4IP and DMProc-sg-SLX4IP under different treatment conditions, a Welch-corrected t-test was used (ns, not significant). P<0.0001); B represents the change in functional recovery of DMProc-sg-SLX4IP in HeLa-OC cells with respect to Cu content in MOF. Data are expressed as mean ± sd, n = 3. Figure 21 To illustrate the chemical deprotection and gene editing function recovery of MOF-248-NH2-catalyzed DMProc-sg-SLX4IP in HEK293T cells in Example 8, where A represents the comparison of the CRISPR / Cas9 gene editing capabilities of sg-SLX4IP and DMProc-sg-SLX4IP under different treatment conditions, a Welch-corrected t-test was used (ns, not significant). P<0.0001); B represents the change in functional recovery of DMProc-sg-SLX4IP in HEK293T cells with respect to Cu content in MOF. Data are expressed as mean ± sd, n = 3; Figure 22 This is a schematic diagram illustrating the click cycloaddition reaction catalyzed by the MOF-248 derivative of the present invention between alkyne nucleic acids and azide molecules; Figure 23 Example 9 illustrates the MOF-248-NH2-catalyzed Proc-sg-SLX4IP bonding reaction and its inhibition of gene editing activity. In HeLa-OC cells, A represents the comparison of CRISPR / Cas9 gene editing activities mediated by sg-SLX4IP and Proc-modified sg-SLX4IP under different catalytic conditions, using Welch-corrected t-test (ns, not significant). P<0.01; P<0.0001); B represents the effect of MOF-248-NH2 dosage on the inhibitory effect of Proc-sg-SLX4IP gene editing; data are expressed as mean ± sd, n = 3; Figure 24The image shows laser confocal microscopy imaging of Cy3-MOF-248-NH2 in HeLa-OC cells in Example 10; where A is the bright field image, Hoechst staining image, Cy3 channel image and merged image of HeLa-OC cells without Cy3-MOF-248-NH2 treatment, and B is the bright field image, Hoechst staining image, Cy3 channel image and merged image of HeLa-OC cells after Cy3-MOF-248-NH2 treatment; scale bar: 20 μm; Figure 25 The results show the effect of MOF-248-NH2 on the viability of MCF-7 cells in Example 10; Figure 26 To evaluate the monoclonal formation experiment of MCF-7 cells after MOF-248-NH2 treatment in Example 10, A shows representative monoclonal formation images of MCF-7 cells after treatment under different conditions; B is a quantitative analysis of the number of clones in A. Data are expressed as mean ± sd, n = 6. Statistical analysis was performed using Welch-corrected t-test (ns, not significant). P<0.001, P<0.0001); Figure 27 This is an evaluation of the monoclonal formation experiment in HeLa-OC cells treated with MOF-248-NH2 in Example 10. A shows representative monoclonal formation images of HeLa-OC cells after different treatment conditions, and B is a quantitative analysis of the number of clones in A. Data are expressed as mean ± sd, n = 3. Statistical analysis was performed using a Welch-corrected t-test. P<0.05, P<0.01). Detailed Implementation

[0033] The present invention will be further described below with reference to embodiments, but the scope of protection of the present invention is not limited to the following embodiments. For those skilled in the art, various substitutions, modifications or improvements made without departing from the spirit and essence of the present invention should fall within the scope of protection of the present invention.

[0034] Unless otherwise specified, all conditions in the following examples were performed under conventional conditions in the art; all reagents used are commercially available unless otherwise specified.

[0035] Figure 1This is a schematic diagram of the structure of the MOF material of the present invention. The gray polyhedrons represent inorganic nodes of the [Zr6(μ3-OH)8(OH)8] zirconium oxide cluster, the orange spheres represent Cu, the blue spheres represent I, the dark gray spheres represent C, the red spheres represent O, and the light blue spheres represent N. The INA-R ligand is a 3-substituted isonicotinic acid ligand, where R is located at the 3-position of the pyridine ring, and can be selected from substituents such as NH2, CH3, OCH3, F, and NO2. The INA-R ligand is connected to the zirconium oxide cluster through the carboxylate group and to the [Cu4I4] metal cluster through the pyridine nitrogen group, thus constructing a three-dimensional crystalline porous framework.

[0036] Example 1 Preparation of MOF-248-NH2 material Zirconium salt ZrOCl2·8H2O (4.00 mg, 0.0124 mmol), cuprous iodide CuI (9.22 mg, 0.0484 mmol), and 3-NH2-INA (1.35 mg, 0.0098 mmol) were added to a mixture of 1.0 mL N,N-dimethylformamide and 32 μL trifluoroacetic acid. The concentration of zirconium salt in the solvent was approximately 12.0 mmol / L, and the molar ratio of zirconium salt, cuprous iodide, and 3-NH2-INA was approximately 1:3.9:0.8. The mixture was sonicated or stirred to ensure thorough mixing and the formation of a clear solution.

[0037] After sealing the reaction flask, place it in a 100°C constant temperature oven for 16 hours. After the reaction is complete, cool to room temperature and centrifuge or filter to obtain the solid product.

[0038] The obtained solid was washed and solvent exchanged repeatedly with N,N-dimethylformamide and acetone, and then activated under vacuum to remove residual solvent in the pores, thus obtaining the target crystalline material MOF-248-NH2.

[0039] Figure 2 The PXRD pattern (λ = 1.54056 Å) of MOF-248-NH2 prepared in Example 1 was obtained from testing and single-crystal simulation.

[0040] Figure 3 The image shows the atomic thermal vibration diagram (30% probability) of the single crystal data of MOF-248-NH2 prepared in Example 1. In the figure, Cu, I, Zr, C, N and O atoms are marked with yellow, purple, sky blue, gray, dark blue and red, respectively.

