Lentinula edodes strain pingxiang 69, cultivation method and application thereof

Abstract

The present application relates to the technical field of edible mushroom breeding, and specifically discloses a Lentinula edodes strain Pingxiang 69, a cultivation method thereof and an application thereof. Compared with traditional main cultivars, the Lentinula edodes strain Pingxiang 69 provided by the present application realizes the synergistic optimization of growth cycle, yield, quality and disease resistance on the basis of retaining the excellent traits of traditional cultivars, and the biological conversion rate is greatly improved. In addition, the Lentinula edodes strain Pingxiang 69 also has the advantages of high temperature resistance and low rotten stick rate. The present application effectively solves the problems of low yield, easy mushroom explosion after the mushroom stick is placed on the shelf, poor mushroom yield in the high temperature period, poor stress resistance, and many deformed mushrooms of the existing Lentinula edodes, significantly improves the yield and quality of the Lentinula edodes, provides an excellent alternative variety for the edible mushroom industry, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of edible fungi breeding technology, and in particular to a shiitake mushroom strain, Pingxiang 69, and its cultivation method and application. Background Technology

[0002] Shiitake mushrooms are currently the most widely cultivated edible fungus in my country, and thanks to mature cultivation and management techniques, year-round supply of fresh mushrooms has been largely achieved. However, with the continuous expansion of the industry, structural contradictions in the upstream and downstream of the industrial chain have become increasingly acute. The concentrated release of domestic production capacity has led to a reversal in market supply and demand, resulting in fierce competition among homogeneous products. This current state of the industry has directly led to a significant compression of profit margins in the production and cultivation stages. How to reduce costs and increase efficiency through technological means has become a core issue for the industry's survival and development.

[0003] Currently, effective solutions to the aforementioned dilemmas mainly focus on two aspects: germplasm innovation and cultivation technology optimization. First, high-yielding and stress-resistant new varieties are selected to offset cost pressures by improving biotransformation efficiency. Second, cultivation techniques are optimized to improve product quality and stabilize cultivation profits. However, current progress in shiitake mushroom breeding cannot meet the urgent needs of industry iteration. Although there are numerous commercial varieties on the market, the vast majority are homogeneous, resulting in a severe shortage of germplasm resources.

[0004] In my country's current commercial cultivation, varieties such as 0912, F6, and 610 of shiitake mushrooms have long dominated, characterized by short mycelial life, medium to large leaf shape, and dense flesh. However, during long-term propagation, these strains have experienced increasingly severe aging and degeneration, leading to problems such as significantly reduced yield, severe rotting of mushroom logs during the fruiting period, failure to fruit at high temperatures, poor resistance to adverse conditions, and an increase in deformed mushrooms.

[0005] Therefore, there is an urgent need to provide a new strain of shiitake mushroom to solve the problems of low yield, easy rotting of mushroom logs during the fruiting period, failure to produce fruiting at high temperatures, high proportion of deformed mushrooms, and poor stress resistance of existing shiitake mushroom strains, thereby filling market gaps and promoting industrial upgrading. Summary of the Invention

[0006] In response to the problems of low yield, excessive fruiting after the spawn is placed on the shelf, poor fruiting rate during high temperature period, poor stress resistance, and many deformed mushrooms, this invention provides a shiitake mushroom strain Pingxiang 69 and its cultivation method and application.

[0007] To achieve the above-mentioned objectives, the present invention adopts the following technical solution: This invention provides a shiitake mushroom strain, Pingxiang 69, with the Latin name Lentinula edodes. This strain was deposited on April 21, 2026, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 42762.

[0008] The shiitake mushroom strain Pingxiang 69 provided by this invention, while retaining the excellent traits of traditional varieties, achieves synergistic optimization of growth cycle, yield, quality, and disease resistance, and significantly improves bioconversion rate. Furthermore, Pingxiang 69 exhibits outstanding performance in high-temperature tolerance and cultivation stability: it can fruit normally under high-temperature conditions of 28℃~32℃, which is 2℃~4℃ higher than traditional varieties, and has an extremely low rate of substrate rot under the substrate cultivation mode. The shiitake mushroom strain Pingxiang 69 possesses excellent stress resistance and broad ecological adaptability, making it suitable not only for conventional cultivation but also perfectly suited to the development needs of off-season summer mushroom production areas, with a very broad prospect for promotion.

[0009] This invention provides a shiitake mushroom cultivar, obtained by culturing the aforementioned shiitake mushroom strain Pingxiang 69.

