A strain of filamentous fungus Podospora anserina with the functions of promoting growth and development of fungal fruiting bodies and delaying aging

Abstract

The application discloses a filamentous fungus Podospora anserina strain with the functions of promoting growth and development of fungal fruiting bodies and delaying aging. The filamentous fungus Podospora anserina strain with the functions of promoting growth and development of fungal fruiting bodies and delaying aging is formed by overexpressing a PaAFG1 gene in a wild-type filamentous fungus Podospora anserina, wherein the PaAFG1 gene is Pa_4_2480, and the Gene ID is 6188062. The filamentous fungus Podospora anserina strain with the overexpressed PaAFG1 gene has the advantages of accelerated growth rate, enhanced reproductive capacity and longer life, and provides a new scheme and way for engineering of a gene-reformed filamentous fungus Podospora anserina strain with efficient growth.

Description

Technical Field

[0001] This application relates to the field of filamentous fungi technology, and in particular to a filamentous fungus strain, *Podospora anserina*, which has the effect of both promoting the growth and development of fungal fruiting bodies and delaying aging. Background Technology

[0002] Filamentous fungi, as important industrial cell factories, are widely used in the large-scale production of enzymes, organic acids, and bioenergy. However, during long-term subculturing and fermentation, industrial strains generally face aging phenomena such as stunted growth, decreased metabolic activity, and declining product synthesis capabilities, which has become a key bottleneck restricting the improvement of fermentation industry efficiency. In-depth analysis of the regulatory mechanisms of filamentous fungal aging and the development of effective stress-resistance and anti-aging strategies are of significant theoretical and practical value for ensuring stable and high yields in industrial fermentation.

[0003] Senescence in filamentous fungi is a complex biological process mediated by both environmental factors and genetic regulation. These two factors are interconnected through mitochondrial homeostasis, jointly regulating the fungal senescence process. At the environmental level, temperature, light, and pH are key regulatory factors: extreme temperatures can damage cell wall and cell membrane structures, induce oxidative stress, and thus accelerate senescence; different light spectra regulate developmental processes and reactive oxygen species (ROS) levels through photoreceptor signaling pathways, with red, white, and blue light potentially delaying senescence; pH levels deviating from the optimal range disrupt cellular energy metabolism, affect signal transduction and gene expression, ultimately inducing senescence. At the genetic level, decreased mitochondrial DNA (mtDNA) stability, large-scale recombination, and deletion are core molecular markers of senescence, directly causing mitochondrial dysfunction; autophagy maintains cellular homeostasis by selectively degrading damaged organelles and misfolded proteins, playing a role in delaying senescence; oxidative damage caused by ROS homeostasis imbalance significantly promotes the senescence process; metabolic disorders, abnormal lipid metabolism, and energy metabolism imbalances also accelerate senescence. Furthermore, epigenetic alterations such as DNA methylation and histone modifications are also deeply involved in this process.

[0004] As the core engine regulating cellular energy metabolism homeostasis, adenosine triphosphatase (ATPase) and its related AAA+ (ATPases associated with diverse cellular activities) play a crucial role in eukaryotes. AAA+ proteins regulate substrate protein conformational remodeling through ATP hydrolysis and are widely involved in protein quality control, organelle biogenesis, and various energy-dependent life activities. Currently, ATPase family gene 1 (AFG1), as an important member of this family, has attracted much attention. Existing heterologous model organism studies have confirmed that AFG1 family proteins have conserved cellular energy metabolism regulatory functions: Saccharomyces cerevisiae Afg1p maintains energy homeostasis and delays cellular senescence by stabilizing respiratory chain function; mammalian AFG1L protein ensures normal oxidative phosphorylation by regulating mitochondrial function. However, although the functions of AFG1 in yeast and mammals have been gradually elucidated, whether it is associated with senescence by regulating energy metabolism in filamentous fungi with complex life histories and typical energy-dependent senescence characteristics remains largely unreported, representing a research gap that urgently needs to be filled.

[0005] Therefore, how to effectively promote the growth and development of filamentous fungal fruiting bodies and delay their senescence remains a key research focus and challenge in this field. Summary of the Invention

[0006] The purpose of this application is to provide a novel filamentous fungus strain, *Podospora anserina*, which can both promote the growth and development of fungal fruiting bodies and delay aging.

[0007] To achieve the above objectives, this application adopts the following technical solution:

[0008] This application discloses a filamentous fungus, *Podospora anserina*, which has the effects of promoting the growth and development of fungal fruiting bodies and delaying aging. This filamentous fungus *Podospora anserina* strain is formed by overexpression of the PaAFG1 gene in wild-type filamentous fungus *Podospora anserina*. The PaAFG1 gene is Pa_4_2480, and its Gene ID is 6188062.

[0009] It should be noted that this study found that the Podospora anserina strain overexpressing the PaAFG1 gene (abbreviated PaAFG1-OE) exhibits characteristics of accelerated growth rate, enhanced reproductive capacity, and delayed aging process. In some implementation methods, the fruiting body yield increased by about 28.8%, clarifying that PaAFG1 has a dual function of positively regulating reproductive development and negatively regulating the aging process, providing a new scheme and approach for the efficient growth of the filamentous fungus Podospora anserina.

[0010] In some implementations, the filamentous fungus *Podospora anserina* strain has the accession number CCTCC M20261299.

[0011] This application also discloses the application of the filamentous fungus *Podospora anserina* strain of this application in the preparation of highly efficient mycelia.

[0012] In some implementations, high-efficiency mycelium growth refers to mycelial growth rate, higher fruiting body yield, and / or longer lifespan compared to wild-type filamentous fungus Podospora anserina.

[0013] This application discloses a method for increasing the fruiting body yield of the filamentous fungus *Podospora anserina*, which includes overexpressing the PaAFG1 gene in *Podospora anserina*, wherein the PaAFG1 gene is Pa_4_2480 and its Gene ID is 6188062.

[0014] This application discloses a method for accelerating the mycelial growth rate of the filamentous fungus *Podospora anserina*, which includes overexpressing the PaAFG1 gene in *Podospora anserina*, wherein the PaAFG1 gene is Pa_4_2480 and its Gene ID is 6188062.

[0015] This application discloses a method for extending the lifespan of a filamentous fungus, Podospora anserina, comprising overexpressing the PaAFG1 gene in Podospora anserina, wherein the PaAFG1 gene is Pa_4_2480 and its Gene ID is 6188062.

[0016] In some implementations, the PaAFG1 gene overexpression of this application includes: constructing the complete coding sequence of the PaAFG1 gene into a plasmid vector to obtain a recombinant plasmid; transforming the recombinant plasmid into protoplasts of the wild-type filamentous fungus *Podospora anserina*; culturing and screening positive transformants; sexually mating the positive transformants with the wild-type filamentous fungus *Podospora anserina*; and isolating and purifying homozygous strains from ascospores, i.e., strains that homozygous overexpress the PaAFG1 gene.

[0017] In some implementations, the full coding sequence of the PaAFG1 gene is driven by a strong promoter.

[0018] In some implementations, the strong starter includes Pwl2Pro.

[0019] In some implementations, the recombinant plasmid is pKNTG-PaAFG1.

[0020] Due to the adoption of the above technical solutions, the beneficial effects of this application are as follows:

[0021] The filamentous fungus *Podospora anserina* strain overexpressing the PaAFG1 gene in this application exhibits accelerated growth rate, enhanced reproductive capacity, and longer lifespan, providing a new approach and method for genetically modifying highly efficient filamentous fungal strains of *Podospora anserina*. Attached Figure Description

[0022] Figure 1 This is a plasmid map of the overexpression vector pKNTG-Pwl2Pro in the embodiments of this application;

[0023] Figure 2 This is a map of the pBC-NourR plasmid, which was knocked out in the embodiments of this application.

[0024] Figure 3 This is a flowchart illustrating the construction process of the ΔPaAFG mutant in the embodiments of this application;

[0025] Figure 4 This is a diagram illustrating the conserved structural domains in the gene multiple sequence alignment results in the embodiments of this application;

[0026] Figure 5 This is a phylogenetic tree in the embodiments of this application;

[0027] Figure 6 These are electrophoresis gel images of conventional PCR and fusion PCR in the embodiments of this application;

[0028] Figure 7 This is a PCR electrophoresis gel image used to verify the transformants in the embodiments of this application;

[0029] Figure 8 The results of the construction and validation of the PaAFG1 overexpression strain in the embodiments of this application are shown.

