Chlorella sorokiniana strain SZ2-1 and application thereof

Abstract

The present disclosure relates to the field of microbial technology, in particular to a Chlorella sorokiniana SZ2-1 and application thereof. Chlorella sorokiniana The Chlorella sorokiniana SZ2-1 of the present disclosure is preserved in China Center for Type Culture Collection on April 15, 2026, and the preservation number is CCTCC NO: P202610. The Chlorella sorokiniana SZ2-1 screened by the present disclosure has excellent adaptability and tolerance to inorganic selenium compounds during the culture process, can efficiently absorb and utilize inorganic selenium in the culture solution, and can convert the inorganic selenium into nano selenium, thereby realizing efficient enrichment of nano selenium by the Chlorella.

Description

Technical Field

[0001] This disclosure relates to the field of microbial technology, specifically to a strain of Chlorella sorogenesis SZ2-1 and its applications. Background Technology

[0002] Cadmium (Cd) is a non-essential, highly toxic heavy metal widely present in the environment. With the advancement of industrialization and urbanization, cadmium pollution in farmland soil has become a global agricultural ecological and food safety issue. Even under low-concentration exposure conditions, cadmium can be absorbed into crops through plant roots, disrupting key physiological processes such as photosynthesis, nutrient absorption and transport, and antioxidant defense systems, resulting in stunted crop growth, reduced biomass, and significantly lower yields. Furthermore, it can accumulate through the food chain, causing severe and irreversible damage to animal and human health. Rice, with its highly efficient root cadmium absorption and aboveground translocation mechanisms, is a food crop with an extremely high capacity for cadmium accumulation.

[0003] Currently, among the existing technologies for controlling cadmium pollution in rice, soil passivation remediation, agronomic regulation, and breeding of low-accumulation varieties are widely used. Soil chemical passivation technology, which often uses inorganic minerals and chemical chelating agents, can reduce the bioavailability of cadmium in the soil in the short term, but it has inherent drawbacks such as long-term application easily damaging the soil's physicochemical structure, causing a decline in soil fertility, and triggering secondary environmental pollution. Agronomic regulation methods suffer from cumbersome operation procedures, their effects are greatly affected by regional environment and climate conditions, and their field application stability is insufficient.

[0004] Selenium (Se) is an essential trace element for the growth and development of plants and animals. Compared with inorganic and organic selenium, selenium nanoparticles (SeNPs) possess higher bioactivity, lower biotoxicity, and stronger environmental stability, showing great application potential in the field of heavy metal stress mitigation in crops. Existing research shows that SeNPs can significantly improve crop tolerance to heavy metal stress and reduce the accumulation of heavy metals in crops by regulating the plant's antioxidant defense system, enhancing heavy metal chelation, and inhibiting heavy metal transmembrane transport and aboveground accumulation. However, the current mainstream preparation method for SeNPs is chemical synthesis, which requires the use of large amounts of toxic and harmful chemical reducing agents and dispersing stabilizers. This method involves harsh reaction conditions, high energy consumption, and the generation of toxic byproducts during the preparation process. The resulting nanoparticles suffer from problems such as chemical reagent residues, poor biocompatibility, and easy aggregation and inactivation. This not only significantly increases the preparation cost but also poses potential ecological and environmental risks in agricultural field applications, severely limiting the large-scale promotion and application of SeNPs in safe agricultural production.

[0005] Currently, the green synthesis technology of SeNPs based on microalgae still faces technical bottlenecks such as difficulty in screening functional algae, low synthesis and conversion efficiency, and insufficient product particle size uniformity and storage stability. At the same time, existing research on the application effects and mechanisms of SeNPs synthesized by microalgae in the control of cadmium stress in rice is insufficient, especially their role in cadmium detoxification metabolism and restoration of physiological homeostasis under stress in rice is still unclear, which cannot provide reliable technical support and theoretical basis for the green and safe control of cadmium pollution in rice.

[0006] Therefore, developing efficient, green, and safe technologies for controlling cadmium pollution in rice, and conveniently obtaining nano-selenium that can effectively inhibit cadmium accumulation in rice and significantly alleviate the toxic effects of cadmium on rice, are key technical issues that urgently need to be addressed in the fields of agricultural environment and food security.

[0007] Furthermore, on the one hand, there are differences in understanding among those skilled in the art; on the other hand, the inventors studied a large number of documents and patents when making this invention, but due to space limitations, not all details and contents were listed in detail. However, this does not mean that the present invention does not possess the features of these prior art. On the contrary, the present invention already possesses all the features of the prior art, and the applicant reserves the right to add relevant prior art to the background art. Summary of the Invention

[0008] This disclosure relates to the field of microbial technology, specifically to a strain of Chlorella sorogenesis SZ2-1 and its applications.

[0009] To address the aforementioned technical problems, one of the objectives of this invention is to provide a strain of *Chlorella sorokinense* (…). Chlorella sorokiniana SZ2-1, Chlorella sorokinica SZ2-1, was deposited at the China Center for Type Culture Collection on April 15, 2026, with accession number CCTCC NO: P202610.

[0010] One of the objectives of this invention is to provide an algae preparation containing the aforementioned Chlorella sorogenesis SZ2-1.

[0011] One objective of this invention is to provide the application of the aforementioned *Chlorella sorokinense* SZ2-1 in the preparation of nano-selenium, wherein *Chlorella sorokinense* SZ2-1 bioconverts inorganic selenium into nano-selenium, the inorganic selenium being selenite. The inorganic selenium used for conversion is preferably sodium selenite (Na2SeO3) at a concentration of 10-400 mg / L or a corresponding inorganic selenium ion concentration. Preferably, the inorganic selenium ion concentration is 1-200 mg / L. More preferably, the inorganic selenium ion concentration is 1 mg / L. Other possible concentrations include 200 mg / L, 5 mg / L, 10 mg / L, 20 mg / L, 50 mg / L, and 100 mg / L.

[0012] According to one specific embodiment, the nano-selenium is elemental selenium containing biological macromolecules. Preferably, the biological macromolecules include polysaccharides and proteins.

[0013] According to one specific embodiment, the selenite is one or more of sodium selenite, potassium selenite, barium selenite, and calcium selenite.

[0014] One of the objectives of this invention is to provide a method for biosynthesizing nano-selenium from the aforementioned Chlorella vulgaris SZ2-1, which includes the following steps: After crushing Chlorella SZ2-1, it was mixed with a culture medium containing selenium compounds to obtain a mixture rich in nano-selenium.