[0041] Figure 4 XPS and AES spectra of MOF-248-NH2 prepared in Example 1.

[0042] from Figure 2-3The results show that the obtained material maintains the expected crystalline structure, from Figure 4 It can be seen from the results that the obtained material has stable Cu(I) iodine-bridged tetranuclear copper cluster sites.

[0043] Figure 5 The N2 adsorption-desorption isotherm and pore size distribution of MOF-248-NH2 prepared in Example 1 are shown. Figure 5 As can be seen, the obtained material exhibits obvious nitrogen adsorption behavior, indicating that it has a porous structure. The pore size distribution results show that the pore size of MOF-248-NH2 is mainly concentrated in the range of about 2–4 nm, indicating that the material has a stable mesoporous channel structure.

[0044] Example 2 Preparation of MOF-248-NH2 material Zirconium salt ZrCl4 (5.78 mg, 0.0248 mmol), CuI (18.44 mg, 0.0968 mmol), and 3-NH2-INA (2.69 mg, 0.0195 mmol) were added to 2.0 mL of N,N-dimethylformamide. The concentration of zirconium salt in the solvent was approximately 12.4 mmol / L, and the molar ratio of zirconium salt, cuprous iodide, and 3-NH2-INA was approximately 1:3.9:0.8. The mixture was sonicated or stirred to ensure thorough mixing and the formation of a clear solution. The reaction flask was sealed and placed in a 100°C oven for 22 hours. After the reaction, the mixture was cooled to room temperature and centrifuged or filtered to obtain a solid product. The obtained solid was washed repeatedly with N,N-dimethylformamide and acetone, followed by solvent exchange, and then activated under supercritical CO2 extraction conditions to obtain the target crystalline material MOF-248-NH2.

[0045] The dial indicator diagram of the material obtained in this embodiment is the same as that in Embodiment 1.

[0046] Example 3 Preparation of MOF-248-CH3 material Zirconium salt ZrOCl₂·8H₂O (4.00 mg, 0.0124 mmol), CuI (9.22 mg, 0.0484 mmol), and 3-CH₃-INA (3.73 mg, 0.0272 mmol) were added to a mixed solvent of 1.0 mL N,N-dimethylformamide and 32 μL trifluoroacetic acid. The mixture was sonicated or stirred to ensure thorough mixing and a clear solution. The concentration of zirconium salt in the solvent was approximately 12.0 mmol / L; the molar ratio of zirconium salt, cuprous iodide, and 3-CH₃-INA was approximately 1:3.9:2.2. The reaction flask was sealed and placed in a 100°C oven for 72 hours. After the reaction was complete, the mixture was cooled to room temperature and centrifuged or filtered to obtain the solid product. The obtained solid was washed and solvent-exchanged repeatedly with N,N-dimethylformamide and acetone, and then activated with supercritical carbon dioxide to obtain the target crystalline material MOF-248-CH3.

[0047] Figure 6 The PXRD pattern (λ = 1.54056 Å) of MOF-248-CH3 prepared in Example 3 was obtained from testing and single-crystal simulation.

[0048] Figure 7 The image shows the atomic thermal vibration diagram (30% probability) of the single crystal of MOF-248-CH3 prepared in Example 3. In the diagram, Cu, I, Zr, C, N, and O atoms are marked with yellow, purple, sky blue, gray, dark blue, and red, respectively.

[0049] Figure 8 XPS and AES spectra of MOF-248-CH3 prepared in Example 3.

[0050] from Figure 6-7 It can be seen from this that the obtained material maintains the expected crystalline structure, from Figure 8 It can be seen from the results that the obtained material has stable Cu(I) iodine-bridged tetranuclear copper cluster sites.

[0051] Example 4 Preparation of MOF-248-OCH3 material Zirconium salt ZrOCl2·8H2O (4.00 mg, 0.0124 mmol), CuI (9.22 mg, 0.0484 mmol), and 3-OCH3-INA (1.34 mg, 0.0088 mmol) were added to a mixed solution of N,N-dimethylformamide and 24 μL trifluoroacetic acid. The concentration of zirconium salt in the solvent was approximately 12.1 mmol / L; the molar ratio of zirconium salt, cuprous iodide, and 3-OCH3-INA was approximately 1:3.9:0.7. The mixture was sonicated or stirred to ensure thorough mixing and the formation of a clear solution. The reaction flask was sealed and placed in a 100°C oven for 18 hours. After the reaction was complete, the mixture was cooled to room temperature and centrifuged or filtered to obtain the solid product. The obtained solid was washed and solvent-exchanged repeatedly with N,N-dimethylformamide and acetone, and then activated with supercritical carbon dioxide to obtain the target crystalline material MOF-248-OCH3.

[0052] Figure 9 The PXRD pattern (λ = 1.54056 Å) of MOF-248-OCH3 prepared in Example 4 of this invention is obtained from testing and single-crystal simulation.

[0053] Figure 10 The atomic thermal vibration diagram (30% probability) of MOF-248-OCH3 prepared in Example 4 of this invention is shown. In the diagram, Cu, I, Zr, C, N and O atoms are marked with yellow, purple, sky blue, gray, dark blue and red, respectively.

[0054] Figure 11 XPS and AES spectra of MOF-248-OCH3 prepared in Example 4 of this invention.

[0055] Figure 9-10 The results show that the obtained material maintains the expected crystalline structure. Figure 11 The results show that the obtained material has stable Cu(I) iodine-bridged tetranuclear copper cluster sites.