[0030] Figure 9 The results of RT-qPCR verification of PaAFG1 overexpression level in the embodiments of this application;

[0031] Figure 10 This is a diagram showing the mycelial growth after 10 days of cultivation in an embodiment of this application.

[0032] Figure 11 This is a diagram showing the growth diameter measurement after 10 days of cultivation in an embodiment of this application.

[0033] Figure 12 These are the observation results of the strains in the embodiments of this application;

[0034] Figure 13 This is a statistical result of the number of fruiting bodies of the strains in the embodiments of this application;

[0035] Figure 14 These are the results of microscopic observation of the development of the offspring in the embodiments of this application;

[0036] Figure 15 This is a comparison diagram of the growth results under different carbon source culture media in the embodiments of this application;

[0037] Figure 16 The results of ATP content detection in the embodiments of this application;

[0038] Figure 17 This is a DAB staining image of the ROS tissue of the strain in the embodiments of this application;

[0039] Figure 18 This is an NBT staining image of the ROS tissue of the strain in this application embodiment;

[0040] Figure 19 The above are the SOD enzyme activity detection results in the embodiments of this application;

[0041] Figure 20 The results of CAT enzyme activity detection in the embodiments of this application;

[0042] Figure 21 The results of POD enzyme activity detection in the embodiments of this application;

[0043] Figure 22 These are comparative results of cellulase activity in the embodiments of this application;

[0044] Figure 23 This is the sample relationship evaluation result in the embodiments of this application.

[0045] The overexpressing strain PaAFG1-OE of this application, with the Latin name Podospora anserina, is deposited at the China Center for Type Culture Collection (CCTCC), located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, on June 12, 2026, with accession number CCTCC M 20261299. Detailed Implementation

[0046] Given the unclear roles of genes in the growth, development, and anti-aging of filamentous fungi, this study used the classic aging model organism *Podospora anserina* as material, focusing on the AFG1 family ATPase-encoding gene PaAFG1 (Pa_4_2480), whose function has not yet been identified. By constructing the gene knockout mutant ΔPaAFG1 and the overexpressing strain PaAFG1-OE, we systematically investigated the regulatory role of this gene on mycelial vegetative growth, sexual reproductive development, and the aging process. Furthermore, combining energy metabolism levels, redox homeostasis, and transcriptome sequencing analysis, we elucidated the molecular mechanism by which PaAFG1 regulates fungal physiological phenotypes. This study aims to fill the functional gap of the AFG1 subfamily in filamentous fungi and provide theoretical support for in-depth analysis of the aging regulatory network in filamentous fungi and the genetic improvement of anti-aging in industrial strains.

[0047] Phenotypic analysis revealed that the ΔPaAFG1 mutant exhibited severely delayed hyphal growth, significantly impaired sexual reproduction (a decrease in fruiting body yield of approximately 25.9%), and a typical premature aging phenotype (premature pigment deposition). Conversely, the PaAFG1-OE overexpressing strain showed accelerated growth rate, enhanced reproductive capacity (an increase in fruiting body yield of approximately 28.8%), and delayed aging. This clarifies that PaAFG1 has a dual function of positively regulating reproductive development and negatively regulating the aging process. At the mechanistic level, energy metabolism assays revealed abnormal ATP accumulation in the ΔPaAFG1 mutant cells, while the ATP level was reduced in the overexpressing strain, confirming that it directly affects the cellular energy metabolism state as an ATP hydrolase. Oxidative stress analysis showed that the ΔPaAFG1 mutant had increased reactive oxygen species (ROS) levels and decreased activities of antioxidant enzymes such as SOD, CAT, and POD, while the PaAFG1-OE strain exhibited the opposite characteristics, indicating that this gene is involved in maintaining cellular redox homeostasis. Cellulose degradation capacity analysis revealed that the ΔPaAFG1 mutant exhibited a premature aging trend in cellulose-based media, but its basal cellulase activity showed no significant difference compared to the wild type. Transcriptomic analysis further revealed at the molecular level that PaAFG1 overexpression triggered large-scale gene expression reprogramming, identifying 2314 differentially expressed genes. These genes were significantly enriched in peroxisome biogenesis and metabolic pathways; among them, genes involved in fatty acid β-oxidation and catalase (CAT) synthesis were specifically upregulated, elucidating the potential molecular mechanism by which PaAFG1 alleviates oxidative damage by enhancing peroxisome function. These results indicate that PaAFG1 profoundly affects the development and senescence of fungal fruiting bodies by regulating energy metabolism homeostasis.

[0048] In summary, this study not only deepens our understanding of the mechanisms by which eukaryotic energy metabolism regulates aging and sexual reproduction, but also, by revealing the key function of the AAA+ ATPase gene PaAFG1, provides a potential molecular target and theoretical basis for targeting energy metabolism nodes to delay the aging of industrial filamentous fungi and improve their reproductive and production efficiency. The study found that genetically manipulating PaAFG1 can effectively prolong the vegetative growth and enzyme production cycle and stabilize fermentation performance while delaying the aging of filamentous fungi; and promoting fruiting body development helps enhance their biomass degradation efficiency and environmental adaptability. The synergistic effect of these two aspects provides a clear and feasible strategic direction for the targeted genetic improvement of industrial fungi.

[0049] The present application will be further described in detail below through specific embodiments. The following embodiments are only for further illustration of the present application and should not be construed as limiting the present application.

[0050] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0051] Example

[0052] I. Materials and Methods

[0053] 1. Materials

[0054] (1) Strains and plasmids

[0055] The wild-type strain (WT) of *Podospora anserina* and the homologous recombination-efficient strain Δmus51::GeneR (obtained by replacing the mus51 gene with the GeneR resistance marker gene, which significantly improves homologous recombination efficiency) were provided and preserved by the College of Life Sciences and Oceanography, Shenzhen University. The overexpression vector pKNTG-Pwl2Pro (a plasmid carrying the GeneR resistance gene) was kindly provided by the research team of Li Guotian at Huazhong Agricultural University. The overexpression vector pKNTG-Pwl2Pro is as follows: Figure 1 As shown. The knockout vector pBC-NourR (a plasmid carrying the Nour R resistance gene) was provided and preserved by the College of Life Sciences and Oceanography, Shenzhen University. The knockout vector pBC-NourR is shown below. Figure 2 As shown.

[0056] (2) Main culture medium

[0057] The preparation of the M2 basal medium and the culture conditions for the strain were referenced from the Podospora anserina Genome Project (http: / / podospora.i2bc.paris-saclay.fr / methods.php). Lignocellulose media: Based on the M2 medium, three lignocellulose media were prepared by replacing dextrin with equal amounts of lignin powder, wood shavings, or microcrystalline cellulose as the sole carbon source.

[0058] (3) Main reagents and instruments

[0059] Main instruments: upright microscope (ZEISS Primo Star), multi-functional microplate reader (BioTek SynergyHTX), ultra-micro UV spectrophotometer (Thermo NANODROP 2000), pH meter (OHAUS STARTER 3100).

[0060] Main reagents: Microcrystalline cellulose (Sangon Biotech); NBT and DAB colorimetric kits, peroxidase (Solarbio); Nourseothricin and Geneticin (Yisheng Biotech); Cellulase (Sigma); BCA protein concentration assay kit (Vazyme); ATP assay kit, total SOD activity assay kit, catalase assay kit (Beyotime); High-purity RNA extraction kit (TransGold); Homologous recombination cloning kit (TOLOBIO); DNA gel extraction kit (OMEGA).

[0061] 2. Bioinformatics Analysis

[0062] The putative ATPase AAA superfamily AFG1 subfamily protein gene (number Pa_4_2480) was obtained from the P. anserina genome database and named PaAFG1. Its protein structure was then predicted. The ATPase amino acid sequences of 13 different AFG1 subfamily members from various species, including *P. anserina*, were obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). These sequences are: *Clonostachys chloroleuca* (A0AA35M3J9), *Sordaria macrospora* (A0AB58ZM56), *Penicillium brevicompactum* (A0A9W9UHU1), *Drechsierellastenobrocha* (9PEZ), *Saccharomyces cerevisiae* (QHB08018.1), *Schizosac charomyces* (A0AA5F0AU7), *Homo sapiens* (Q8WV93.2), *Mus musculus* (Q3V384.1), *Arabidopsisthaliana* (AEE85772.1), *Neurospora crassa* (KAK3503636.1), and *Cheetomium*. strumarium (XP062721117.1) and Madurella fahali (XP070917999.1). The compiled sequences were aligned using the Muscle algorithm and manually adjusted. A phylogenetic tree based on these sequences was constructed using the maximum likelihood method in MEGA 12.