[0015] Specifically, *Chlorella sorokinica* SZ2-1 was inoculated into BG11 medium containing 20 g / L glucose without selenium and cultured until the stationary phase. The algal cells were then collected by centrifugation. The algal cells were resuspended in PBS, sonicated, and the intracellular contents (supernatant) were collected by centrifugation. Different concentrations of sodium selenite were then added to the supernatant to biotransform and synthesize selenium nanoparticles.

[0016] To improve the efficiency of nano-selenium preparation, microalgae are typically first expanded and cultured. Once the algal biomass reaches a suitable level, the algae are then broken up. Adding an inorganic selenium source at this stage further facilitates the conversion of selenium to nano-selenium, significantly increasing the yield of the target product. Therefore, it is suitable to add a selenium-containing compound after the microalgae have been cultured in a shaker until they reach the logarithmic growth phase or the stationary phase, followed by crushing and centrifugation.

[0017] According to one specific embodiment, SZ2-1 used for enriching nano-selenium is a treated algal supernatant, and the treatment method includes: OD 680 No less than 4% of Chlorella sorogenesis SZ2-1 was added to the selenium-containing culture medium after undergoing processes to prevent protein denaturation, remove cell debris, and remove impurities.

[0018] Preferably, to prevent protein denaturation, PBS is added to the enriched algae and the algae are disrupted, with the treatment environment maintained at 0-10°C. The disruption method is, for example, ultrasonic disruption. The ambient temperature is, for example, 4°C.

[0019] Preferably, cell debris is removed by centrifugation followed by separation of the supernatant and precipitate.

[0020] Preferably, the impurity removal process involves washing the supernatant after centrifugation with PBS.

[0021] Preferably, the supernatant after washing is mixed with a culture medium containing a selenium compound, and the mixture is incubated under light until the reaction solution turns deep red. The selenium compound is, for example, sodium selenite. The light incubation is, for example, under 30,000 lux illumination. The photoperiod is, for example, 16 h light / 8 h dark.

[0022] Specifically, the culture medium of Chlorella sorogenesis SZ2-1 was obtained by shaking culture at 20-30℃ and 3000 lux light conditions until the growth was stable.

[0023] According to one specific embodiment, the culture medium is a BG11 liquid medium containing a carbon source. Preferably, the selenium concentration in the culture medium is 1-400 mg / L.

[0024] According to one specific embodiment, the culture medium is BG11 liquid medium containing 20 g / L glucose.

[0025] One of the objectives of this invention is to provide a method for mitigating cadmium stress using nano-selenium biosynthesized by *Chlorella sorokinica* SZ2-1, specifically by adding nano-selenium biosynthesized by *Chlorella sorokinica* SZ2-1 to the plant growth environment.

[0026] According to one specific embodiment, the cadmium content is 0.1-20 mg / L.

[0027] According to one specific implementation method, enriching organic selenium involves bioconverting inorganic selenium into nano-selenium in an environment with a selenium concentration of 1-200 mg / L.

[0028] The beneficial effects of this invention are as follows: 1. The Chlorella sorokinica SZ2-1 obtained by screening in this invention has excellent adaptability and tolerance to inorganic selenium compounds during the cultivation process. It can efficiently absorb and utilize inorganic selenium in the culture medium and directionally convert it into nano-selenium, thereby achieving efficient enrichment of nano-selenium by Chlorella sorokinica.

[0029] 2. The nano-selenium-enriched Chlorella SZ2-1 obtained in this invention can be applied to rice cultivation systems, effectively alleviating cadmium stress in rice and improving the growth performance and stress resistance of rice in cadmium-polluted environments. It has good application prospects in the field of stress-resistant agricultural cultivation. Attached Figure Description

[0030] Figure 1 This invention relates to the use of different Na2SeO3 concentrations. Chlorella sorokiniana Characterization diagram of SeNPs synthesized by SZ2-1, where, (a) Chlorella sorokiniana Phenotype of SZ2-1 at different Na2SeO3 reaction concentrations, (b) PDI, (c) hydrodynamic dimensions, (d) Zeta potential of SeNPs; Figure 2 The chlorophyll synthesis and characterization of the SeNPs involved in this invention are shown in the following figures: (a) schematic diagram of microalgae culture and biomass extraction; (b) EDS spectrum; (c) FTIR spectrum; (d) DLS measurement of hydrodynamic dimensions; (e) SEM; (f, g) TEM imaging; and (h, i) elemental mapping of SeNPs. Figure 3 The effects of different concentrations of Cd toxicity on rice involved in this invention include (a) the growth phenotype of rice plants under different concentrations of Cd, (b) the height of the aboveground parts and the length of the root system, (c) the fresh weight and dry weight of the aboveground parts, (d) the fresh weight and dry weight of the root system, (e) Chl a, (f) Chl b, and (g) carotenoid activity. Figure 4 The effects of SeNPs involved in this invention on rice growth and photosynthetic pigments under different concentrations of cadmium treatment, wherein (a) growth phenotypes of rice plants under different concentrations of SeNPs and Cd stress, (b) plant height and root length, (c) fresh and dry weight of aboveground parts, (d) fresh and dry weight of roots, (e) Chl a, (f) Chl b, and (g) carotenoid activity; Figure 5 The effects of SeNPs on chlorophyll fluorescence parameters of rice under cadmium stress as described in this invention are shown in (a) Fv / Fm, Y(NO) and Y(NPQ) activities in the aboveground parts of rice, (b) ETR, (c) Y(NPQ), and (d) Y(NO). Figure 6 This is an analysis of the morphology and cross-section of rice roots involved in this invention. In (a, c), the roots treated with CK and SeNP-3 showed normal, intact endoderm (ED) and cortex (C). (b) Cell degradation and collapse of ED and C cells under Cd stress. (d) SeNP-3 treatment maintained the integrity of cortex and stele (ST) under Cd stress. (eh) Enlarged views of ED and ST corresponding to the order in the figure. Figure 7 The selenium content and its translocation and bioaccumulation factors in the aboveground parts, roots and nutrient solution involved in this invention are: (a) selenium content in rice stems, (b) selenium content in rice roots, (c) translocation factors, (d) selenium content in nutrient solution, (e) BCF of selenium in rice stems, and (f) BCF of selenium in rice roots. Figure 8 The present invention relates to the Cd content in the aboveground parts, roots and nutrient solution and its translocation and bioaccumulation factors, wherein (a) Cd content in the aboveground parts of rice, (b) Cd content in the roots of rice, (c) translocation factor, (d) Cd content in the nutrient solution, (e) BCF of Cd in rice shoots, and (f) BCF of Cd in rice roots. Figure 9 This invention relates to the distribution, chemical forms, and subcellular localization of Cd in the aboveground parts and roots of rice, wherein (a) the total cadmium content in the nutrient solution, roots, and aboveground parts; (b) the extractable chemical forms of Cd in rice stems; (c) the extractable chemical forms of Cd in rice roots; (d, e) the subcellular distribution of Cd in rice stems (cell walls, organelles, and soluble parts); and (f, g) the subcellular distribution of Cd in rice roots (cell walls, organelles, and soluble parts). Figure 10 The present invention relates to the speciation of selenium in the aboveground parts and roots of rice under cadmium stress, wherein (a, b) are the proportions of selenium compounds in rice stems, (c) are the absolute concentrations of selenium compounds in rice stems, (d, e) are the proportions of selenium compounds in rice roots, (f) are the absolute concentrations of selenium compounds in rice stems, and (g, h) are representative chromatograms of selenium compounds in rice stems and roots under CdSeNP-3 treatment. Figure 11 This invention relates to the effect of adding SeNPs on the antioxidant activity of rice under Cd stress, wherein (a, b, c) are the contents of H2O2, SOD and MDA in the aboveground parts of rice, (d, e, f) are the activities of CAT, POD and GSH in the rice stems, (g, h, i) are the contents of H2O2, SOD and MDA in the rice roots, and (j, k, l) are the activities of CAT, POD and GSH in the rice stems under Cd and CdSeNPs treatments. Detailed Implementation