[0010] This invention provides a method for preparing the above-mentioned shiitake mushroom spawn, comprising the following steps: The spores or fruiting bodies of the shiitake mushroom strain Pingxiang 69 were inoculated into the mother culture medium and cultured to obtain mother culture mycelium; The mother culture mycelium was inoculated into the original culture medium and cultured to obtain the original culture mycelium; The original mycelium was inoculated into the culture medium of the mushroom bag for cultivation to obtain the shiitake mushroom spawn.

[0011] Preferably, the formula of the mother culture medium includes: potato 180g / L~220g / L, glucose 15g / L~25g / L, KH2PO4 2g / L~4g / L, MgSO4·7H2O 0.4g / L~0.6g / L, agar 18g / L~22g / L, and natural pH.

[0012] Preferably, the original culture medium comprises the following components in the following mass ratio: 75%~80% sawdust, 17%~22% wheat bran, 0.5%~1.5% gypsum, 0.5%~1.5% brown sugar, with a water content of 55%~58% and a natural pH.

[0013] Preferably, the culture medium for the mushroom bags comprises the following components in the following mass ratios: 78%~79% sawdust, 20%~21% wheat bran, 1%~1.2% gypsum, with a moisture content of 58%~62% and a natural pH.

[0014] Preferably, the culture temperature of the mother mycelium and the original mycelium is 18℃~25℃.

[0015] Preferably, the culture temperature of the mushroom bags is 18℃~25℃.

[0016] Preferably, the relative humidity of the air during the cultivation of the mother mycelium and the original mycelium is 55%~60%.

[0017] Preferably, the relative humidity of the air in the culture bag is 55%~60%.

[0018] For example, during the cultivation of the mother culture mycelium, the original culture mycelium, and the culture bags, the carbon dioxide concentration needs to be controlled below 3500 ppm, and direct sunlight should be avoided.

[0019] This invention provides a shiitake fruiting body obtained by culturing the above-mentioned shiitake strain Pingxiang 69.

[0020] This invention provides a shiitake mushroom mycelium, obtained by liquid fermentation of the above-mentioned shiitake mushroom strain Pingxiang 69.

[0021] This invention provides the application of the above-mentioned Shiitake mushroom strain Pingxiang 69 in breeding.

[0022] This invention provides the application of the above-mentioned shiitake mushroom strain Pingxiang 69 in food processing.

[0023] The present invention provides a cultivation method for the above-mentioned shiitake mushroom strain Pingxiang 69, which includes the following steps: managing the fruiting of the spawn containing the shiitake mushroom strain. Attached Figure Description

[0024] Figure 1 This is a photograph of the antagonistic line between *Lentinula edodes* strain 69 and *Lentinula edodes* strain 0912 in the antagonistic test of Example 3 of the present invention; Figure 2 This is a photograph of the antagonistic line between *Lentinula edodes* strain 69 and *Lentinula edodes* strain F6 in the antagonistic test of Example 3 of the present invention; Figure 3 This is a photograph of the antagonistic line between strains Pingxiang 69 and Shiitake 610 in the antagonistic test of Example 3 of the present invention; Figure 4 The first flush of fruiting body of the Pingxiang 69 strain provided by the present invention is shown in the figure. Figure 5 The maximum likelihood phylogenetic tree diagram constructed based on the ITS sequence of the Pingxiang 69 strain provided by this invention; Among them, 1 is the 69th strain of *Lentinula edodes*, 2 is the 0912th strain of *Lentinula edodes*, 3 is the F6th strain of *Lentinula edodes*, and 4 is the 610th strain of *Lentinula edodes*. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0026] Unless otherwise specified, the raw materials and reagents used in this invention are all conventional commercially available products; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0027] Example 1 1. Materials 1.1 Parental strains: Shiitake mushroom varieties 0912, F6 and 610 from northern regions; strains preserved in liquid nitrogen by Pingquan Xicai Applied Fungi Technology Development Co., Ltd.

[0028] 1.2 Culture medium formulation The mother culture medium consists of the following formula: 200 g / L potato, 20 g / L glucose, 3 g / L KH2PO4, 0.5 g / L MgSO4·7H2O, 20 g / L agar, and natural pH.

[0029] The original culture medium consists of the following raw materials by weight percentage: 78% sawdust, 20% wheat bran, 1% gypsum, and 1% brown sugar; the moisture content of the original culture medium is 55%~58%, and the pH is natural.

[0030] The culture medium for the cultivar consists of the following raw materials by weight percentage: 78% sawdust, 20% wheat bran, 1% gypsum, and 1% brown sugar; the moisture content of the culture medium is 55%~58%, and the pH is natural.

[0031] The substrate culture medium consists of the following raw materials by weight percentage: 79% sawdust, 20% wheat bran, and 1% gypsum. The moisture content of the substrate culture medium is 55%~58%, and the pH is natural.