[0063] 3. DNA extraction

[0064] Genomic DNA extraction:

[0065] Rapid extraction of genomic DNA:

[0066] (1) Activation of strains. The frozen strains were inoculated into M2 solid medium and cultured at 27°C under light for 2 days.

[0067] (2) Bacterial culture. Cut a strip of bacteria from the activated plate with a sterile blade and place it in a 1.5 mL EP tube. Add 1 mL of sterile deionized water and grind the bacteria using a three-dimensional sample grinder at maximum power for 45 s each time, repeating 3 times. Take 5 μL of the bacterial suspension and drop it into the center of an M2 plate lined with sterile cellophane. Continue to incubate at 27℃ under light for 2-3 days.

[0068] (3) DNA extraction. Collect hyphae, add an appropriate amount of glass beads, and flash freeze in liquid nitrogen to embrittle the hyphae. Then, grind them using a three-dimensional sample grinder at maximum power for 45 seconds each time, repeating 4 times. Add 50 μL of Tris-EDTA buffer to the ground product, incubate in a water bath at 65℃ for 20 min, and then freeze at -80℃ for 10 min. Finally, centrifuge at 13000 rpm for 1 min, and collect the supernatant to obtain the crude genomic DNA extract. After concentration determination and electrophoresis, the extracted DNA can be used directly or stored at -20℃ for later use.

[0069] Genomic DNA extraction:

[0070] (1) Activation of strains. The frozen strains were inoculated into M2 solid medium and cultured at 27°C under light for 2 days to complete the activation.

[0071] (2) Bacterial culture. Using a sterile blade, cut a long strip of bacteria from the activated plate and transfer it to a 1.5 mL EP tube. Add 1 mL of sterile deionized water. Grind the bacterial strip using a three-dimensional sample grinder at maximum power for 45 s each time, repeating 3 times. Take 5 μL of the obtained bacterial suspension and drop it into the center of an M2 plate lined with sterile cellophane. Continue to incubate at 27℃ under light for 2-3 days.

[0072] (3) DNA extraction. Mycelia were collected, and an appropriate amount of glass beads were added. After quick-freezing in liquid nitrogen to embrittle the mycelia, they were ground using a three-dimensional sample grinder at maximum power for 45 seconds each time, repeated 4 times. Subsequently, genomic DNA was extracted strictly according to the instructions of the M5 Fungal Genomic DNA Kit. The extracted DNA, after concentration determination and agarose gel electrophoresis detection, could be used directly for subsequent experiments or stored at -20℃ for later use.

[0073] Plasmid DNA extraction:

[0074] pBC plasmid extraction:

[0075] (1) Culture of strain. Add chloramphenicol to LB liquid medium to a final concentration of 34 μg / mL, mix well, and inoculate the strain carrying pBC plasmid at a ratio of 1:500-1:1000 (v / v). Culture at 37℃ and 250 rpm for 12-16 h with shaking.

[0076] (2) Plasmid extraction. After the bacterial culture is completed, strictly follow the FastPure procedure. ® The Plasmid Mini Kit instructions describe the extraction of pBC plasmid DNA.

[0077] pKNTG plasmid extraction:

[0078] (1) Culture of strain. Add ampicillin to LB liquid medium to a final concentration of 100 μg / mL, mix well, and inoculate the engineered strain carrying pKNTG plasmid at a ratio of 1:500-1:1000 (v / v) and culture at 37℃ and 250 rpm for 12-16 h.

[0079] (2) Plasmid extraction. After culture, pKNTG plasmid DNA was extracted strictly according to the FastPure® Plasmid Mini Kit instructions.

[0080] 4. Construction of PaAFG1 mutant

[0081] (1) Construction and validation of ΔPaAFG1 knockout mutant

[0082] The PaAFG1 gene was knocked out in WT strains using homologous recombination. The principle of the strain construction technique is as follows: Figure 3As shown in Table 1, primers were designed using NCBI online software to amplify the upstream homologous arm (5' flank, 1328 bp) and downstream homologous arm (3' flank, 1370 bp) of the PaAFG1 gene by PCR. The Nourseothricin resistance gene (1803 bp) was amplified using the pBC-Nourseothricin plasmid as a template. The 5' flank was ligated to the nat fragment (5N, 3131 bp) by fusion PCR, and the nat fragment was ligated to the 3' flank fragment (N3, 3173 bp). The two fusion fragments were co-transformed into protoplasts of the Δmus51::Geneticin strain, and transformants were screened on a medium containing Nourseothricin (40 μg / mL). The verified transformants (mat+) were hybridized with the wild type (mat-), and the homozygous knockout mutant ΔPaAFG1 (two mating types) without mus51 background was isolated and purified from the ascospores. Genomic DNA was extracted and verified by PCR and sequencing using primers across the knockout site (YzF / YzR).

[0083] Table 1

[0084] 1F TCGCCCTTGTTTGGTCTCT 1 2R CTATTTAACGACCCTGCCCTGAACCGCGCCGACAAGGTTGGATAGT 2 MkF ACTATCCAACCTTGTCGGCGCGGTTCAGGGCAGGGTCGTTAAATAG 3 MkR AGCAAACAAGAAACGTCGCGATCGAACTGGATCTCAACAGCGGTAAG 4 3F CTTACCGCTGTTGAGATCCAGTTCGATCGCGACGTTTCTTGTTTGCT 5 4R CTCTCGAACCACATCCTCCG 6 5T TGAGAAGCACACGGTCAC 7 YZ-F CGAGGGATAGGGGAGTGTGA 8 3T TCGGGGCGAAAACTCTC 9 YZ-R GTCTTGAATGGACTGCGTGC 10

[0085] In Table 1, primers 1F and 2R were used for 5' amplification of the upstream region of the gene, primers MkF and MkR were used for amplification of the Nourseothricin resistance marker gene, primers 3F and 4R were used for 3' amplification of the downstream region of the gene, and primers 5T, YZ-F, 3T, and YZ-R were used for gene knockout verification.

[0086] Protoplast preparation:

[0087] Fungal liquid culture: (1) Thaw the Δmus51::Geneticin(mat+) strain frozen at -80℃ on ice, inoculate it into M2 solid medium, and culture at 27℃ under light for 2 days. (2) Cut a long strip of fungal material with a sterile blade, place it in a 1.5 mL centrifuge tube, add 1 mL of sterile deionized water, and grind it using a three-dimensional sample grinder at maximum power for 45 s each time, repeating 3 times to prepare a bacterial suspension. (3) Add tetracycline solution to 1 L of fungal liquid medium to a final concentration of 10 μg / mL, mix well, and dispense into cell culture flasks (100 mL / flask). Inoculate each flask with 200 μL of the above bacterial suspension and culture at 27℃ in the dark with shaking for 2-3 days.

[0088] Fungal hyphae recovery and protoplast preparation: (1) Filter the culture using a funnel covered with double-layer sterile gauze to recover the hyphae. Wash the hyphae 2-3 times with TPS1 solution to remove residual culture medium. (2) Weigh a sterile 250 mL sealed Erlenmeyer flask in advance. Transfer the washed hyphae to the Erlenmeyer flask with a sterile spatula, weigh it again, and calculate the wet weight of the hyphae. Add an equal volume of TPS1 solution to the flask, followed by cellulase solution to a final concentration of 20 mg / mL. (3) Seal the Erlenmeyer flask and place it in a shaker at 37℃ for 2-4 h at 70 rpm in the dark. (4) After enzymatic hydrolysis, take a small amount of the reaction solution and observe it under a microscope to assess the number of protoplasts and confirm the cell wall lysis effect.

[0089] Isolation and purification of protoplasts: (1) Fix four layers of sterile gauze onto a small funnel, wrap the funnel with newspaper, and then autoclave. (2) Place the sterilized funnel onto a sterile 50 mL centrifuge tube and filter the enzymatic digestion mixture to remove incompletely digested hyphal fragments. Collect the filtrate containing protoplasts. Wash the gauze thoroughly with an appropriate amount of TPS1 solution to recover the remaining hyphae to the maximum extent possible. During the washing process, care should be taken to avoid liquid overflow. (3) Centrifuge the centrifuge tube containing the collected filtrate at 3200 r / min and 20 ℃ for 10 min and carefully discard the supernatant. (4) Add 20-30 mL of TPS1 solution to the precipitate, gently resuspend the protoplast precipitate, centrifuge for 10 min under the same conditions, and discard the supernatant. (5) Add 20-30 mL of TPC solution to the precipitate, resuspend the precipitate, and centrifuge for 10 min under the same conditions. Carefully discard most of the supernatant, and finally retain about 1 mL of supernatant to avoid aspirating the precipitate. (6) Gently resuspend the protoplast precipitate with a small amount of TPC solution, count the protoplasts using a hemocytometer, and adjust the protoplast concentration to 2 × 10⁻⁶ with TPC solution. 8 (7) Dispense the purified protoplast suspension into 1.5 mL centrifuge tubes at a rate of 200 μL per tube. It can then be used for subsequent transformation experiments or stored at -80 °C for long-term storage.