[0031] In the description of this invention, terminology is used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. In the description of this invention, "a plurality of" means two or more, unless otherwise explicitly defined.

[0032] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials, reagents, or instruments used, unless otherwise specified by the manufacturer, are all commercially available; the conditions not specified in the examples are all performed under conventional conditions or conditions recommended by the manufacturer. Furthermore, this invention does not limit the source of the raw materials used; unless otherwise specified, the raw materials used in this invention are all commercially available products commonly found in this technical field. Data from control experiments using non-biological selenium (i.e., exogenously added selenium) can also be included.

[0033] The ITS sequence of *Chlorella sorokinense* SZ2-1 is shown in SEQ ID NO.1. The RcbLZ sequence of *Chlorella sorokinense* SZ2-1 is shown in SEQ ID NO.2. The tufAF sequence of *Chlorella sorokinense* SZ2-1 is shown in SEQ ID NO.3.

[0034] SEQ ID NO.1:

[0035] SEQ ID NO.2: 。

[0036] SEQ ID NO.3: ATTATGTAAAAACATGATTACAGGTGCAGCACAAATGGACGGTGCAATTCTTGTTGTTTCTGGTGCTGATGGTCCAATGCCACAAACAAAAGAACATTTACTGTTAGCTAAGCAAGTTGGCGTTCCAAATATTGTTGTATTTTTAAATAAAGAAGATCAAGTAGATGATGCTGAATTATTAGAACTTGTTGAACTTGAAATTCGCGAAACATTAGATAAATATGAATTTCCGGGTGATGAAATTCCAATTATCGCCGGATCTGCTCTTTTAGCTTTAGAAGCATTATCAGAAAATCCTCAAATTAAACCAGGTGATAATAAATGGGTTGATAAAATTTATAACCTCATGGATCAGGTTGATGCTTATATTCCAACACCACAACGTGAAACAGATAAACCATTCTTAATGGCAGTAGAAGATGTATTTTCAATTACTGGGCGTGGTACTGTTGCTACAGGACGTGTAGAACGTGGCTGTGTTAAAATCGGTGATACTGTTGAACTCGTAGGTTTACGTGATACAAAAACAACAACAGTAACTGGTTTAGAAATGTTCCAAAAAACATTAGAGGAAAGTGTTGCTGGTGATAACGTAGGGATTTTACTTCGTGGTGTTCAAAAAACAGATATTGAGCGCGGTATGGTTCTTGCAAAACCAGGAAGCATTACACCTCACACAAAATTTGAAGCTCAAGTCTATGTTTTAACAAAAGAAGAGGGCGGTCGTCATACTCCATTTTTCCCAGGATATCGACCACAATTTTACGTTCGTACAACAGACGTAACAGGTAAAATTGAATCTTTCCGCGCAGATGATGATAGCGCAACACAAATGGTAATGCCAGGTGACCGTGTGAAAATGATTGTGAACTTATC。

[0037] Example 1 1. Experimental procedures 1.1 Microalgae cultivation microalgae Chlorella sorokiniana SZ2-1 algal strain (Chlorella sorokinense) was streaked onto BG11 solid agar plates to obtain single algal colonies, which were then incubated upside down in a light incubator at 25°C with a light / dark cycle of 16 / 8 hours. After visible single algal colonies had grown, they were selected and transferred to 300 mL of sterile BG11 liquid medium supplemented with glucose (20 g / L), antibiotics Amp (100 mg / L), and Cef (250 mg / L). The cultures were then incubated for 7 days at 25°C and 150 rpm in a shaker with a light intensity of 3000 lux and a 16-hour light / 8-hour dark cycle.

[0038] 1.2 Synthesis of SeNPs Figure 2 a illustrates the method for synthesizing SeNPs. When Chlorella sorokiniana Optical density (OD) of SZ2-1 culture 680 When the pH reached 4.0, the algae were collected by centrifugation at 12,000 rpm for 12 minutes at 4°C. The resulting precipitate was resuspended in phosphate-buffered saline (PBS) and then sonicated at 100 W for 60 minutes, with the temperature maintained at 4°C on ice to prevent protein denaturation. The sonicated suspension was centrifuged again at 12,000 rpm for 12 minutes to remove cell debris. The supernatant containing proteins, polysaccharides, and other bioactive compounds was collected and washed 3 to 5 times with PBS to remove impurities. The PBS solution (pH 7.4) was prepared by dissolving 8 g / L NaCl, 0.2 g / L KCl, 1.44 g / L Na₂HPO₄, and 0.24 g / L KH₂PO₄ in distilled water. In the synthesis of selenium nanoparticles (SeNPs), sodium selenite (Na₂SeO₃) at concentrations of 10, 20, 50, 100, 200, and 400 mg / L was added to the extracted algal supernatant, and then incubated in a shaking incubator at 25°C with continuous stirring at 180 rpm under a 16-hour light / 8-hour dark cycle and a light intensity of 30,000 lux. After 7 days of incubation, the color of the reaction solution changed from yellow-orange to deep red, indicating that Na₂SeO₃ was reduced to elemental SeNPs. Based on molar mass conversion, 10, 20, 50, 100, 200, and 400 mg / L of sodium selenite correspond to selenium ion concentrations of 4.57, 9.13, 22.83, 45.66, 91.31, and 182.63 mg / L, respectively.