[0056] Example 5 Preparation of MOF-248-F material Zirconium salt ZrOCl2·8H2O (4.00 mg, 0.0124 mmol), CuI (9.22 mg, 0.0484 mmol), and 3-F-INA (1.34 mg, 0.0095 mmol) were added to a mixed solution of N,N-dimethylformamide and 24 μL trifluoroacetic acid. The concentration of zirconium salt in the solvent was approximately 12.1 mmol / L; the molar ratio of zirconium salt, cuprous iodide, and 3-F-INA was approximately 1:3.9:0.8. The mixture was sonicated or stirred to ensure thorough mixing and a clear solution. The reaction flask was sealed and placed in a 100 °C oven for 18 hours. After the reaction, the mixture was cooled to room temperature and centrifuged or filtered to obtain a solid product. The obtained solid was washed repeatedly with N,N-dimethylformamide and acetone, followed by solvent exchange, and then activated with supercritical carbon dioxide to obtain the target crystalline material MOF-248-F.

[0057] Figure 12 The PXRD pattern (λ = 1.54056 Å) of MOF-248-F prepared in Example 5 of this invention was obtained from testing and single-crystal simulation.

[0058] Figure 13 The atomic thermal vibration diagram (30% probability) of MOF-248-F prepared in Example 5 of this invention is shown. In the diagram, Cu, I, Zr, C, N, O and F atoms are marked with yellow, purple, sky blue, gray, dark blue, red and green, respectively.

[0059] Figure 14 XPS and AES spectra of MOF-248-F prepared in Example 5 of this invention.

[0060] Figure 12-13 The results show that the obtained material maintains the expected crystalline structure. Figure 14 The results show that the obtained material has stable Cu(I) iodine-bridged tetranuclear copper cluster sites.

[0061] Example 6: Preparation of MOF-248-NO2 material Zirconium salt ZrCl4 (5.78 mg, 0.0248 mmol), CuI (18.44 mg, 0.0968 mmol), and 3-NO2-INA (3.28 mg, 0.0195 mmol) were added to 2.0 mL of N,N-dimethylformamide. The concentration of zirconium salt in the organic solvent was approximately 12.4 mmol / L; the molar ratio of zirconium salt, cuprous iodide, and 3-NO2-INA was approximately 1:3.9:0.8. The mixture was sonicated or stirred to ensure thorough mixing and the formation of a clear solution. The reaction flask was sealed and placed in a 100°C oven for 32 hours. After the reaction, the mixture was cooled to room temperature and centrifuged or filtered to obtain a solid product. The obtained solid was washed repeatedly with N,N-dimethylformamide and acetone for solvent exchange, followed by supercritical carbon dioxide activation to obtain the target crystalline material MOF-248-NO2.

[0062] Figure 15 The PXRD pattern (λ = 1.54056 Å) of MOF-248-NO2 prepared in Example 6 of this invention was obtained from testing and single-crystal simulation.

[0063] Figure 16 XPS and AES spectra of MOF-248-NO2 prepared in Example 6 of this invention.

[0064] Figure 15 The results show that the obtained material maintains the expected crystalline structure. Figure 16 The results show that the obtained material has stable Cu(I) iodine-bridged tetranuclear copper cluster sites.

[0065] Example 7 MOF-248-R is used for the deprotection transformation of protected RNA. This embodiment illustrates the specific experimental method for catalyzing the deprotection of protected RNA by MOF-248-NH2 under conditions without added reducing agent. The protected RNA substrate was RNA with a dimethylpropyne carbonate protecting group. RNA model strands of 21 nt, 32 nt, 64 nt, and 91 nt were used, synthesized by Sangon Biotech (Shanghai) Co., Ltd., and purified by HPLC. Unprotected RNA of the same sequence served as a positive control, and protected RNA without catalyst served as a negative control. The MOF material of this invention does not have a specific selection function for RNA sequences of different lengths. This embodiment only studies the effect of RNA model strands of different lengths; the sequence itself does not affect the experimental results.

[0066] The MOF-248-NH2, MOF-248-CH3, MOF-248-OCH3, MOF-248-F, and MOF-248-NO2 materials prepared in Examples 1, 3, 4, 5, and 6, respectively, were dispersed in RNase-free water to prepare 1 mg / mL stock solutions. Before use, the solutions were sonicated for 5-10 min to form a homogeneous dispersion. The reaction system consisted of 20 μL of 0.5 μM protected RNA, 2-64 μM MOF-248-R (the amount of MOF-248-R was calculated based on the copper content in the materials, corresponding to 2 μM, 4 μM, 8 μM, 16 μM, 32 μM, and 64 μM, respectively), and 10 mM Tris-HCl buffer (pH = 6.8, 25 °C). o C). Place the reaction solution at 37°C. o Incubate at C for 30 min. Do not add ascorbic acid, phosphine reagent, or other exogenous reducing agents during the reaction.

[0067] After the reaction, the MOF particles do not need to be removed; denaturing polyacrylamide gel electrophoresis can be used directly to detect changes in RNA migration before and after the reaction. Specifically, 20 μL of the reaction mixture is mixed with an equal volume of RNA loading buffer containing formamide; then, a 20% denaturing polyacrylamide gel containing 7 M urea is used, and the mixture is incubated at 25°C in 1×TBE buffer. o C. Electrophoresis at 400 V for 3-4 hours. Fluorescently labeled RNA was detected using a ChemiDoc imaging system; unlabeled RNA was stained with SYBR Gold or GelRed before imaging. Using the unprotected RNA band as a reference for the deprotection product, ImageJ was used to quantify the grayscale of the substrate and product bands, and the deprotection conversion rate was calculated. Results comparisons are shown below. Figure 18 .

[0068] Figure 17 This is a schematic diagram of the reaction in which the MOF-248 derivative of this invention catalyzes the deprotection of protected RNA.