[0090] Conventional PCR:

[0091] Using wild-type P. anserina genomic DNA as a template, the upstream homologous arm (5' flank) of the PaAFG1 gene was amplified using primers 1F / 2R, and its downstream homologous arm (3' flank) was amplified using primers 3F / 4R. Using pBC plasmid as a template, the Nourseothricin resistance marker gene (nat) fragment was amplified using primers MkF / MkR. All PCR reactions used a 2× Phanta® Max Master Mix (Dye Plus) premixed enzyme system. Specifically, a 50 μL reaction volume consisted of: 25 μL of 2× Phanta® Max Master Mix (Dye Plus), 2 μL each of 20 mM forward and reverse primers, 1 μL of DNA template, and ddH2O added to a final volume of 50 μL.

[0092] PCR reaction program: 95℃ pre-denaturation for 5 min, then 30 cycles: 95℃ denaturation for 15 s, 58℃ denaturation for 15 s, 72℃ extension for 1.5 min, and after the cycle, 72℃ extension for 7 min.

[0093] After PCR, 1 μL of the PCR product was analyzed by agarose gel electrophoresis to check the uniformity and size of the amplified bands. Products with uniform bands and correct size were directly purified using the High Pure PCR Product Purification Kit; products with nonspecific bands were extracted using a DNA gel extraction kit. The purified DNA fragments were then stored at -20°C after concentration determination.

[0094] Fusion PCR:

[0095] Using the purified upstream homologous arm (5' flank) of the PaAFG1 gene and the Nourseothricin resistance marker gene fragment (nat) as templates, fusion PCR was performed using outer primer 1F and MkR to amplify the fusion fragment of the upstream homologous arm and the resistance marker (5' flank-nat). Using the downstream homologous arm (3' flank) of the PaAFG1 gene and the nat gene fragment as templates, fusion PCR was performed using outer primer MkF and 4R to amplify the fusion fragment of the downstream homologous arm and the resistance marker (nat-3' flank). The fusion PCR reaction used a 2× KeyPo Master Mix (Dye Plus) premixed enzyme system. The 50 μL reaction system included: 25 μL of 2× KeyPo Master Mix (Dye Plus), 2 μL each of 20 mM forward and reverse primers, 1 μL each of DNA template, and ddH2O added to a final volume of 50 μL.

[0096] PCR reaction program: pre-denaturation at 95℃ for 3 min, followed by 30 cycles: denaturation at 95℃ for 10 s, denaturation at 58℃ for 5 s, extension at 72℃ for 0.5 min, and extension at 72℃ for 7 min after the cycle.

[0097] After fusion PCR amplification, 1 μL of the fusion PCR product was analyzed by agarose gel electrophoresis to check the uniformity and size of the bands. Products showing a single expected band were directly purified using the High Pure PCR Product Purification Kit; samples with nonspecific bands or byproducts were recovered by gel excision using a DNA gel extraction kit. The purified fusion fragments were then stored at -20℃ after concentration determination.

[0098] Protoplast transformation:

[0099] Fungal protoplast transformation: (1) Take out the protoplasts of Δmus51::Geneticin(mat+) strain frozen at -80℃ and thaw them on ice for 30-60 min. (2) Preheat the metal bath to 48℃, take 200 μL of protoplast suspension and heat shock it at 48℃ for 5 min, then immediately transfer it to ice and let it stand for 30 s, and finally let it stand at room temperature (about 25℃) for 15 min. (3) Add about 5 μg of purified DNA fusion fragment (5N and N3) to the above 200 μL of protoplasts, mix gently, and let it stand at room temperature for 15 min. (4) Add 2 mL of thawed Tampon D solution to the bottom of a 50 mL centrifuge tube, slowly add the protoplast and DNA mixture from step (3) along the tube wall, gently mix in a circular motion during the addition process, and let it stand at room temperature for 15 min. (5) Centrifuge the centrifuge tube at 20℃ and 3200 r / min for 10 min, carefully discard the supernatant, and white protoplast precipitate will be visible at the bottom of the tube. (6) Slowly add 5 mL of RG liquid culture medium along the tube wall, gently resuspend the precipitate, and place the centrifuge tube in 27℃ and dark conditions for overnight incubation.

[0100] Transformant screening: (1) Mix 25 mL of preheated and melted RG Top medium with 5 mL of D-sorbitol solution, and add the mixture to 5 mL of overnight RG liquid culture, for a total volume of 35 mL. (2) Add 17.5 μL of 100 mg / mL Nourseothricin antibiotic to the above mixture to a final concentration of 40 μg / mL, and mix gently. (3) Incubate the mixture in a 45℃ water bath for 5-10 min, and then pour it evenly onto 4-5 solid selection plates containing Nourseothricin (final concentration 40 μg / mL), and incubate at 27℃ in the dark for 2-3 days. (4) Pick a single colony from the selection plate and inoculate it onto a new resistant plate containing the same concentration of Nourseothricin for verification culture. Colonies that grow after two verifications are the preliminary positive transformants.

[0101] Validation of the ΔPaAFG1 knockout mutant: Validation PCR. At least three single colonies were selected from transformants that underwent secondary validation on Nourseothricin-resistant plates and inoculated onto M2 solid medium, incubated at 27°C for 2 days. Mycelia were collected, and DNA was prepared using a crude genomic DNA extraction method to serve as the PCR validation template. Validation primers YzF and YzR were designed approximately 2000 bp upstream and downstream of the PaAFG1 gene coding region. The PCR reaction used a 2× Phanta® Max Master Mix (DyePlus) premixed enzyme system, and the reaction system and procedure were the same as for conventional PCR.

[0102] Take 1 μL of the validation PCR product and perform agarose gel electrophoresis. Analyze the results by comparing the size with the expected fragment. If the electrophoretic band size matches the expectation (i.e., larger than the wild-type band due to the insertion of the resistance marker gene), purify the product: products showing a single specific band are directly recovered using a High Pure PCR Product Purification Kit; products with non-specific bands or tails are excised using a DNA gel extraction kit. After purification, determine the DNA concentration and send it for sequencing. Compare the sequencing results with the expected knockout sequence to confirm correct gene knockout construction. If the electrophoretic band size does not match the expectation, the transformation was unsuccessful and protoplast transformation needs to be repeated.

[0103] Genetic hybridization and mutant purification. Transformants (mat+) verified by sequencing were hybridized with wild-type strains of the opposite mating type (mat-) on the same solid medium and cultured at 27°C under light until the ascocarps matured and emitted ascospores. The emitted spores were collected using sterile spore collection medium, and single ascospores were picked up under a microscope using a micromanipulation needle and transferred to germination medium. Germination was promoted by incubation at 27°C in the dark for 1-2 days. Germinated colonies were inoculated onto dual-resistance plates containing Nourseothricin (40 μg / mL) and Geneticin (at an appropriate concentration), and incubated at 27°C in the dark for 1 day. Colonies growing on Nourseothricin plates but not on Geneticin plates were screened to obtain candidate progeny carrying only the PaAFG1 knockout expression cassette and without the original Δmus51::Geneticin marker. The candidate colonies were further confronted with two known mating types (mat+ and mat−) of wild-type strains. After about one week of incubation at 27°C under light, the mating type was determined based on whether fruiting bodies formed. Homozygous knockout mutants of the two mating types (mat+ and mat−) were screened and isolated. The mutant colonies with confirmed mating types were transferred to M2 plates and incubated at 27°C under light for 2 days. The bacterial blocks were then cut and placed in preservation tubes, covered with an appropriate amount of RG liquid medium, and stored at -80°C for long-term preservation.