[0039] 1.3 Characterization and Observation of SeNPs Characterization of SeNPs was performed using a combination of spectroscopic and microscopic analyses. To identify the surface functional groups involved in stabilization, KBr pellets were prepared at 4000–500 cm⁻¹.-1 Fourier transform infrared spectroscopy (FTIR) was performed within the spectral range of the SeNPs. To further analyze the particle size, morphology, and distribution characteristics of the SeNPs, scanning electron microscopy (SEM, Apreo 2 S, Thermo Fisher Scientific), energy-dispersive X-ray spectroscopy (EDS, ULTIM MAX65, Oxford) and transmission electron microscopy (TEM, H-7650) were used.

[0040] For SEM imaging, SeNPs were collected by centrifugation, washed three times with sterile water, and fixed overnight in 2.5% glutaraldehyde at 4°C. After fixation and removal of glutaraldehyde, the samples were dehydrated by a series of fractionated ethanol solutions (30%, 50%, 70%, 90%, 100%), each for 15 minutes. The dehydrated SeNPs were transferred to a silicon wafer, adhered to the sample stage with conductive adhesive, and sputter-coated with gold prior to analysis. Interfacial charges were determined by energy dispersive spectroscopy (EDS) coupled with SEM, and their hydrodynamic dimensions were determined using a Nanotrac Wave II dynamic light scattering (DLS) analyzer (Microtrac GmbH, Germany). For TEM negative staining analysis, quantitative nanoparticle suspensions were aspirated, air-dried on a copper grid, and observed in an H-7650 transmission electron microscope.

[0041] 1.4 Plant growth conditions and experimental design To investigate the remediation efficiency of biogenic SeNPs for Cd, a rice cultivation experiment was conducted from September 2024 to December 2025 at the Sichuan Institute of Urban Agriculture, Chinese Academy of Agricultural Sciences (N 30° 24′30″, E 104° 7′30″). Seeds were first sterilized with 10% H₂O₂ solution for 10 minutes, followed by thorough rinsing with deionized water. The sterilized seeds were placed in seedling trays containing distilled water to promote germination. Seven days later, seedlings were cultured for two weeks in a 1 / 4 concentration of Kimura nutrient solution at a constant ambient temperature of 25°C, after which they were transferred to a light intensity of 400 μmol / m². -2 s -1 The seedlings were cultured for 7 days in a 1 / 2 concentration Kimura nutrient solution with a photoperiod of 16 hours light / 8 hours darkness and a relative humidity of 75%, and the pH of the nutrient solution was adjusted to 6.0. Afterward, one-month-old seedlings were exposed to full-concentration Kimura nutrient solution, and 5, 10, 15, and 20 mg / L of CdCl2·2.5H2O were added respectively (i.e., Cd-5, Cd-10, Cd-15, and Cd-20, with calculated Cd concentrations of 2.46, 4.92, 7.38, and 9.85 mg / L based on molar mass) to detect Cd. 2+ The toxicity threshold.

[0042] The final treatment concentration was 10 mg / L Cd, with different concentrations of SeNPs added for combined treatments: (CdCl2·2.5H2O, 1 mg / L SeNPs), (CdCl2·2.5H2O, 3 mg / L SeNPs), and (CdCl2·2.5H2O, 5 mg / L SeNPs), with each treatment repeated three times. In addition, treatments containing only 1 mg / L, 3 mg / L, and 5 mg / L SeNPs were set up as positive controls, and an untreated control without Cd and SeNPs was established.

[0043] 1.5 Determination of plant biomass and chlorophyll fluorescence parameters Rice plants were rinsed three times with distilled water and then blotted dry with absorbent paper. The length, fresh weight, and dry weight of roots and shoots were measured. To investigate changes in root microstructure, treated roots were fixed with formaldehyde-acetic acid-ethanol (FAA) fixative, double-stained with saffron O-fast green FCF, and frozen sections were observed under a microscope. Chlorophyll (Chl a and b) and carotenoid contents were determined using existing techniques. Briefly, 0.1 g of fresh stems and leaves were weighed and placed in a 2.0 mL polypropylene centrifuge tube containing 1.0 mL of 99% ethanol. The centrifuge tube was vortexed for 30–60 s to ensure sample homogeneity, followed by centrifugation at 10,000 rpm for 2 minutes. 200 μL of the supernatant was transferred to a microplate, and absorbance was recorded at 470 nm, 649 nm, and 665 nm using a UV spectrophotometer (Spark, TECAN, Männedorf, Switzerland). The pigment concentration (μg / mL) in the extract was calculated according to the following equation: Chl a=13.36×A 665 –5.19×A 649 …(1) Chl b=27.43×A 649 –8.12×A 665 …(2) Carotenoids = (1000 × A) 470 –2.13×Chl a–97.64×Chl b) / 209…(3) Since the extraction system consisted of 0.1 g of fresh tissue added to 1.0 mL of extraction solution, the pigment content per gram of fresh weight (μg / g FW) was calculated as follows: the obtained concentration (μg / mL) was multiplied by the extraction volume and divided by the weight of the stem tissue. Chlorophyll fluorescence parameters of rice stems were measured after 15 minutes of dark adaptation. Photosynthetic efficiency indices included the maximum efficiency of optical system II (Fv / Fm), non-photochemical quenching [Y(NPQ)], actual photochemical efficiency [Y(II)], and the relative electron transfer rate (ETR) of the stem was determined.