[0069] Figure 18The performance of MOF-248 derivatives with different pore chemical environments in the DMProc-RNA deprotection reaction is shown. The deprotection performance of MOF-248, MOF-248-NH2, MOF-248-CH3, MOF-248-OCH3, MOF-248-F, and MOF-248-NO2 on nucleic acids of different chain lengths was compared. Data are expressed as mean ± sd, n = 3. A represents the deprotection conversion rate of a 21 nt RNA model strand, B represents the deprotection conversion rate of a 32 nt RNA model strand, C represents the deprotection conversion rate of a 64 nt RNA model strand, and D represents the deprotection conversion rate of a 91 nt RNA model strand. The results show that the conversion rates of protected RNA to native RNA catalyzed by MOF-248 derivatives with different pore substitutions exhibit significant differences. MOF-248-NH2 generally performed better, indicating that the functionalized pore environment is conducive to nucleic acid proximity to the catalytic site and promotes complete reaction.

[0070] Figure 19 The initial copper concentration and residual copper content in the supernatant after reaction were determined for MOF-248 derivatives with different pore chemical environments. The initial copper concentration and residual copper content in the supernatant after reaction were compared between MOF-248 derivatives with different pore chemical environments and the homogeneous copper system. Data are expressed as mean ± sd, n = 3. The results show that all systems exhibit low metal residue.

[0071] Example 8 MOF-248-NH2 is used for intracellular sgRNA activation. This example illustrates the application of MOF-248-NH2 in catalyzing the deprotection of protected sgRNA and restoring CRISPR / Cas9 gene editing activity in the cellular environment. Unmodified sgRNA for cell experiments can be obtained through in vitro transcription or commercial synthesis. Taking in vitro transcription as an example, unmodified sgRNA targeting the SLX4IP gene was designed. First, a DNA template containing the T7 promoter (SEQ ID1: TAATACGACTCACTATAGG) was designed. GCCACAGCCAGGATTTAAGAGTTTTAGAGCTAG AAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT The T7 promoter sequence is 5'-taatacgactcactataG. gg-3', G This is the start site for RNA transcripts. The DNA template sequence includes the target spacer sequence (single underlined portion) and the sgRNA backbone sequence (double underlined portion); subsequently, in vitro transcription was performed according to the instructions of the Thermo Fisher Scientific T7 High Yield RNA Transcription Kit. After the reaction, DNase I was added to digest and remove the DNA template, and the RNA was purified by ethanol precipitation, RNA purification column, or denaturing polyacrylamide gel electrophoresis to obtain the corresponding unmodified sgRNA. In other embodiments, the sgRNA can be designed for SCN10A or other target genes, and the MOF material of this invention shows no difference in efficacy for different sgRNAs.

[0072] Subsequently, the obtained unmodified sgRNA was subjected to an in vitro post-modification reaction with the dimethylpropargyl carbonate-based modifying agent DMproc (Reference: Post-synthetic 'Click' Synthesis of RAFT Polymers with Pendant Self-immolative Triazoles, Timothy N. Forder, Peter G. Maschmeyer et al. Chemistry– An Asian Journal, 2021, Volume 16, DOI: 10.1002 / asia.202001443), introducing a dimethylpropargyl carbonate protecting group at the RNA 2'-OH site of the sgRNA. Specifically, the sgRNA was dissolved in a reaction system containing HEPES (4-hydroxyethylpiperazine ethanesulfonic acid), MgCl2, NaCl, and DMSO (dimethyl sulfoxide), and DMproc and 4-dimethylaminopyridine (DMAP) were added as catalysts. The reaction was carried out with shaking at 37 °C for 12 h. After the reaction was completed, sodium acetate, ethanol and glycogen were added to terminate the reaction and precipitate RNA. After centrifugation, the precipitate was washed with pre-cooled 75% ethanol and then reconstituted with RNase-free water to obtain DMproc-modified protected sgRNA, i.e., DMproc-sgRNA.

[0073] Cellular experiments were performed using HeLa-OC cells and HEK293T cells, respectively. HeLa-OC cells, a stable Cas9-expressing cell line, were donated by Professor Wensheng Wei of the School of Life Sciences, Peking University. Both HeLa-OC and HEK293T cells were cultured in high-glucose DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin, and kept at 37°C. o C. Incubate in a 5% CO2 incubator. Seed cells into 12-well plates, approximately 1.5 × 10⁶ cells per well.5 The number of cells is increased to approximately 60%-80% at the time of transfection.

[0074] For HeLa-OC cells, since this cell line stably expresses Cas9 protein, unmodified sgRNA or DMproc-sgRNA was transfected into the cells using Lipofectamine™ 3000 transfection reagent (Thermo Fisher Scientific) or an equivalent RNA transfection reagent. 1.2 μg of sgRNA was used per well, and the transfection complex was formed in serum-free DMEM according to the reagent instructions before adding the cells. Four hours after transfection, the medium was replaced with fresh complete medium, and sonicated MOF-248-NH2 nanoparticles were added to achieve a final copper concentration of 15-40 μM, preferably 30 μM or 40 μM. Cells were cultured for another 24 hours before harvesting for subsequent genomic DNA extraction and gene editing efficiency assays.

[0075] For HEK293T cells, Cas9 RNP transfection was used for experiments. Specifically, Cas9 protein (EnGen® Spy Cas9 NLS, NEB #M0646M) was mixed with unmodified sgRNA or DMproc-sgRNA in vitro at a molar ratio of sgRNA:Cas9 of 1:1.1 and incubated at room temperature for 10-20 min to allow the Cas9 protein and sgRNA to pre-assemble into a Cas9 / sgRNA ribonucleoprotein complex, i.e., the RNP complex. Subsequently, the resulting RNP complex was mixed with Lipofectamine™ 3000 or an equivalent transfection reagent in serum-free DMEM to form a transfection complex, which was then added to HEK293T cells pre-seeded in 12-well plates. The amount of sgRNA or DMproc-sgRNA used per well was 1.2 μg. Four hours after transfection, the medium was replaced with fresh complete medium, and ultrasonically dispersed MOF-248-NH2 nanoparticles were added to bring the final copper concentration in the system to 15-40 μM, preferably 30 μM or 40 μM. Cells were collected after culturing for another 24 hours.