[0104] (2) Construction and validation of PaAFG1-OE overexpression strain

[0105] The plasmid pKNTG-Pwl2Pro was digested with the restriction endonuclease SalI to obtain a linearized vector fragment. Primers were designed based on a homologous recombination strategy: the forward primer (5'→3') consisted of a long arm homologous to the upstream sequence of the SalI site in the linearized vector, the SalI restriction site, and a 20 bp specific sequence at the start of the complete coding sequence (CDS) of the PaAFG1 gene; the reverse primer consisted of a long arm homologous to the downstream sequence of the SalI site in the linearized vector, the SalI restriction site, and a reverse complementary sequence at the end of the PaAFG1 gene CDS. Specific sequences are shown in Table 2. The linearized vector was ligated to the PCR-amplified PaAFG1-CDS fragment using the TOLOBIO homologous recombination cloning kit to construct the recombinant plasmid pKNTG-PaAFG1. After sequencing verification, the plasmid was transformed into wild-type (WT, mat+) protoplasts. Transformants were screened on a medium containing genicin (100 μg / mL), and genomic DNA was extracted for PCR verification to confirm positive transformants. To obtain a homozygous overexpressing strain PaAFG1-OE, the above positive transformants (mat+) were sexually mated with wild-type (mat-), and homozygous strains were isolated and purified from ascospores. Total RNA was extracted from each strain and reverse transcribed to synthesize cDNA. Using β-tubulin as an internal reference gene, the transcription level of PaAFG1 was detected by RT-qPCR, and its relative expression level was calculated using the 2^-ΔΔCt method to verify the overexpression effect.

[0106] Table 2

[0107] F’ TTAAAAACTTTCAAAGTCGAATGAACCGAGCGGCCACATCC 11 R’ AAGCTTATCGATACCGTCGATTAGGTCGTGTGGCGTTCGCC 12 Yz-F' ATTACATCCCTTACTCCGCCAC 13 Yz-R' GGGCATGGCGGACTTGAAGAA 14

[0108] RNA extraction: The frozen bacterial strain was inoculated onto M2 solid medium for activation and cultured at 27°C under light for 2 days. A strip of bacteria was cut from the activated plate using a sterile blade and placed in a 1.5 mL centrifuge tube. 1 mL of sterile deionized water was added, and the plate was ground using a three-dimensional grinder at maximum power for 45 seconds each time, repeated 3 times. 5 μL of the bacterial suspension was added to the center of an M2 plate lined with sterile cellophane and cultured at 27°C under light for 2-3 days. Mycelia were then collected. A suitable amount of glass beads was added to the mycelia, and after quick-freezing in liquid nitrogen to embrittle them, the plates were ground using a three-dimensional grinder at maximum power for 45 seconds each time, repeated 4 times. Subsequently, total RNA was extracted strictly according to the instructions of the high-purity RNA extraction kit. After determining the RNA concentration and purity, it was immediately used for subsequent experiments or stored at -80°C.

[0109] cDNA synthesis: A 5× All-in-One Reaction Mix and TransScript® All-in-One Enzyme Mix reaction system was used to perform reverse transcription while removing genomic DNA. After adding each component sequentially and mixing gently, the mixture was incubated at 50 °C for 5 min, followed by heating at 85 °C for 2 min to inactivate the enzyme activity. The resulting product is cDNA. After determining its concentration, it should be used immediately or stored at -20 °C for later use.

[0110] The 50μL reaction system includes: 1μL of extracted RNA, 4μL of 5× All-in-One Reaction Mix, 1μL of TransSeript® Al-in-One Enzgme Mix, and RNase-free Water to bring the total volume to 50μL.

[0111] PCR amplification of the target gene fragment: Using the synthesized cDNA as a template, PCR amplification was performed using specific primers (Table 2) to obtain the complete CDS fragment of the PaAFG1 gene. The reaction was performed using a 2× Phanta® Max Master Mix (DyePlus) premixed enzyme system, and the specific system and reaction procedure were the same as for conventional PCR.

[0112] Take 1 μL of PCR product for agarose gel electrophoresis to verify the correct size of the amplified fragments. For products with single bands and correct size, purify and recover them using the High Pure PCR Product Purification Kit; if non-specific bands are present, excise and recover them using a DNA gel extraction kit. After determining the concentration of the purified DNA fragments, store them at -20℃ for later use.

[0113] Construction of the recombinant vector: Using the TOLOBIO Homologous Recombination Cloning Kit, the linearized vector fragment was ligated with the exogenous DNA insert (PaAFG1-CDS) for homologous recombination. The recombination reaction system was prepared on ice. The reaction system was incubated at 50°C for 10–20 min, and immediately transferred to ice for 1–2 min after completion. The reaction product can be used directly for subsequent transformations or stored at -20°C.

[0114] The 10 μL recombination reaction system includes: 2 × Ezmax® Ultra Universal Clone Mix 5 μL, linearized vector 20 ng / kb, exogenous DNA insert fragment 20-40 ng / kb, and RNase-free water to 10 μL.

[0115] Transformation of recombinant products:

[0116] Remove DH5α clonal competent cells from -80℃ and thaw on ice. Add 10 μL of the recombinant reaction product to 100 μL of thawed competent cells, mix gently, and incubate on ice for 30 min. Then, heat shock the mixture in a 42℃ water bath for 90 s, and immediately transfer it to ice to cool for 2 min. Add 900 μL of antibiotic-free LB liquid medium and incubate at 37℃ with shaking at 220 rpm for 45 min to resuscitate the cells. Centrifuge the resuscitated bacterial culture at 5000 rpm for 2 min, discard the supernatant, and gently resuspend the bacterial pellet in 200 μL of antibiotic-free LB liquid medium. Spread the entire bacterial culture onto LB solid selective plates containing ampicillin (100 μg / mL) and incubate upside down at 37℃ for 12–16 h.

[0117] Positive clone verification:

[0118] Validation primers Yz-F' and Yz-R' were designed approximately 2000 bp flanking the PaAFG1-CDS insertion site on the recombinant vector. Single colonies were randomly picked from transformation plates, resuspended in 10 μL of sterile water, and 1 μL of the suspension was used as a template for colony PCR. The PCR products were analyzed by agarose gel electrophoresis to verify that the band size matched the expected insert. PCR products with correct band size were purified and sent for sequencing. Clones with sequenced correctness were used to extract recombinant plasmids using a plasmid extraction kit for subsequent experiments.

[0119] Protoplast preparation and transformation:

[0120] Protoplasts were prepared using *P. anserina* wild-type strain (mat+) as material, following the methods described above. A correctly constructed and validated recombinant plasmid was used as exogenous DNA, which was then introduced into the protoplasts. Transformants were screened using resistance plates containing genicin, as the pKNTG-Pwl2Pro plasmid carries the genicin resistance gene.

[0121] Validation of PaAFG1-OE overexpression strains:

[0122] From transformants that underwent secondary validation on genicin-resistant plates, at least three single colonies were selected and inoculated onto M2 solid medium, incubated at 27°C under light for 2 days. Mycelia were collected, and crude genomic DNA was extracted as a template for PCR validation. PCR amplification was performed using validation primers Yz-F' and Yz-R' in a 2× Phanta® Max Master Mix (DyePlus) reaction system. 1 μL of the PCR product was analyzed by agarose gel electrophoresis. If the band size matched the expected value (indicating successful integration of the recombinant vector), the product was purified and sent for sequencing validation.

[0123] The overexpression transformant (mat+) confirmed by sequencing was hybridized with the wild-type strain of opposite mating type (mat-) and cultured at 27°C under light until the ascocarps matured and released spores. Ascospores were collected using sterile spore collection medium, and single ascospores were picked up under a microscope using a micromanipulation needle and transferred to germination medium. After spore germination, the germinated colonies were seeded onto geneticin-containing resistant plates and cultured at 27°C in the dark for 1 day. Colonies that could grow on these plates were then screened.

[0124] To obtain overexpressing strains with clearly defined mating types, the colonies selected for resistance screening were confronted with wild-type strains of mat+ and mat- mating types, respectively. After approximately one week of incubation at 27°C under light, the mating type was determined based on the formation of fruiting bodies, thus isolating mat+ and mat- overexpressing strains with clearly defined mating types. The correctly identified strains were transferred to M2 plates and incubated at 27°C under light for 2 days. Afterward, bacterial blocks were excised and placed in preservation tubes, covered with an appropriate amount of RG liquid medium, and stored long-term at -80°C.

[0125] 5. Phenotypic Analysis

[0126] Different mating types (mat+ and mat-) of the test strains were inoculated into M2 solid medium and cultured at 27 ℃ under light for 10 days. During the culture period, the radial growth rate of colonies, morphological characteristics, pigment synthesis and distribution patterns, the time and density of fruiting bodies, and the development of ascospores were observed and recorded daily. At least three biological replicates were set up for each strain.