[0032] Example 2 2. Breeding of Shiitake Mushroom Strain Pingxiang 69 In a sterile laminar flow hood, mycelial blocks containing culture medium from the parent strains of shiitake mushrooms, 0912, F6, and 610, were cut and placed in equal amounts in the same sterilized mortar. Sterile quartz sand (30 wt% of the total mycelial block weight) was added for initial grinding until the mycelial blocks were broken into small pieces. Mannitol solution (250 mL, 50 g) was then added, and grinding continued until a thin porridge-like consistency was achieved with a particle size not exceeding 0.5 mm. The homogenate was transferred to a sterile blank agar plate, shaken to mix, and spread into an 8 mm thick layer. After sealing the edges, the plate was irradiated in a microwave oven (2450 MHz, 700 W) for 11 seconds. The treated plates were then incubated in a 24°C biochemical incubator in the dark for 18–20 days. When white colonies appear on the surface of the plate, pick a single colony and transfer it to the center of a new mother culture medium plate. Propagate the colony under the conditions of 24℃, 55% relative humidity, CO2 concentration <1500ppm, and light intensity of 100~150 lux. After the mycelium germinates, culture for 3 days and remove the inoculation blocks that have not germinated or have stunted growth. Inoculate the remaining strains onto a new mother culture medium plate and culture for 7 days. Remove plates with abnormal morphology (such as angular deformation, fan-shaped deformation, uneven edges) or weak growth. Then, re-inoculate the strains onto a new plate medium. When the mycelium has almost completely covered the culture dish, remove plates with uneven edges, abnormal color, color change, or aging inoculation points (patches, red oozing, shrinkage).

[0033] Based on mycelial phenotypic characteristics, including growth potential, color, growth rate and morphological structure, the fusion hybrid strains were initially screened, and a total of 18 candidate strains were obtained. After they were fully grown in 90 mm agar plates, they were subcultured and transferred to establish the 18 test strains.

[0034] Example 3 2. Breeding of Shiitake Mushroom Strain Pingxiang 69 2.1 Antagonistic Identification of Fusions and Parents Eighteen initially screened bacterial strains were subjected to confrontation culture with their parents (0912, F6, and 610), and the authenticity of hybridization was determined by observing whether antagonistic lines appeared. Following a strategy of preserving differences and eliminating similarities, strains exhibiting genetic recombination were selected. The results showed that 16 fusion strains formed clear antagonistic lines with their parents in the later stages of culture.

[0035] 2.2 Antagonistic Screening Between Fusion Substances To further eliminate duplicate mutants, mutual antagonism tests were conducted on the above 16 strains. Based on the 30% duplication rate threshold, 6 new strains were finally identified.

[0036] 2.3 Microscopic examination of clamp-like structures Microscopic morphological observations were performed on the six candidate strains, and the proportion of clamp connections was counted in 50 fields of view. The results showed that the clamp connection rate of all six strains exceeded 90%, indicating that they possessed normal binucleation characteristics and fruit-setting ability.

[0037] Example 4 3. Propagation and cultivation of Shiitake mushroom strain Pingxiang 69 Six newly selected strains (XGZJ1~XGZJ6) were subjected to fruiting cultivation experiments. First, the mycelia of each strain were inoculated onto a mother culture medium and cultured at a constant temperature of 25℃ to obtain the mother culture. Then, the mother culture was transferred to a primary culture medium and cultured at 25℃ and 65% relative humidity until the mycelia were fully colonized, thus obtaining the primary culture. Next, the primary culture was inoculated onto a cultivation culture medium and cultured under the same conditions until the mycelia filled the bags, thus obtaining the cultivation culture. Cultivation was carried out using polyethylene folded-corner bags with dimensions of 17cm×60cm×0.005cm. 1000 bags were inoculated for each strain, and each bag was filled into a mushroom bag for cultivation. 1100g of substrate was sterilized at 100℃ under normal pressure for 24 hours. When the substrate temperature dropped below 20℃, the spawn was inoculated and transferred to a mycelium incubation room with relative humidity below 65% and temperature of 25℃. After the mycelium filled the bag and formed nodular protrusions, large holes were pierced. The mycelium incubation period was set at 120 days. After the emergence of signal mushrooms, the bags were shelved and managed according to conventional methods. The focus was on the proportion of rotten substrate during the fruiting stage and setting different fruiting temperature conditions to observe the upper limit of the fruiting temperature for the new variety and the control parent strains. Parent strains 0912, F6, and 610 were set as controls.