[0076] Gene editing efficiency was assessed using T7 Endonuclease I. Specifically, after cell collection, DNA was extracted using a genomic DNA extraction kit, and PCR amplification was performed on the genomic fragment containing the target site. The primer pairs were: SLX4IP-F:TTATCCGGCACTGTGAAAGCT; SLX4IP-R:CCTGATGTTTAGCAACTTTTTGG. The products were then purified at 95°C. o After denaturation at C for 5 min, the mixture was slowly cooled to refold and form heteroduplexes. Then, T7 Endonuclease I was added and the mixture was heated at 37°C.o Incubate at C for 15-30 min. The enzyme digestion products are separated by 1.5% agarose gel electrophoresis, and bands are recorded using a gel imaging system. Gray-scale analysis is performed on the gel images, measuring the gray values ​​of the uncut band (uncut) and the two cleaved product bands (cut1 and cut2). The cleavage ratio Fcut is calculated using the formula Fcut = (cut1 + cut2) / (uncut + cut1 + cut2), and the indel efficiency is calculated using the formula Indel (%) = [1] (1 Fcut) 0.5 ] × 100% Calculation. If necessary, further verification of editing efficiency can be performed using Sanger sequencing, ICE analysis, or targeted deep sequencing.

[0077] Figure 20 To investigate the chemical deprotection and gene editing function recovery of MOF-248-NH2-catalyzed DMProc-sg-SLX4IP in HeLa-OC cells, A represents the comparison of the CRISPR / Cas9 gene editing capabilities of sg-SLX4IP and DMProc-sg-SLX4IP under different treatment conditions. Welch-corrected t-tests were used (ns, not significant). (P<0.0001) indicates that unmodified sg-SLX4IP maintained similar editing efficiencies under catalyst-free, MOF-248-NH2, and CuSO4+BTTAA conditions. DMProc-sg-SLX4IP was almost completely inactivated under catalyst-free conditions, but its gene editing activity was significantly restored after MOF-248-NH2 treatment; in contrast, no significant recovery was observed after CuSO4+BTTAA treatment. Figure B shows that the functional recovery of DMProc-sg-SLX4IP in HeLa-OC cells gradually increased with increasing Cu content in the MOF, and stabilized after approximately 30 μM. The CuSO4+BTTAA treatment group remained close to background levels. Data are expressed as mean ± sd, n = 3.

[0078] Figure 21 To assess the chemical deprotection and gene editing function recovery of MOF-248-NH2-catalyzed DMProc-sg-SLX4IP in HEK293T cells, A represents the comparison of the CRISPR / Cas9 gene editing capabilities of sg-SLX4IP and DMProc-sg-SLX4IP under different treatment conditions. Welch-corrected t-tests were used (ns, not significant). (P<0.0001) indicates that unmodified sg-SLX4IP maintained similar editing efficiencies under catalyst-free, MOF-248-NH2, and CuSO4+BTTAA conditions. DMProc-sg-SLX4IP was almost completely inactivated under catalyst-free conditions, but its gene editing activity was significantly restored after MOF-248-NH2 treatment; in contrast, no significant recovery was observed after CuSO4+BTTAA treatment. B shows that the functional recovery of DMProc-sg-SLX4IP in HEK293T cells gradually increased with increasing Cu content in the MOF, and tended to stabilize after approximately 30 μM. The CuSO4+BTTAA treatment group remained close to the background level. Data are expressed as mean ± sd, n = 3. In summary, when protected sgRNA is transfected alone, the T7E1 restriction band is weak or close to background levels due to the interference of the protective group with sgRNA structure or Cas9 recognition. After the addition of MOF-248-NH2, the T7E1 restriction band at the target site of the protected sgRNA is significantly enhanced, indicating that MOF-248-NH2 can catalyze the deprotection of sgRNA and restore gene editing activity in cells. The editing efficiency of the unprotected sgRNA group changes little before and after the addition of MOF-248-NH2, indicating that MOF-248-NH2 has little interference with the native sgRNA or the Cas9 system itself.

[0079] Example 9 MOF-248-NH2 is used for intracellular sgRNA inactivation. This example illustrates the application of MOF-248-NH2 in catalyzing a click cycloaddition reaction between alkyne-modified sgRNA and azide molecules in a cellular environment, thereby reducing sgRNA-mediated CRISPR / Cas9 gene editing activity. Figure 22 The diagram shown is a schematic representation of the click cycloaddition reaction catalyzed by the MOF-248 derivative of the present invention between alkyne nucleic acids and azide molecules.

[0080] The alkyne-modified sgRNA used in this embodiment was obtained by in vitro post-modification of unmodified sgRNA. The unmodified sgRNA could be prepared by in vitro transcription or commercial synthesis, and its preparation method was the same as in Example 8.

[0081] Subsequently, the obtained unmodified sgRNA was subjected to an in vitro post-modification reaction with Proc RNA 2'-OH modification reagent Proc (reference: Mesoporous Metal–Organic Frameworks for Catalytic RNA Deprotection and Activation, Jin Liu, Xingyu Liu, et al., Angew. Chem. Int. Ed. 2023, DOI: 10.1002 / anie.202302649) to introduce terminal alkyne modification at the RNA 2'-OH site of the sgRNA, obtaining Proc-sgRNA. Specifically, the unmodified sgRNA was dissolved in a reaction system containing HEPES, MgCl2, NaCl and DMSO, and Proc and 4-dimethylaminopyridine (DMAP) were added as catalysts, and the reaction was carried out at 37°C. o The reaction was carried out under C conditions with shaking for 12 h. After the reaction was completed, sodium acetate, ethanol and glycogen were added to terminate the reaction and precipitate RNA. After centrifugation, the precipitate was washed with pre-cooled 75% ethanol and then reconstituted with RNase-free water to obtain Proc-modified alkyne-containing sgRNA.