[0127] Based on this, the ability of the strains to utilize complex carbon sources was further evaluated. Equal volumes of bacterial suspension were inoculated into the center of solid culture media using lignin, sawdust, or microcrystalline cellulose as the sole carbon source (replacing dextrin in the original formula) and cultured under the same conditions for 10 days. The growth potential, colony morphology, pigment deposition degree, and developmental characteristics of reproductive structures (fruiting bodies and ascospores) of each strain under different carbon source limitations were observed and recorded. At least three biological replicates were set up for each treatment.

[0128] Fruiting body count: The test strains (mat+ and mat-) were inoculated separately into M2 solid medium and activated by light at 27 ℃ for 2 days. A bacterial suspension was prepared. 5 μL of the bacterial suspension was placed in the center of an M2 medium (d=9 cm) and incubated at 27 ℃ for 7 days. After incubation, the fruiting bodies in each plate were counted under a stereomicroscope. At least three biological replicates were set up for each strain.

[0129] Fruiting body morphology and development and observation of ascospores:

[0130] The strain activation and inoculation methods are the same as above. After culturing at 27℃ under light for 7 days, a single mature fruiting body is carefully picked up with sterile pointed forceps, placed on a glass slide with a drop of sterile water, and gently covered with a coverslip and pressed lightly to induce ascospore release. The morphological characteristics of the fruiting body (such as size, color, and structure) and the morphology, size, and arrangement of the ascospores are observed and recorded under an optical microscope.

[0131] Data are expressed as mean ± standard deviation (Mean ± SD). GraphPad Prism 11.0 was used for data statistics and plotting. t-tests were used to compare the two groups of data. p > 0.05 was considered statistically insignificant, p < 0.05 was considered statistically significant, p < 0.01 was considered moderately significant, and p < 0.001 was considered highly significant.

[0132] 6. Detection of physiological and biochemical indicators

[0133] (1) Histochemical staining of reactive oxygen species (ROS)

[0134] The test strains were inoculated into M2 solid medium and cultured at 27 °C under light for 3, 5, and 7 days. Diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining were performed to visualize hydrogen peroxide (H2O2) and superoxide anion (O2) levels in vivo. - The accumulation of DAB was observed. Specifically, DAB reacted with H₂O₂ in the presence of peroxidase to form an insoluble brown precipitate, while NBT was absorbed by O₂. - The reaction produces a blue-purple formazan precipitate, and the staining intensity is positively correlated with the accumulation level of the corresponding reactive oxygen species. The stained samples are incubated in a horizontal shaker in the dark for 3 hours. After the color development is obvious, the samples are washed three times with PBS buffer to terminate the reaction. The staining degree of the mycelia of each strain is then observed and compared. At least three biological replicates are required for the experiment.

[0135] NBT staining: Weigh 100 mg of nitroblue tetrazolium (NBT) solid powder and dissolve it in 40 mL of sterile deionized water. Shake well to dissolve completely, preparing a 25 mM NBT staining solution. Add 8 mL of NBT staining solution to mycelia cultured for 5 days, ensuring the mycelia are completely submerged. In the dark, gently shake and stain for 3-5 hours. After staining, aspirate the staining solution and gently wash the mycelia three times with sterile deionized water to terminate the reaction. Observe and photograph the formation of blue formazan precipitate in the mycelia under a stereomicroscope.

[0136] DAB staining: Add 8 mL of 3,3'-diaminobenzidine (DAB) staining solution to another set of parallel cultured hyphae, ensuring the hyphae are completely submerged. Incubate in the dark and gently shake for 3-5 hours. After staining, aspirate the staining solution and gently wash the hyphae three times with sterile deionized water. Observe and photograph the deposition of brown polymers in the hyphae under a stereomicroscope to indicate the accumulation of hydrogen peroxide.

[0137] (2) Determination of antioxidant enzyme activity and ATP content

[0138] The test strain was inoculated onto M2 solid medium and cultured at 27 °C under light. Mycelia were collected on days 3, 5, and 7 of culture, and crude enzyme extracts were prepared by grinding with liquid nitrogen. The total protein concentration was determined using the BCA method. Following the instructions of commercial kits, the activities of superoxide dismutase (SOD, WST-8 method), catalase (CAT, hydrogen peroxide consumption method), and peroxidase (POD, guaiacol method) were measured. Simultaneously, samples were prepared by adding 100-200 μL of ATP lysis buffer to every 20 mg of wet mycelia. After sonication in an ice bath, the supernatant was collected by centrifugation, and the ATP content was determined using an enhanced ATP assay kit (Beyotime, S0027). ATP levels were expressed as nanomoles per milligram of protein (nmol / mg protein).

[0139] Preparation of crude enzyme solution: Cultured mycelia were collected, and an appropriate amount of glass beads were added. After quick-freezing and embrittlement in liquid nitrogen, the mixture was ground using a three-dimensional sample grinder at maximum power (45 s each time, repeated 4 times). An appropriate amount of pre-cooled protein extraction buffer was added to the ground product, and the mixture was vortexed and incubated on ice for 5 min to ensure thorough extraction. Subsequently, the mixture was centrifuged at 12000 r / min for 5-10 min at 4 ℃, and the supernatant was collected as the crude enzyme solution. The protein concentration of the crude enzyme solution was determined using the BCA method.

[0140] Superoxide dismutase (SOD) activity assay: SOD activity assay is based on the WST-8 method. The principle is that WST-8 reacts with superoxide anions (O2) produced by the catalytic reaction of xanthine oxidase (XO). - The reaction produces water-soluble formazan dye. SOD catalyzes the disproportionation reaction of superoxide anions, thereby inhibiting this colorimetric reaction. Therefore, SOD activity is negatively correlated with the amount of formazan dye produced. SOD enzyme activity can be calculated by detecting the change in absorbance at 520 nm. The specific operation should be strictly performed according to the instructions of the total SOD activity assay kit (Beyotime, catalog number S0101M).

[0141] Peroxidase (POD) activity assay: POD activity was determined using the guaiacol method. POD catalyzes the oxidation of guaiacol in the presence of hydrogen peroxide to produce the brownish-yellow product tetra-o-methoxyphenol, which has a characteristic absorption peak at 470 nm. Within a certain reaction time, the amount of product generated is directly proportional to the POD activity. POD activity was calculated by detecting the change in absorbance at 470 nm over time. The specific procedures were strictly performed according to the instructions of the peroxidase (POD) activity assay kit (Solarbio, catalog number BC0095).

[0142] Catalase (CAT) activity assay: CAT activity assay is based on the consumption of hydrogen peroxide. Under conditions of sufficient hydrogen peroxide, CAT catalyzes the decomposition of hydrogen peroxide into water and oxygen. The remaining hydrogen peroxide is then oxidized by peroxidase to a specific chromogenic substrate, producing a red product (N-(4-antipyryl)-3-chloro-5-sulfonate-p-benzoquinonemonoimine), which has a maximum absorbance at 520 nm. By constructing a hydrogen peroxide standard curve, the amount of hydrogen peroxide consumed per unit volume of sample per unit time can be calculated, and thus the CAT enzyme activity can be calculated. The specific operation must be strictly performed according to the instructions of the Catalase (CAT) assay kit (Beyotime, catalog number S0051).

[0143] (3) Filter paper enzyme activity (FPA) assay

[0144] Different mating types (mat+ and mat-) of the test strains were inoculated into liquid induction medium with cellulose as the sole carbon source and cultured with shaking at 27 ℃ and 150 r / min light. Samples were taken on days 5, 7, 9, and 11 of culture, and filter paper activity (FPA) was determined according to national standard GB / T 25833-2010 and Dashtban's method. The reaction system included 50 mM sodium citrate buffer (pH 4.8) and qualitative filter paper strips. After reacting in a 50 ℃ water bath for 1 h, the amount of reducing sugar released was determined using the DNS method. FPA is defined as the amount of enzyme required to catalyze the production of 1 μmol of glucose per milligram of protein per minute under the above conditions. At least three biological replicates were set up for each treatment.

[0145] 7. Transcriptome sequencing and analysis

[0146] The test strains were inoculated into M2 solid medium and cultured at 27 ℃ under light for 5 days. Mycelial samples were then collected, with three biological replicates for each strain. mRNA sequencing libraries were constructed and paired-end 150 bp (PE150) sequencing was performed using the Illumina NovaSeq 6000 platform by SpectroMed Medical Technology (Hangzhou) Co., Ltd. The selected DEGs were subjected to Gene Ontology (GO) functional annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis.