[0038] The mycelium growth and fruiting of different shiitake mushroom strains were monitored, and the monitoring results are shown in Table 1: Table 1 As shown in Table 1, among the newly obtained hybrid strains, XGZJ5 exhibits a short development cycle and low contamination rate. Furthermore, its fruiting rate and yield per bag are significantly better than those of the other hybrid strains and the parent strain, demonstrating the heterosis of this strain.

[0039] The fruiting body characteristics, single mushroom weight, and biological transformation rate of strain XGZJ5 and its parent strain were monitored, and the results are shown in Table 2. Table 2 The data in Table 2 show that the fruiting body morphology of the new hybrid strain XGZJ5 is larger, thicker, and shorter than that of the parent strain, which better meets the current market demand. In terms of biological conversion rate, the XGZJ5 strain is more outstanding, reaching 90.7%, which is significantly better than the parent strain, and the yield increase effect is significant, fully demonstrating the hybrid vigor.

[0040] The proportion of high-quality mushrooms from the first flush of mushrooms obtained by cultivating hybrid strain XGZJ5 and parent strains was tested, and the results are shown in Table 3. Table 3 The standards for high-quality mushrooms are: cap diameter of 35mm or more, round shape, cap edge curl of not less than 2mm, and stem length of less than 35mm; mushrooms other than high-quality mushrooms are considered ordinary mushrooms. As shown in Table 3, the proportion of high-quality mushrooms of hybrid strain XGZJ5 can reach 94%, which is significantly higher than that of the parent strain.

[0041] The rate of mushroom log rot during the fruiting process of hybrid strain XGZJ5 and its parent strain was monitored, and the results are shown in Table 4. Table 4 Note: The statistics on rotten mushroom sticks are based on the standard of no mushroom production; the data in the table are cumulative values.

[0042] Monitoring the rot rate of mushroom logs throughout the entire fruiting cycle, the rot rate of XGZJ5 was only 1.1% throughout the entire fruiting cycle, while the rot rate of the parent strains all exceeded 10%.

[0043] The fruiting rates of hybrid strain XGZJ5 and its parent strain under different high-temperature conditions during the fruiting process were monitored, and the results are shown in Table 5. Table 5 Note: The maximum temperature for fruiting of traditional varieties is 28℃. If the temperature exceeds 28℃, mushroom buds will not form on the substrate.

[0044] As the fruiting temperature gradually increases, it becomes increasingly difficult for mushroom buds to form. The parent strain basically does not form mushroom buds after the temperature exceeds 28℃, while strain XGZJ5 can still form mushroom buds normally at 32℃, and the fruiting rate reaches 89%, which exceeds the fruiting limit temperature of the parent strain by 4℃. It can produce fruit normally in the high-temperature season, fill the market gap, and improve cultivation benefits.

[0045] The clamping structures of hybrid strain XGZJ5 and its parents 0912, F6, and 610 were observed under a microscope. The tested strains were inoculated onto mother culture plates, and after the hyphae had fully grown, 50 fields of view were randomly selected for microscopic examination of the clamping structures to assess the fruiting potential of the strains. Statistical analysis of the microscopic data showed that the detection rates of clamping structures in the 50 fields of view for XGZJ5, 610, 0912, and F6 were 92%, 74%, 76%, and 68%, respectively.

[0046] The hybrid strain XGZJ5 has a mycelial growth cycle of 92 days, a first flush harvest time of 104 days, a fruiting rate of 99%, a contamination rate of only 0.5%, a cap thickness of 20-24 mm, a cap diameter of 48-68 mm, a stipe length of 20-25 mm, a single mushroom weight of 38-45 g, a bioconversion rate of 90.7%, and a high-quality mushroom ratio of 94%. Compared with its parent strains 610, 0912, and F6, hybrid strain XGZJ5 (tentative name: Pingxiang 69) exhibits significant hybrid vigor in overall traits: a shorter growth cycle, a lower contamination rate, and excellent fruit setting. Simultaneously, this strain shows a significant improvement in yield, the proportion of high-quality mushrooms, and the bioconversion rate. Furthermore, Pingxiang 69 has a low rate of rotten substrate and possesses excellent high-temperature tolerance and normal fruiting ability. In conclusion, strain Pingxiang 69 has significant promotional value, especially in off-season summer mushroom producing areas, with broad market prospects.

[0047] Molecular biological identification and preservation of *Pingxiang 69* strain This invention uses the CTAB method to extract total DNA from the bacterial strain. A mixed reagent is used: upstream primer ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and downstream primer ITS4 (5'-TCCTCCGCTTATTGATATGC-3'). The PCR amplification system (25 μL) consists of: 10 μL of 2×Mix, 1 μL of each primer, 7 μL of ddH2O, and 1 μL of DNA template. The PCR amplification program is: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 20 s, 55℃ annealing for 20 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min. The PCR product is sequenced, and the ITS sequence obtained is SEQ ID NO.1.