[0082] In this embodiment, the terminal alkyne structure in Proc-sgRNA serves as a click reaction handle. Under MOF-248-NH2 catalysis, Proc-sgRNA undergoes a CuAAC click cycloaddition reaction with azide molecules, thereby introducing a larger azide molecular tag onto the sgRNA. This interferes with the binding of sgRNA to Cas9 protein, the formation of the sgRNA / Cas9 complex, or target DNA recognition, ultimately achieving the chemical shutdown of sgRNA-mediated gene editing activity. In other embodiments, the sgRNA can be designed for SCN10A or other target genes; the MOF material of this invention shows no difference in effectiveness for different sgRNAs.

[0083] Biotin-PEG2-azide (Bide Pharmaceuticals, #BD00894842) was used as a representative azide molecule for illustration. Before the experiment, MOF-248-NH2 nanoparticles were dispersed in RNase-free water to prepare a stock solution, which was then sonicated for 5-10 min before use to form a homogeneous dispersion. Biotin-azide was prepared as a DMSO stock solution and added to the cell culture medium to a final concentration of 50 μM. The amount of MOF-248-NH2 used was calculated based on the copper content in the material, resulting in a final copper concentration of 8 μM during cell treatment.

[0084] Cellular experiments were performed using HeLa-OC cells, with cell culture conditions as described in Example 8. HeLa-OC cells, which stably express Cas9 protein, were transfected with native sgRNA or Proc-sgRNA using Lipofectamine™ 3000 or an equivalent RNA transfection reagent. 1.2 μg of sgRNA was used per well, and the transfection complex was formed in serum-free DMEM according to the reagent instructions before adding the cells. Four hours after transfection, the medium was replaced with fresh complete medium, and MOF-248-NH2 and biotin azide were added according to the experimental groups. Cells were collected after another 24 hours of culture for subsequent genomic DNA extraction and gene editing efficiency assays.

[0085] The steps for detecting Cas9 gene editing efficiency are the same as in Example 8.

[0086] Figure 23 The results show the bonding reaction of Proc-sg-SLX4IP catalyzed by MOF-248-NH2 and its inhibition of gene editing activity. Figure A shows the comparison of CRISPR / Cas9 gene editing activities mediated by sg-SLX4IP and Proc-modified sg-SLX4IP under different catalytic conditions in HeLa-OC cells. Unmodified sg-SLX4IP maintained high editing activity in all groups. The editing activity of Proc-modified sg-SLX4IP decreased significantly in the presence of MOF-248-NH2. Figure B shows the effect of MOF-248-NH2 dosage on the inhibitory effect of Proc-sg-SLX4IP gene editing; with increasing Cu concentration, the Indel value gradually decreased, and the function was significantly inhibited at a copper concentration of 8 μM. Data are expressed as mean ± sd, n = 3. Statistical analysis was performed using the Welch-corrected t-test (ns, not significant). P<0.01; P<0.0001).

[0087] This embodiment demonstrates that, under the catalysis of MOF-248-NH2, alkyne-modified sgRNA undergoes a CuAAC reaction with azide molecules, leading to a decrease in sgRNA biological activity and thus inhibiting CRISPR / Cas9 editing. This indicates that MOF-248-NH2 can achieve a significant sgRNA inactivation effect with a relatively low copper concentration, showcasing its potential application in nucleic acid activity suppression.

[0088] Example 10 Material positioning and biocompatibility evaluation This embodiment illustrates the uptake, localization, and distribution of MOF-248-NH2 in cells. Cy3-labeled MOF-248-NH2 nanoparticles were used as fluorescent tracer materials, and their intracellular distribution in HeLa-OC cells was observed using laser confocal microscopy.

[0089] Before the experiment, HeLa-OC cells were seeded in 35 mm confocal culture dishes (2 × 10⁻⁶ cells / year). 5 In a culture medium containing 10% fetal bovine serum and 1% penicillin and streptomycin, cells were added to a high-glucose DMEM medium and incubated at 37°C. o C. Incubate overnight in a 5% CO2 incubator to achieve a cell density of approximately 50%-70% for imaging.

[0090] Cy3-MOF-248-NH2 was dispersed in sterile water to prepare a stock solution, which was then sonicated for 5-10 min before use to ensure a homogeneous dispersion. Cy3-MOF-248-NH2 was then added to the cell culture medium to achieve a final concentration of 30 μM (calculated based on copper content). No Cy3-MOF-248-NH2 was added to the control group cells. The treated cells and Cy3-MOF-248-NH2 were incubated at 37°C. o C. Incubate for 4 hours under 5% CO2 conditions.

[0091] After incubation, the culture medium was discarded, and the cells were gently washed three times with pre-warmed PBS to remove untaken or unbound free material. Then, PBS containing Hoechst 33342 was added to stain the cell nuclei. The final concentration of Hoechst 33342 was 5 μg / mL, and incubation was carried out at 37 °C in the dark for 15 min. After staining, the cells were washed three times with PBS, fixed with 4% paraformaldehyde at room temperature for 15 min, and then washed three more times with PBS.