[0147] II. Results and Analysis

[0148] 1. Sequence characteristics and phylogenetic analysis of PaAFG1

[0149] Based on annotations in the NCBI database, the gene presumed to encode the ATPase, Pa_4_2480, was named PaAFG1. Multiple sequence alignment analysis showed that, as Figure 4 As shown, the PaAFG1-encoded product consists of 645 amino acids and has the highest similarity to the AFG1 homolog of *Sordaria macrospora*, sharing 438 conserved amino acid residues and exhibiting a sequence identity of 67.9%. Domain analysis revealed that PaAFG1, along with other AFG1-like proteins from other species, contains characteristic motifs of the AAA+ ATPase family, including Walker A (GTGKT / S), Walker B (FLDEFQLP), and Sensor-2 / arginine finger (R...R) domains. Multiple sequence alignment and domain annotation confirmed that PaAFG1 and its homologs fully retain the three core functional motifs of AAA+ ATPases. These functional elements are constrained by purification selection pressures, resulting in highly stable sequences, suggesting that the AFG1 family proteins are evolutionarily functionally conserved.

[0150] To further clarify the phylogenetic position of PaAFG1, a phylogenetic tree was constructed that included groups such as fungi, plants, animals, and bacteria, such as... Figure 5 As shown in the phylogenetic tree, PaAFG1 is most closely related to Neurospora crassa, both belonging to the same branch with a bootstrap value of 75%, indicating high statistical reliability of the clustering results. Furthermore, PaAFG1 is significantly more closely related to fungal groups than to yeasts, plants, animals, and prokaryotes, consistent with the principles of biological taxonomy.

[0151] 2. Genetic construction and molecular verification of the knockout mutant ΔPaAFG1

[0152] A knockout mutant was constructed using a split-marker homologous recombination strategy. The upstream and downstream homologous arms of PaAFG1 (1328 bp and 1370 bp, respectively) were amplified using wild-type genomic DNA as a template, and the Nourseothricin resistance gene (1803 bp) was amplified using a plasmid as a template. Two knockout elements (5N and 3N) were obtained by fusion PCR and transformed into recipient bacterial protoplasts lacking the key gene mus51 at the non-homologous ends. After screening the transformants in Nourseothricin-containing medium, three resistant clones were randomly selected for PCR verification and sequencing analysis. The results showed that the PaAFG1 coding region had been precisely replaced by natR, successfully obtaining the knockout mutant ΔPaAFG1. Figure 6 and Figure 7 As shown.

[0153] Figure 6 The images show the electrophoresis gel images of routine PCR and fusion PCR. In Figure (a), the images are agarose gel electrophoresis gel images of the PaAFG1-5', NatR, and PaAFG1-3' gene fragments, in the order of lane 5', lane N, and lane 3'. In Figure (b), the images are agarose gel electrophoresis gel images of the PaAFG1-5'-NatR and NatR-PaAFG1-3' fusion fragments, with the NatR resistant fragment as a reference. Lane 5N is the PaAFG1-5'-NatR fusion fragment, lane 3N is the NatR-PaAFG1-3' fusion fragment, and lane N is the control fragment. In Figures (a) and (b), lane M represents the DNA marker, and the bands from top to bottom are 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.

[0154] Figure 7 The PCR electrophoresis gel image was used to verify the transformants. Lane 1F represents the F-terminal fragment of transformant 1, lane 1R represents the R-terminal fragment of transformant 1, lane 2F represents the F-terminal fragment of transformant 2, lane 2R represents the R-terminal fragment of transformant 2, lane 3F represents the F-terminal fragment of transformant 3, lane 3R represents the R-terminal fragment of transformant 3, and lane M represents the DNA marker. The bands from top to bottom are 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.

[0155] 3. Genetic construction and molecular validation of the overexpression strain PaAFG1-OE

[0156] For the construction of the overexpression strain, the strong promoter Pwl2Pro was used to drive the complete coding sequence (CDS) of PaAFG1. After linearization by SalI digestion, the sequence was ligated with PaAFG1-CDS via homologous recombination to construct the recombinant plasmid pKNTG-PaAFG1. After sequencing verification, the plasmid was transformed into wild-type (mat+) protoplasts, and positive transformants were screened on medium containing genicin (100 μg / mL). Genomic PCR and sequencing results confirmed that the exogenous expression cassette had been successfully integrated into the host genome. Figure 8 As shown. Figure 8 In the figure, (a) shows the enzyme digestion verification of the overexpression vector pKNTG-PaAFG1, and (b) shows the genomic PCR verification of the overexpression strains; in (a), lane 1 is the circular plasmid, lane 2 is the linearized plasmid, and lane 3 is PaAFG1-CDS (1938bp); in (b), lanes 4 to 11 are the genomic PCR amplification results of the eight overexpression strains; in (a) and (b), lane M is the DNA marker, and the bands from top to bottom are 4500bp, 3000bp, 2000bp, 1200bp, 800bp, 500bp, and 200bp.

[0157] To obtain homozygous strains, positive transformants (mat+) were sexually mated with wild-type (mat-), and homozygous strains of different mating types were isolated and screened from ascospores. RT-qPCR analysis showed that, compared with the wild-type, the transcription level of the target gene in the PaAFG1-OE strain was significantly upregulated by approximately 5.8-fold (P < 0.001), confirming its overexpression effect. Figure 9 As shown in the figure, the successful construction of the above genetic material lays the foundation for subsequent functional studies.

[0158] 4. PaAFG1 regulates mycelial growth and development, sexual reproduction, and delays senescence.

[0159] To systematically evaluate the effects of PaAFG1 on mycelial growth, senescence, and sexual reproduction, this study conducted simultaneous culture observations of wild-type WT, the knockout mutant ΔPaAFG1, and the overexpressing strain PaAFG1-OE on 15cm M2 plates under continuous light at 27℃ for 10 days. Colony morphology, growth dynamics, and sexual reproductive development characteristics are shown in [Figure number missing]. Figure 10 and Figure 11 . Figure 10 This image shows the mycelial growth after 10 days of cultivation. Figure 11This is a graph showing the growth diameter. Phenotypic analysis revealed significant differences among the three genotype strains in colony growth, senescence timing, and fruiting body development. On day 4 of culture, WT colonies exhibited vigorous growth and abundant aerial hyphae, while ΔPaAFG1 showed slow growth and sparse, shallow colonies. PaAFG1-OE had higher hyphal density than WT. WT continued to grow from day 6 to 10, while the knockout strain showed further growth lag and flattened colony edges. The overexpressing strain exhibited faster radial growth and larger colony diameter. Regarding senescence characteristics, WT showed pigment deposition starting on day 8, with a clear senescence phenotype on day 10. ΔPaAFG1 showed significantly earlier senescence, with obvious pigment deposition appearing on the outer edge of the colony on day 6, rapidly deepening and expanding over time. PaAFG1-OE showed pigmentation at a similar time to WT, but the senescence area expanded more slowly. In terms of sexual reproduction, PaAFG1 significantly regulated the number and developmental progress of fruiting bodies, while ΔPaAFG1 had fewer fruiting bodies and slower development. E showed a greater number and denser distribution of mature fruiting bodies, indicating a significantly enhanced sexual reproductive capacity. The quantitative detection results of colony diameter were consistent with morphological observations. The growth rate of ΔPaAFG1 throughout the entire growth cycle was significantly lower than that of WT, with highly significant differences observed on days 6, 8, and 10. The colony diameter of PaAFG1-OE was significantly larger than that of WT from day 6 onwards, and its growth advantage continued to expand in the later stages. In summary, under M2 medium conditions, PaAFG1 gene deletion inhibits hyphal growth, accelerates the senescence process, and weakens sexual reproductive capacity, while gene overexpression promotes hyphal expansion, maintains normal senescence time, and significantly enhances the level of sexual reproductive development.