[0044] 1.6 Quantitative analysis of Cd and Se content Cadmium and selenium content was determined using acid digestion. In short, 0.5 g (1 mL liquid) of sample was accurately weighed into a digestion container. A mixture of 5 mL concentrated nitric acid (HNO3) and 2 mL hydrogen peroxide (H2O2) was added, and the container was placed in a microwave digestion system. The digestion program was set as follows: uniformly increase the temperature to 120 °C over 5 minutes and hold for 5 minutes; uniformly increase the temperature to 150 °C over 10 minutes and hold for 5 minutes; finally, reach 180–190 °C over 5 minutes and hold for 15–20 minutes. After digestion, the solution was heated to 120 °C on an acid evaporator until nearly dry (a small droplet is permissible). Then, 5 mL of 6 mol / L hydrochloric acid (HCl) was added, and the mixture was heated on a hot plate below 120 °C until the solution became clear and colorless with the appearance of white fumes. The solution was cooled to room temperature, quantitatively transferred to a 10 mL volumetric flask, diluted to the mark with deionized water, and thoroughly mixed for subsequent analysis. Cd and total Se content were determined using ICP-MS (Agilent 8900 Triple-Quad, Agilent Technologies, USA). Bioaccumulation factor (BCF) and translocation factor (TF) were derived to assess uptake and translocation behavior. BCF was calculated as the ratio of total Cd concentration in the plant (roots and stems) to the total Cd concentration in the nutrient solution. Similarly, TF was calculated as the ratio of total Cd concentration in the roots and stems.

[0045] 1.7 Subcellular distribution of Cd For subcellular distribution analysis, a total of 1 g of fresh roots and stems / leafs were homogenized in 30 mL of pre-cooled extraction buffer (10 mL) containing 50 mM Tris-HCl (pH 7.5), 250 mM sucrose, and 1.0 mM dithiothreitol (DTT). The resulting homogenate was centrifuged at 3000 rpm for 15 min, and the resulting solid residue was designated as the cell wall fraction. Subsequently, the supernatant was centrifuged at 15000 rpm for 30 min to obtain organelle fractions (precipitates) and soluble fractions (supernatant). The three subcellular fractions were washed with 5% HNO3 into Erlenmeyer flasks and then evaporated to near dryness on a graphite plate at 60 °C. The subcellular fractions were digested using a mixture of HNO3 and HClO4 at a ratio of 4:1. The Cd content in these three fractions was determined by ICP-MS (Agilent 8900 Triple-Quad, Agilent Technologies, USA). 2+ The concentration.

[0046] 1.8 Extraction and quantification of extractable chemical forms of cadmium Chop 1 g of sample and grind it into a fine slurry using 20 mL of extraction buffer. Transfer the homogenate to a 50 mL centrifuge tube and extract by shaking at 25°C for 18 hours, followed by centrifugation at 5000 g for 10 minutes. Collect the supernatant, resuspend the residue in an equal volume of fresh extractant, and perform three additional extraction cycles at 2-hour intervals under the same conditions. After the final extraction, combine all supernatants in a 150 mL Erlenmeyer flask. Extract the residue sequentially with solvents of increasing polarity to separate different Cd fractions: 80% ethanol for extraction of inorganic salts (e.g., nitrates, chlorides) and amino acid salts; deionized water for extraction of water-soluble organic salts; 1 mol / L NaCl for extraction of pectin, protein-bound, or adsorbed heavy metals; 2% acetic acid for extraction of water-insoluble heavy metal phosphates; and 0.6 mol / L hydrochloric acid for extraction of oxalates. The final residue contains residual heavy metals. The Cd content in each fraction (supernatant and residue) was quantified using ICP-MS (Agilent 8900 Triple-Quad, Agilent Technologies, USA).

[0047] 1.9 Assessment of oxidative stress markers and antioxidant enzyme activity Fresh roots and stems of rice plants were ground into a fine powder using liquid nitrogen, extracted with phosphate buffer (0.05 mol / L, pH 7.8) in an ice bath, and centrifuged at 12,000 rpm (4°C) for 10 minutes. The supernatant was used to analyze the enzyme activities of catalase (CAT), superoxide dismutase (SOD), and peroxidase (POD), as well as the contents of glutathione (GSH), hydrogen peroxide (H2O2), and malondialdehyde (MDA) (catalog numbers G0101W48, G0107W48, G0105W48, G0206F, G0168W, G0109W48; Geruisi, Jiangsu). Each sample was analyzed in at least three replicates.

[0048] 1.10 Selenium speciation analysis using HPLC-ICP-MS Selenium speciation in rice roots and stems exposed to SeNPs and Cd+SeNPs was determined using HPLC-ICP-MS. HPLC-ICP-MS (Agilent 8900 Triple Quad, Agilent Technologies, USA) was coupled to an HPLC Agilent ZORBAX SB Aq reversed-phase column (4.6 mm × 250 mm, 5 μm) at a flow rate of 1.0 mL / min. Selenium standards used included MeSeCys, SeCys2, SeMet, Se(IV), and Se(VI). 25 mg of sample was accurately weighed into a 50 mL centrifuge tube, and 10 mg of protease XIV, 10 mg of alkaline protease, 10 mL of water, and 20 μL of 2-hydroxyethylthiol were added sequentially. Extraction was then performed by sonication at 25 °C and 150 W for 40 min, followed by centrifugation at 4 °C and 8000 r / min for 10 min. The resulting supernatant was filtered through a 0.22 μm filter membrane into a sample vial for the determination of selenium speciation in the solution.

[0049] 2. Test Results 2.1 Synthesis and Characterization of SeNPs when Chlorella sorokiniana When Na₂SeO₃ was added to the SZ₂-1 extract at concentrations ranging from 10 to 400 mg / L, the resulting SeNPs exhibited a significant color change. At 10 mg / L, the solution was milky white, and no signs of SeNP formation were observed. Similarly, with increasing concentrations, only a faint orange hue was observed at 20-50 mg / L, indicating incomplete reduction; the solution turned orange-red at 100 mg / L; and a deep red color and complete reduction were observed at 200 mg / L. Although a deep red suspension was also produced at higher concentrations (400 mg / L), precipitation occurred at the bottom of the tube, indicating uncontrolled particle growth and aggregation. Figure 1 a).

[0050] like Figure 1As shown in Figures bd, the microalgae SZ2-1 was observed from its microscopic morphology, chemical element distribution, and molecular functional group structure. The results showed that at the lowest concentration of 10 mg / L, the PDI was 0.0108, but no measurable particles were detected (hydrodynamic size 0 nm), and the Zeta potential was nearly neutral at 0.47 mV. However, in the range of 20–100 mg / L, the PDI remained low (ranging from 0.026 to 0.057), while the Zeta potential remained positive, increasing from +11.3 mV to +129.2 mV. When the concentration was 200 mg / L, the synthesized SeNPs exhibited a moderate PDI (0.119) and significant charge reversal, with a negative Zeta potential reaching -71.1 mV. At the highest concentration of 400 mg / L, the largest particles were formed, with an average size of 527.5 nm, exhibiting a highly polydisperse distribution (PDI of 0.639) and an extremely high positive Zeta potential (+203.4 mV). With increasing sodium selenite concentration, the hydrodynamic diameter increased, the PDI value rose, and the Zeta potential shifted towards a positive value, indicating decreased stability and aggregation.