[0048] The specific details of SEQ ID NO.1 are as follows: GGAACTTCCCTTTTTTTCCAATGAATAGACCAGATTGAGCAAATTAAATGCACCAACCCAAACCAATAGAGCTTTATTATTGTAAGGTTCCACCAAAATGTAGATAATTTCCCACCAAGGTTTAGAACTACCAAACCAGGGTTCCCATTAATAAATTTAAGAGGAGCTGCCAAACCCCTGCAACCTTCCACCATCCAAGCT TTAATAAGTAAAAACTTATAAAGTTGAGAATTTAATGACACTCAAACAGGCATGCCCTCCGGAATACCAGAGGGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGGGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATTAAGTTTA.

[0049] Based on the ITS sequence, a phylogenetic tree was constructed using the Neighbor-Joining (NJ) method. Genetic distances were calculated using the Maximum Composite Likelihood method, and branch reliability was assessed using 1000 replicate samplings via the Bootstrap method. Nucleotide sequences of Pingxiang 69 and other known Lentinula edodes strains were analyzed. After removing ambiguous alignment sites, the final dataset contained 532 valid sites. BLAST homology search results showed that the ITS sequence (401 bp) of the tested strain Pingxiang 69 had 100% coverage and identity with the Lentinula edodes sequence in the NCBI database, and both sequences were classified as belonging to the Lentinula edodes species. Figure 5 The provided phylogenetic tree shows that Pingxiang 69 is located within the Lentinula edodes cluster, in the same cluster as known Lentinula edodes strains (PV938736.1, KX512806.1, PP156809.1, etc.), indicating that the evolutionary relationship of the sequence is stable and the strains are closely related. Based on the results of the phylogenetic tree, Pingxiang 69 has been clearly identified as Lentinula edodes and belongs to the shiitake mushroom species.

[0050] Based on the above classification, identification, and molecular phylogenetic studies of the ITS sequence, the strain XGZJ5 of this invention is determined to belong to Lentinula edodes in taxonomy, and is named Pingxiang 69. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42762, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, on April 21, 2026.

[0051] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A shiitake mushroom strain, Pingxiang 69, characterized in that, Its accession number is CGMCC No.42762.

2. A shiitake mushroom cultivation strain, characterized in that, It was obtained by culturing the shiitake mushroom strain Pingxiang 69 as described in claim 1.

3. A method for preparing the shiitake mushroom spawn according to claim 2, characterized in that, Includes the following steps: The spores or fruiting bodies of the shiitake mushroom strain Pingxiang 69 were inoculated into the mother culture medium and cultured to obtain mother culture mycelium; The mother culture mycelium was inoculated into the original culture medium and cultured to obtain the original culture mycelium; The original mycelium was inoculated into the culture medium of the mushroom bag for cultivation to obtain the shiitake mushroom spawn.

4. The method for preparing shiitake mushroom spawn as described in claim 3, characterized in that, The formula of the mother culture medium includes: potato 180g / L~220g / L, glucose 15g / L~25g / L, KH2PO4 2g / L~4g / L, MgSO4·7H2O 0.4g / L~0.6g / L, agar 18g / L~22g / L, and natural pH.

5. The method for preparing shiitake mushroom spawn as described in claim 3, characterized in that, The original culture medium comprises the following components in the following mass ratio: 75%~80% sawdust, 17%~22% wheat bran, 0.5%~1.5% gypsum, 0.5%~1.5% brown sugar, with a water content of 55%~58% and a natural pH. The culture medium for the mushroom bags comprises the following components in the following mass ratios: 78%~79% sawdust, 20%~21% wheat bran, 1%~1.2% gypsum, with a moisture content of 58%~62% and a natural pH.

6. A fruiting body of a shiitake mushroom, characterized in that, It was obtained by culturing the shiitake mushroom strain Pingxiang 69 as described in claim 1.

7. A shiitake mushroom mycelium, characterized in that, The mushroom strain Pingxiang 69 described in claim 1 was obtained by liquid fermentation.

8. The application of the Shiitake mushroom strain Pingxiang 69 as described in claim 1 in breeding.

9. The application of the Shiitake mushroom strain Pingxiang 69 as described in claim 1 in food processing.

10. A method for cultivating the shiitake mushroom strain Pingxiang 69 according to claim 1, comprising the following steps: The mushroom cultivation management was carried out on the spawn containing the shiitake mushroom strain Pingxiang 69.

Images