[0092] Imaging was performed using a laser confocal microscope (Zeiss LSM 980). For example... Figure 24 As shown, bright-field, Hoechst, Cy3, and merged images were acquired separately. Hoechst was used to visualize the cell nucleus, and the Cy3 signal was used to show the intracellular distribution of Cy3-MOF-248-NH2. During imaging, the laser power, gain, exposure, and scanning parameters were kept consistent between the control and treatment groups to compare fluorescence signal differences. Results showed that distinct red fluorescent spots corresponding to the cell outline were visible in the cells of the treatment group. The material was distributed around the cytoplasm and near the nucleus, which facilitated its contact with nucleic acid substrates.

[0093] The cell viability of MCF-7 cells treated with different concentrations of MOF-248-NH2 was detected using the CCK-8 assay. MCF-7 cells were seeded in 96-well plates, with approximately 5 × 10⁶ cells per well. 3 Add high-glucose DMEM medium containing 10% fetal bovine serum and 1% penicillin and streptomycin, and incubate at 37°C. o C. Incubate overnight in a 5% CO2 incubator.

[0094] After cultivation, the original culture medium was discarded, and fresh complete culture medium containing different concentrations of MOF-248-NH2 was added. MOF-248-NH2 was dispersed in sterile water before use and sonicated for 5-10 min to ensure uniform dispersion. Material amounts were calculated based on the copper content in the system, with final Cu concentrations of 25, 50, and 100 μM. A homogeneous copper catalytic system using Cu(I) / BTTAA was employed, with the same final Cu concentration used as a control. The DMSO-treated group served as a solvent control.

[0095] After treatment, 10 μL of CCK-8 reagent (MCE, #HY-K0301) was added to each well. The cells were then incubated at 37°C. o Incubate in a C24 incubator in the dark for 1 h, and measure the absorbance at 450 nm using a microplate reader. Cell viability is calculated using the following formula: CCK-8 assays were performed on Day 0, Day 1, Day 2, Day 3, and Day 4. For each well, 10 μL of CCK-8 reagent (MCE, #HY-K0301) was added, and the cells were then incubated at 37°C. o Incubate in a C24 incubator in the dark for 1 h, and measure the absorbance at 450 nm using a microplate reader. To avoid repeated addition of CCK-8 to the same well and its impact on subsequent cell proliferation, parallel wells can be used for separate measurements at each time point.

[0096] Cell proliferation folds were calculated by normalizing the absorbance of each treatment group at different time points relative to Day 0: Cell proliferation fold = OD_day n / OD_day 0 Wherein, OD_day n represents the absorbance of the corresponding treatment group on Day n, and OD_day 0 represents the absorbance of the same treatment group on Day 0. Multiple replicates are set for each group, and the data are expressed as mean ± sd.

[0097] like Figure 25The image shows the proliferation of MCF-7 cells treated with MOF-248-NH2 for 0 to 3 days at different Cu concentrations, as detected by the CCK8 assay. Data are expressed as mean ± sd, n = 3. The results show that MOF-248-NH2 had little effect on the short-term proliferation of MCF-7 cells within the Cu concentration range of 25-100 μM, and the cell proliferation curve was generally similar to that of the DMSO control group. In contrast, the homogeneous Cu(I) / BTTAA system exhibited a more significant concentration-dependent proliferation inhibition, especially at higher Cu concentrations where cell proliferation was significantly limited. These results indicate that MOF-248-NH2, by immobilizing copper catalytic sites through crystalline channels, can maintain nucleic acid catalytic conversion capacity while reducing the adverse effects of free copper on short-term cell proliferation, demonstrating good cell compatibility.

[0098] The effect of MOF-248-NH2 on long-term cell proliferation was further evaluated using a monoclonal formation assay, and compared with a homogeneous copper catalytic system. The experiments were conducted using MCF-7 cells and HeLa-OC cells, respectively.

[0099] For MCF-7 cells, approximately 2000 cells were seeded in each well of a 6-well plate to allow for the formation of dispersed monoclonal colonies during subsequent culture. After cell attachment, the cells were treated with either MOF-248-NH2 or a homogeneous copper catalytic system according to the experimental groups. The amount of MOF-248-NH2 was calculated based on the copper content in the material, with final Cu concentrations of 50 μM and 100 μM. The homogeneous copper catalytic system used was CuSO4 + BTTAA + NaAsc, with the final Cu concentration consistent with the MOF-248-NH2 treatment group. H2O or DMSO treatment groups served as controls. After 3 days of treatment, the medium was replaced with fresh complete medium, and the cells were cultured for another 4 days. After culture, the medium was discarded, and the cells were washed with PBS, then fixed with 4% paraformaldehyde for 15 min, followed by staining with 0.1% crystal violet for 20 min. After staining, the cells were gently washed with PBS until the solution was nearly colorless, air-dried, and photographed to record the colony formation.

[0100] For HeLa-OC cells, the experimental procedures were basically the same as for MCF-7 cells. HeLa-OC cells were seeded in 6-well plates, with approximately 500 cells per well. After cell attachment, MOF-248-NH2 or CuSO4+BTTAA+NaAsc were added for treatment, respectively. The MOF-248-NH2 treatment groups were set with final Cu concentrations of 50 μM and 100 μM, while the homogeneous copper catalytic system was set with a final Cu concentration of 100 μM as a control. After 3 days of treatment, the medium was replaced with fresh complete medium, and the cells were cultured for another 4 days. Subsequently, paraformaldehyde fixation, crystal violet staining, washing, photography, and colony counting were performed.

[0101] Clone counts were statistically analyzed using image analysis software such as ImageJ. The number of visible clones in each group was quantitatively analyzed and expressed as mean ± sd. In the MCF-7 cell experiments, n = 6 per group, and in the HeLa-OC cell experiments, n = 3 per group. Statistical analysis was performed using Welch-corrected t-tests.