[0051] like Figure 2 As shown in bi, its elemental composition and the presence of elemental selenium were analyzed by energy dispersive spectroscopy (EDS). Fourier transform infrared spectroscopy (FTIR) was performed at approximately 3200 cm⁻¹. -1 A distinct selenium stretching band (O–H stretching) was observed, a characteristic peak of the hydroxyl-rich encapsulating agent on the SeNP surface. Dynamic light scattering (DLS) analysis showed that the SeNPs prepared at 200 mg / L had the smallest average hydrodynamic diameter (365 nm). Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) imaging confirmed the formation of spherical monodisperse nanoparticles with diameters of 100–150 nm at 200 mg / L. Furthermore, elemental distribution maps showed that selenium and carbon were the major elements. Therefore, all subsequent experiments used a sodium selenite concentration of 200 mg / L, as at this condition, monodisperse, high-quality SeNPs could be prepared by utilizing the reduction and encapsulation capabilities of algal biomass itself.

[0052] 2.2 Effects of cadmium on rice growth and photosynthetic pigments Experimental results showed that, compared with the control (CK), Cd exposure inhibited the growth of both shoots and roots in a concentration-dependent manner. Figure 3 a). For example Figure 3 In diagram b, the upper horizontal section represents the above-ground data, and the lower horizontal section represents the underground data. Specifically, Figure 3In c and d, from left to right, they represent CK, Cd-5, Cd-10, Cd-15, and Cd-20, respectively. After treatment with 5 mg / L CdCl2 for 25 days, compared with the control group, plant height decreased by 45.8% (19.8±3.1 cm), root length shortened by 34.2% (13.1±1.6 cm), fresh weight of aboveground parts decreased by 54.6% (1.09±0.10 g), fresh weight of roots decreased by 49.8% (0.84±0.04 g), dry weight of aboveground parts decreased by 45.7% (0.48±0.04 g), and dry weight of roots decreased by 33.4% (0.20±0.02 g). Figure 3 a, b, c, d. As Cd concentration increased to 10-20 mg / L, the growth inhibition effect became more pronounced. Compared to the control (CK), plant height decreased by 51.2-67.4% (17.8-11.9 cm), aboveground fresh weight decreased by 65.6%-82.4% (0.82-0.42 g), and root fresh weight decreased by 52.0-64.4% (0.80-0.59 g), while aboveground dry weight decreased by 54.0-73.9% (0.41-0.23 g), and root dry weight decreased by 40.5-59.5% (0.19-0.13 g). Similarly, Cd stress reduced photosynthetic pigment activity. Compared to the CK, Cd-5 to Cd-20 treatments reduced chlorophyll a by 8.7%-21.3%, chlorophyll b by 30.5-68.3%, and carotenoids by 11.7-86.3%, as shown in the figure. Figure 3 As shown in e, f, and g. Among all Cd treatments, Cd-10 (10 mg / L) was selected for subsequent rice SeNPs remediation studies because higher concentrations of Cd would cause lethal stress to the plants.

[0053] 2.3 The effect of SeNPs on improving growth phenotype and pigment activity After 30 days of treatment with 10 mg / L Cd, compared with the control (CK), plant height decreased by 26.3% (21.97±1.09 cm), root length shortened by 36.7% (10.63±0.37 cm), aboveground fresh weight decreased by 53.5% (0.70±0.08 g), root fresh weight decreased by 54.8% (0.41±0.02 g), aboveground dry weight decreased by 55.9% (0.64±0.08 g), and root dry weight decreased by 30.2% (0.11±0.01 g). Figure 4 As shown in Figure 4b (the data above the horizontal line is the data of the above-ground part, and the data below the horizontal line is the data of the underground part).

[0054] Meanwhile, the results showed that adding SeNPs could alleviate the inhibitory effect of Cd stress by promoting the development of both aboveground parts and roots. Compared with the Cd10 control group, the aboveground fresh weight of the CdSeNP-1, CdSeNP-3, and CdSeNP-5 treatment groups increased by 103.6%, 106.4%, and 76.8%, respectively, and the root fresh weight increased by 124.4%, 139.0%, and 93.2%, respectively. Figure 4 As shown in c and d (the bar charts represent CK, SeNP-1, SeNP-3, SeNP-5, Cd-10, CdSeNP-1, CdSeNP-3, and CdSeNP-5 in that order), the treatment with only SeNPs showed a dose-dependent promoting effect compared to CK. Plant height increased by 20.4%, 14.9%, and 13.4% in the SeNP-1, SeNP-3, and SeNP-5 groups, respectively; aboveground fresh weight increased by 31.8%, 43.1%, and 17.8%, respectively; and root fresh weight increased by 53.3%, 63.2%, and 39.3%, respectively. CdSeNP-3 showed superior Cd tolerance compared to CdSeNP-1 and CdSeNP-5, and was therefore selected as the main focus of this study. Compared to CK, Cd treatment significantly reduced Chl a, Chlb, and carotenoid contents by 30.9%, 36.1%, and 16.9%, respectively. However, compared with Cd treatment alone (Cd10), the combined treatment with SeNP-3 and Cd (CdSeNP-3) significantly increased the contents of Chl a, Chl b, and carotenoids by 73.9%, 99.1%, and 40.8%, respectively. Figure 4 As shown in e, f, g.

[0055] Chlorophyll fluorescence is an effective and non-destructive method for studying the photosynthetic system under stress conditions. Cd stress significantly reduced ETR by 15.7% relative to CK, while SeNPs increased ETR activity by 26.2%. Compared with CK, Cd treatment significantly increased Y(NPQ), reaching 0.622±0.033, an increase of 12.9%. Figure 5 As shown in a and b. Compared to the Cd-only group, the co-application of SeNPs and Cd significantly reduced Y(NPQ) (26.2%), restoring the photosynthetic apparatus to a non-stress state. Furthermore, compared to the control group, Y(NO), reflecting photo-oxidative damage in photosystem II, significantly increased by 39.3% under Cd stress, while the addition of SeNPs reduced Y(NO) activity by 19.2%. Cd toxicity altered root morphology, leading to visible losses in the aerenchyma (AE) and cortex (C), such as... Figure 6 As shown in b, SeNPs not only reduce the toxicity of Cd, but also help maintain the normal root morphology and structure of rice, such as... Figure 6As shown in c, the endoderm and cortex cells in Cd-treated rice roots exhibited significant damage, including weakened, degraded, and reduced cellular structures. In contrast, the addition of SeNPs maintained the endoderm and cortex cells of the SeNPs and CdSeNP-3 groups, as shown in Figure c. Figure 6 As shown in d.