[0102] Figure 26 To evaluate the monoclonal formation assay in MCF-7 cells after MOF-248-NH2 treatment, A shows representative monoclonal formation images of MCF-7 cells after different treatment conditions. MOF-248-NH2 and CuSO4+BTTAA+NaAsc were treated with Cu concentrations shown in the figures. Cells were cultured for 4 days after treatment and then stained with crystal violet. B shows the quantitative analysis of the number of clones in A. Data are expressed as mean ± sd, n = 6. Statistical analysis was performed using Welch-corrected t-tests (ns, not significant). P<0.001, P<0.0001). Figure 27 To evaluate the monoclonal formation in HeLa-OC cells after MOF-248-NH2 treatment, A shows representative monoclonal formation images of HeLa-OC cells after different treatment conditions. MOF-248-NH2 and CuSO4+BTTAA+NaAsc were treated with Cu concentrations shown in the figures. Cells were cultured for 3 days and then cultured for another 4 days, for a total culture time of 7 days, before crystal violet staining. B shows the quantitative analysis of the number of clones in A. Data are expressed as mean ± sd, n = 3. Statistical analysis was performed using Welch-corrected t-tests (…). P<0.05, (P<0.01). The results showed that in MCF-7 and HeLa-OC cells, the MOF-248-NH2 treatment group still formed significant single colonies, and its inhibition of colony formation was significantly weaker than that of the CuSO4+BTTAA+NaAsc homogeneous copper catalytic system at the same Cu concentration. In contrast, cell colonies were almost completely absent after treatment with the homogeneous copper catalytic system, suggesting that free copper and the reduction system have a stronger impact on long-term cell proliferation. These results indicate that MOF-248-NH2, by immobilizing Cu(I) catalytic sites through crystalline channels, can reduce free copper-related cytotoxicity while maintaining nucleic acid catalytic activity, exhibiting superior cell compatibility compared to the homogeneous copper system.

[0103] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Those skilled in the art can make various modifications and variations based on the disclosure of this invention, and all such modifications and variations should fall within the protection scope of this invention.

Claims

1. A class of metal-organic framework materials for nucleic acid transformation, characterized in that: The repeating structural unit of the metal-organic framework material is a crystalline porous material of [Zr6(μ3-OH)8(OH)8][Cu4I4(INA-R)4]2; Wherein, [Zr6(μ3-OH)8(OH)8] is an inorganic node of zirconium oxide cluster; [Cu4I4] is an iodine-bridged tetranuclear copper cluster framework; INA-R is an organic ligand formed by the deprotonation of 3-substituted isonicotinic acid, whose carboxylic acid terminus is coordinated with [Zr6(μ3-OH)8(OH)8] and whose pyridine nitrogen terminus is coordinated with the [Cu4I4] cluster, thereby forming a three-dimensional crystalline porous framework; R is selected from NH2, CH3, OCH3, F, NO2.

2. The metal-organic framework material according to claim 1, characterized in that: The R group is linked to the pyridine ring of the isonicotinic acid ligand and is located inside the pores of the metal-organic framework material, thereby forming an R-functionalized pore environment.

3. The metal-organic framework material according to claim 2, characterized in that: The copper cluster framework is distributed in an orderly manner within the crystalline channels.

4. A method for preparing a metal-organic framework material according to any one of claims 1-3, characterized in that: Zirconium salt, copper source, iodine source and 3-substituted isonicotinic acid were added to a reaction system containing an organic solvent, and a solid product was obtained by solvothermal reaction. The product was then separated, washed and activated to obtain the metal-organic framework material for nucleic acid conversion.

5. The preparation method according to claim 4, characterized in that: The zirconium salt is at least one of zirconium tetrachloride, zirconium oxychloride, and their hydrates; the copper source and iodine source are cuprous iodide; the substituents of the 3-substituted isonicotinic acid are at least one of NH2, CH3, OCH3, F, and NO2. Preferably, the molar ratio of the zirconium salt, cuprous iodide, and 3-substituted isonicotinic acid is 1 : 3.9 : (0.7-2.2), wherein the concentration of the zirconium salt in the organic solvent is 12.0-12.4 mmol / L.

6. The preparation method according to claim 4, characterized in that: The organic solvent is N,N-dimethylformamide; Preferably, the reaction system contains an acid regulator, which is trifluoroacetic acid; the amount of trifluoroacetic acid added is 0-32 μL per 1 mL of N,N-dimethylformamide. Preferably, the temperature of the solvothermal reaction is 80-120 °C, and the reaction time is 16-72 hours.

7. The preparation method according to claim 4, characterized in that: The obtained solid product was washed and solvent-exchanged multiple times with N,N-dimethylformamide and acetone, and then activated by vacuum or supercritical carbon dioxide to obtain the target crystalline material.

8. The application of a metal-organic framework material according to any one of claims 1-3 or a metal-organic framework material prepared by any one of claims 4-7, characterized in that: The metal-organic framework material can be used as a catalyst for the deprotection transformation of protected nucleic acids, or as a catalyst for the click cycloaddition reaction between alkyne-modified nucleic acids and azide compounds to inhibit or shut down nucleic acid activity.

9. The application according to claim 8, characterized in that: The protected nucleic acid is RNA, sgRNA, or a derivative thereof with a dimethylpropyne carbonate protecting group; the metal-organic framework material catalyzes the removal of the protecting group to restore the biological activity of the nucleic acid; The azide compound is at least one of biotinylated azide, polyethylene glycol azide, or fluorescently labeled azide.

10. The application of a metal-organic framework material according to any one of claims 1-3 or a metal-organic framework material prepared by any one of claims 4-7, characterized in that: The material is used for intracellular CRISPR / Cas9 gene editing regulation for non-diagnostic and therapeutic purposes, achieving gene editing activation by catalyzing sgRNA deprotection, or achieving sgRNA inactivation by catalyzing click reactions.

Images