[0056] 2.4 Accumulation of cadmium and selenium in rice tissues like Figure 7 As shown in a and b, in the treatments with only SeNPs added, the SeNP-5 treatment group had the highest selenium content in the stems, leaves, and roots, at 4.48±0.16 mg / kg and 20.56±0.90 mg / kg, respectively; followed by the SeNP-3 group (3.32±0.06; 15.43±0.86 mg / kg) and the SeNP-1 group (1.52±0.01; 7.41±0.34 mg / kg). The results of the CdSeNP-3 treatment showed that, compared with the Cd-free SeNP-3 group, the selenium content in the aerial parts decreased by 10.0%, while the selenium content in the roots increased by 13.6%. This indicates that Cd stress alters the selenium accumulation pattern.

[0057] In the CdSeNP-1, CdSeNP-3, and CdSeNP-5 treatment groups, the efficiency of selenium translocation to the aboveground parts decreased by 35.7%, 20.1%, and 25.9%, respectively. The medium concentration (CdSeNP-3) and low concentration (CdSeNP-1) treatments showed the largest decreases. Figure 7 As shown in c. It can be seen that the presence of Cd significantly reduces the Se transport efficiency at various SeNP concentrations.

[0058] Under Cd stress, the residual Se content in the solutions of the CdSeNP-1, CdSeNP-3, and CdSeNP-5 treatment groups decreased by 14.1%, 33.4%, and 48.2%, respectively. Figure 7 As shown in d. Figure 7 As shown in e and f, the BCF of the CdSeNP-3 treatment group increased by 31.1%, further indicating that the presence of Cd reduced the residual selenium content in the nutrient solution. Figure 8 As shown in a and b, after rice plants were exposed to Cd stress, large amounts of Cd accumulated in the roots and aboveground parts, with concentrations of 21.91 ± 0.97 mg / kg and 8.14 ± 0.64 mg / kg, respectively. The translocation factor (TF) was 0.367 ± 0.048, indicating that Cd migrated from the roots to the aboveground tissues. With increasing SeNP concentration, the Cd TF in the CdSeNP-1, CdSeNP-3, and CdSeNP-5 treatment groups decreased by 51.0%, 68.1%, and 85.4%, respectively, indicating that SeNPs effectively limited the translocation of Cd from the roots to the aboveground parts. Figure 8As shown in c. Nutrient solution analysis results showed that after SeNPs treatment, the Cd content in the solution significantly increased: CdSeNP-1 group was 9.59±0.32 mg / L (an increase of 778.9% compared to the Cd-treated groups), CdSeNP-3 group was 8.58±0.79 mg / L (an increase of 686.2%), and CdSeNP-5 group was 7.79 mg / L (an increase of 614.7%). Figure 8 As shown in d. In the Cd treatment group, the BCF of the roots and aboveground parts were 20.93±1.43 and 7.50±0.99, respectively, indicating that the roots were the main site of Cd accumulation. Figure 8 As shown in e and f, the combined application of SeNPs and Cd significantly reduced the Cd-BCF in the aboveground parts: the BCF in the CdSeNP-1 group was 0.24 ± 0.04, accounting for 3.2% of the total Cd (a reduction of 96.8%); the BCF in the CdSeNP-3 group was 0.21 ± 0.03, accounting for 2.8% of the total Cd (a reduction of 97.2%); and the BCF in the CdSeNP-5 group was 0.14, accounting for 1.9% of the total Cd (a reduction of 98.1%). In the roots, the Cd BCF in the CdSeNP-1, CdSeNP-3, and CdSeNP-5 treatment groups decreased by 93.2%, 89.9%, and 86.8%, respectively, indicating that SeNPs also reduced the bioaccumulation concentration of Cd in the root tissues of each treatment.

[0059] 2.5 Effects of SeNPs on Cadmium Distribution in Rice Compared with Cd alone, the Cd content in the nutrient solution increased by 21.93 ± 0.97 mg / L (an increase of 36.8%) after applying SeNPs, indicating a reduction in Cd absorption from the nutrient solution to the plant, with a decrease of 11.4% in the roots and 24.0% in the aboveground parts. Figure 9 As shown in a.

[0060] The chemical form of cadmium (Cd) is directly related to its toxicity. In the aboveground parts of rice, Cd in the Cd treatment group was mainly in the form of extractable form (bound by pectin and protein), accounting for 42.5%; followed by highly mobile inorganic extractable form (C2H5OH, 33.9%), extractable form (CH3COOH, 10.47%), residue (8.34%), H2O soluble form (4.71%), and HCl extractable form (0.05%). However, in the rice sprouts of the CdSeNP-3 treatment group, extractable form (49.2%) and residue (13.4%) of Cd were dominant. Figure 9b). In rice roots, the speciation of Cd in the Cd treatment group was as follows: NaCl extractable form (46.1%) > C2H5OH extractable form (23.8%) > residual form (16.4%) > CH3COOH extractable form (8.9%) > H2O soluble form (4.7%) > HCl extractable form (0.04%); while the CdSeNP-3 treatment group showed the following distribution: NaCl extractable form (47.2%) > residual form (25.2%) > C2H5OH extractable form (19.6%) > CH3COOH extractable form (5.8%) > H2O soluble form (2.2%) > HCl extractable form (0.04%). Figure 9 c). Compared with the Cd-treated group, the proportions of highly bioavailable components (C2H5OH extractable form + H2O soluble form) in rice stems and roots decreased to 32.4% and 21.8%, respectively, in the combined treatment group, while the proportions of immobilized components (CH3COOH extractable form + HCl extractable form + residue form) increased to 18.4% and 31.0%, respectively. Under Cd stress, Cd was mainly distributed in cell wall components, accounting for 49.6% (50.80±2.87 mg / kg) in roots and 44.2% (15.59±2.18 mg / kg) in aerial parts; followed by soluble components (39.70% in stems and 36.2% in roots) and organelle components (17.2% in stems and 12.10% in roots), such as... Figure 9 As shown in d and f, CdSeNP-3 treatment significantly altered the subcellular distribution of Cd: in the aerial parts, the proportion of Cd in the cell wall component increased by 7.3%, indicating that the cell wall is the main binding site for Cd; in the roots, the proportion of Cd in the soluble component (mainly composed of vacuoles) increased by 10.3%, while the proportion of Cd in the organelle component significantly decreased by 2.9%, indicating that SeNPs effectively protected root organelles from Cd toxicity. Figure 9 g). Under CdSeNP-3 treatment, the soluble fraction was the main Cd deposition component in the roots (47.20%); while in the aerial parts, Cd was mainly distributed in the cell wall component (50.4%), such as... Figure 9 As shown in e. Figure 9 In e and g, the single bar charts from top to bottom represent the percentages of soluble components, organelle components, and cell wall components, respectively.

[0061] 2.6 Speciation of selenium in rice roots and stems In summary, regardless of whether SeNPs were used alone or in combination with Cd, SeMet was the main form of selenium in rice roots and stems, accounting for 81.3-91.70% in roots and 44.4-80.01% in stems. Figure 10As shown in a, b, d, and e. Meanwhile, small amounts of SeCys2 (10.30%), Se(IV) (30.30%), and Se(VI) (14.9%) were also detected in the roots of rice treated with SeNPs alone; a small amount of Se(VI) (8.30%) was detected in the stems, such as... Figure 10 As shown in c and f. Furthermore, the addition of cadmium affected the distribution of selenium speciation. Compared to SeNPs treatment alone, combining SeNPs with Cd treatment reduced the content of SeMet in roots by 29.8%, but significantly increased its proportion by 80%; simultaneously, the content and proportion of Se(VI) decreased by 18.2% and 2.3%, respectively, while the content and proportion of other selenium speciations decreased by 25.7% and 11.2%, respectively, such as... Figure 10 As shown in g and h.

[0062] 2.7 Regulation of antioxidant defense by SeNPs under cadmium stress Cd stress significantly increased H2O2 and MDA levels, indicating that oxidative stress was induced. Compared with the control (CK), Cd treatment led to a 27.53% increase in H2O2 content and a 78.06% increase in MDA content in roots; the oxidative damage in the shoots was even more significant, with H2O2 and MDA levels increasing by 99.39% and 110.12%, respectively. Figure 11 As shown in a, b, g, and h. In the roots, application of SeNPs reduced H2O2 accumulation: compared with Cd treatment alone, the oxidative stress levels of the CdSeNP-1, CdSeNP-3, and CdSeNP-5 treatment groups decreased by 36.45%, 40.61%, and 42.09%, respectively. In the aerial parts, the degree of lipid peroxidation gradually decreased with increasing SeNP concentration. Compared with the Cd treatment group, the MDA content in the aerial parts of the CdSeNP-1, CdSeNP-3, and CdSeNP-5 treatment groups decreased by 69.82%, 87.78%, and 118.13%, respectively, with CdSeNP-5 showing the most significant effect. Compared with the control group (CK), Cd treatment significantly inhibited the activities of SOD (reduced by 12%), POD (reduced by 39%), CAT (reduced by 52.54%), and GSH (reduced by 12.57%) in the aerial parts. Figure 11 As shown in c, d, e, and f, the root system was more severely affected, with the above indicators decreasing by 19%, 24%, 67.06%, and GSH activity (59.41%), respectively. Figure 11 (i, j, k, l). Furthermore, compared to Cd treatment alone, CdSeNP-3 treatment significantly enhanced antioxidant activity in rice stems and roots: SOD increased by 17.86-20.85%, POD by 162.30-113.16%, CAT by 40.36-187.52%, and GSH by 29.70%-56.21%.

[0063] Compared with the control (CK), Cd treatment significantly inhibited the activity of antioxidant enzymes. In the aerial parts, the activities of SOD, POD, CAT, and GSH decreased by 12%, 39%, 52.54%, and 12.57%, respectively. Figure 11 c, d, e, f); the roots were more severely affected, with the above indicators decreasing by 19%, 24%, 67.06%, and 59.41%, respectively. Figure 11 (i, j, k, l). Furthermore, compared to Cd treatment alone, CdSeNP-3 treatment significantly enhanced antioxidant activity in rice stems and roots: SOD increased by 17.86%–20.85%, POD by 113.16%–162.30%, CAT by 40.36%–187.52%, and GSH by 29.70%–56.21%.

[0064] It should be noted that the specific embodiments described above are exemplary. Those skilled in the art can devise various solutions inspired by the disclosure of this invention, and these solutions all fall within the scope of this invention and its protection. Those skilled in the art should understand that this specification and its accompanying drawings are illustrative and not intended to limit the scope of the claims. The scope of protection of this invention is defined by the claims and their equivalents.

Claims

1. A strain of Chlorella sorokinensis ( Chlorella sorokiniana SZ2-1, characterized in that, The Sorokin Chlorella SZ2-1 was deposited at the China Center for Type Culture Collection on April 15, 2026, with accession number CCTCC NO: P202610. The Sorokin Chlorella SZ2-1 bioconverts inorganic selenium into nano-selenium, with an inorganic selenium ion concentration of 10-200 mg / L.

2. An algae preparation containing the Chlorella sorogenesis SZ2-1 as described in claim 1.

3. The algae-forming agent according to claim 2, characterized in that, The optical density value of *Chlorella sorogenesis* SZ2-1 in the algae preparation is not less than 4 at a wavelength of 680 nm.

4. The application of *Chlorella vulgaris* SZ2-1 as described in claim 1 in the preparation of nano-selenium, characterized in that... The Sorokin Chlorella SZ2-1 bioconverts inorganic selenium into nano-selenium, wherein the inorganic selenium is selenite.

5. The application according to claim 4, characterized in that, The nano-selenium is elemental selenium containing biological macromolecules.

6. The application according to claim 4, characterized in that, The selenite is one or more of sodium selenite, potassium selenite, barium selenite, and calcium selenite.

7. The method for biosynthesizing nano-selenium from *Chlorella vulgaris* SZ2-1 according to claim 1, characterized in that, Includes the following steps: After crushing Chlorella SZ2-1, it was mixed with a culture medium containing selenium compounds to obtain a mixture rich in nano-selenium.

8. The method according to claim 7, characterized in that, The selenium concentration in the culture medium of selenium-containing compounds is 1-200 mg / L.

9. The method according to claim 7, characterized in that, The culture conditions are 20-30℃ and 3000-30000 lux light intensity.

10. The method according to claim 7, characterized in that, The culture medium is BG11 liquid culture medium containing a carbon source.

Images