[0160] To quantitatively assess the impact of PaAFG1 on sexual reproduction efficiency, this study statistically analyzed fruiting bodies of wild-type WT, knockout mutant ΔPaAFG1, and overexpressing strain PaAFG1-OE after 7 days of culture on 9cm M2 plates. Figure 12 As shown, the phenotypic results indicate that WT fruiting bodies are evenly distributed and exhibit a typical spherical structure, ΔPaAFG1 fruiting bodies are significantly fewer in number and sparsely distributed, while PaAFG1-OE fruiting bodies are significantly more numerous and densely arranged; quantitative statistical results, such as... Figure 13 As shown, consistent with morphological observations, the average fruiting body yield per plate was 6101±225 for WT, decreased to 4523±353 for ΔPaAFG1 (a decrease of 25.9%, p<0.01), and increased to 7858±456 for PaAFG1-OE (an increase of 28.8%, p<0.01). This indicates that PaAFG1 positively regulates fruiting body formation, gene deletion significantly inhibits fruiting body occurrence, and overexpression significantly increases fruiting body yield and developmental maturation. To further analyze the regulatory role of PaAFG1 on reproductive development at the microscopic level, WT, ΔPaAFG1, and PaAFG1-OE strains were cultured in M2 medium under continuous light at 27℃. Samples were taken on days 7, 8, and 9 of culture, and the fruiting bodies were observed under a microscope using the squash method. Figure 14 As shown, the results indicated that the fruiting bodies of WT initially formed their structure on day 7, became clear on day 8 and began to form ascospores, and were filled with ascospores on day 9, completing the sexual reproductive cycle. Although spore release was observed on days 8-9 in ΔPaAFG1, the number of spores was sparse and their size was significantly smaller than that of WT throughout the fruiting body development, suggesting an abnormality in fruiting body development. The mycelial network around the fruiting bodies of PaAFG1-OE was denser and the number of ascospores was more abundant on days 8-9, with better spore production and release efficiency than WT. At the same time, the developmental sequence was earlier than WT and the early structural complexity was higher. In summary, PaAFG1 not only positively regulates fruiting body yield but also plays a key regulatory role in fruiting body morphogenesis, spore abundance, and reproductive development sequence. Gene deletion leads to poor fruiting body structural development and reduced spore yield, while overexpression can promote full fruiting body development and improve efficiency.

[0161] To elucidate the function of PaAFG1 in lignocellulose utilization, this study used microcrystalline cellulose (MCC), sawdust, and lignin as the sole carbon sources, and systematically compared the growth and development of wild-type WT, the knockout mutant ΔPaAFG1, and the overexpressing strain PaAFG1-OE. Figure 15 As shown. Figure 15In the figures, (a) shows the growth on MCC medium, (b) shows the growth on sawdust medium, and (c) shows the growth on lignin medium. In MCC medium, the growth rate of PaAFG1 increased significantly. By day 5, WT and PaAFG1-OE had formed black fruiting bodies, while ΔPaAFG1 showed no reproductive structures, indicating a significant delay in reproductive initiation. By day 7, the fruiting bodies of WT and the overexpressing strain continued to increase and mature, while the knockout strain still showed a significant developmental lag. The differences became more pronounced by day 11, with WT fruiting bodies densely distributed in a radial pattern of maturity. The overexpressing strain exhibited stronger reproductive capacity, with more fruiting bodies and a more even distribution, approximately 28.8% more than WT (p < 0.01). ΔPaAFG1 colony growth was restricted, with sparse and slow fruiting bodies accompanied by premature senescence. On sawdust medium, PaAFG1 expression significantly affected hyphal growth and development. By day 7, WT and overexpressing strains had initiated fruiting body development in large numbers, while ΔPaAFG1 only formed fruiting bodies sporadically and delayed development. Phenotypic differences widened further from 9 to 14 days. WT fruiting bodies developed well, while the knockout strain had fewer and slower-developing fruiting bodies. PaAFG1-OE formed a denser and clearer cluster of fruiting bodies, with significantly higher reproductive and developmental activity than WT. On lignin medium, PaAFG1 mainly regulated mycelial vegetative growth. During the 3-7 day observation period, WT consistently maintained the fastest radial growth, with neat and uniformly radiating colony edges. The growth rate of ΔPaAFG1 decreased, and its growth rate at all time points was lower than that of WT, with a more pronounced delay in growth in the later stages. The growth of PaAFG1-OE was between the two, slightly slower than WT in the early stages, and the colony area gradually recovered and approached the level of wild type in the later stages. In summary, PaAFG1 plays a differentiated regulatory role in different lignocellulose carbon sources. In easily degradable microcrystalline cellulose and sawdust carbon sources, it mainly positively regulates development. Gene deletion can cause reproductive delay, developmental hindrance, and premature senescence. In recalcitrant lignin carbon sources, it focuses on maintaining mycelial vegetative growth and expansion capacity. This suggests that PaAFG1 can sense the energy metabolism status of different carbon sources and synergistically regulate fungal vegetative growth, sexual reproductive resource allocation, and senescence timeline.

[0162] 5. PaAFG1 regulates cellular energy metabolism

[0163] ATP content is a core indicator reflecting cellular energy homeostasis. To investigate the regulatory role of PaAFG1 in fungal energy metabolism and its related growth, development, sexual reproduction, and aging processes, this study measured intracellular ATP content in wild-type (WT), knockout mutant (ΔPaAFG1), and overexpression strain (PaAFG1-OE) on days 3, 5, and 7 of culture. Figure 16As shown in the figure. The results showed that the ATP content of the three strains differed significantly and regularly. The ATP content of ΔPaAFG1 was significantly higher than that of WT throughout the entire culture period, reaching a peak on day 5 with a highly significant difference (p<0.0001). This is consistent with the characteristics of PaAFG1 as an AAA family ATPase with ATP hydrolytic activity, indicating that the deletion of this gene will block ATP hydrolysis and turnover, resulting in abnormal accumulation of intracellular ATP and disorder of the ATP-ADP cycle. PaAFG1-OE showed the opposite trend. The ATP content was significantly lower than that of WT in the early and middle stages of culture (p<0.05~p<0.0001), confirming that gene overexpression can improve ATP hydrolysis and turnover efficiency. In the later stage, the ATP content recovered to a level not significantly different from that of WT, suggesting that the strain has a metabolic compensation regulation mechanism. Based on the comprehensive phenotypic analysis of previous studies, the energy metabolism changes mediated by PaAFG1 are highly consistent with the growth, reproduction, and senescence phenotypes of the strain: Although ΔPaAFG1 has a high total intracellular ATP content, the energy storage cannot be converted into usable energy for hyphal growth and fruiting body formation, resulting in sluggish hyphal growth, reduced fruiting body numbers, and delayed development. Simultaneously, energy metabolism disorder disrupts cellular homeostasis, inducing premature pigment deposition and accelerated senescence in colonies. This indicates that an imbalance in ATP turnover, rather than a difference in total ATP content, is the core cause of poor growth and premature senescence in the strain. PaAFG1-OE, with its efficient ATP turnover, early initiation of sexual reproduction, dense fruiting body development, and sufficient spore production, maintains a normal senescence sequence, confirming that appropriate ATP turnover efficiency is crucial for normal fungal development and reproduction. In summary, PaAFG1 is an important negative regulator of intracellular ATP homeostasis. It regulates ATP hydrolysis and energy distribution, and coordinates energy metabolism, vegetative growth, sexual reproduction, and aging processes. Deletion of this gene leads to energy metabolism blockage and ATP accumulation, directly causing growth inhibition, reproductive decline, and premature aging. Overexpression optimizes energy flow efficiency, promotes hyphal growth, enhances sexual reproductive capacity, and maintains normal aging rhythms, playing a core pivotal role in the fungal developmental regulatory network.

[0164] 6. PaAFG1 maintains redox homeostasis.

[0165] To investigate the effect of the PaAFG1 gene on intracellular redox homeostasis, this study used DAB (3,3-diaminobenzidine) and NBT (nitroblue tetrazolium) histochemical staining methods to observe the levels of hydrogen peroxide (H2O2) and superoxide anion (O2) in different genotype strains (WT, ΔPaAFG1, PaAFG1-OE) cultured on M2 medium during three growth stages (days 3, 5, and 7). - The accumulation of DAB. DAB staining results show, for example... Figure 17As shown, H2O2 accumulation exhibits an increasing trend over time. On day 3 of culture, the colonies of all strains showed relatively light staining, indicating that intracellular H2O2 was at a basal level. By days 5 and 7, WT colonies showed a uniformly deepened brown staining. In contrast, the staining intensity of the ΔPaAFG1 mutant was significantly higher than that of WT at these two time points, indicating an abnormally increased accumulation of H2O2, most pronounced in the later stages of culture (day 7). Conversely, the DAB staining intensity of the PaAFG1-OE overexpressing strain was weaker than that of WT at all time points, with its inner colony staining significantly lighter on day 7, suggesting that its H2O2 accumulation was inhibited. NBT staining results further confirmed this trend, such as... Figure 18 As shown, WT colonies exhibit uniform blue-purple staining with a clearly visible staining ring around the periphery, reflecting O2. - The basal accumulation and distribution of O2. The blue-purple staining of the ΔPaAFG1 mutant was significantly deeper than that of WT, and the staining area was wider, indicating its O2. - The levels were abnormally elevated. Conversely, the NBT staining of the PaAFG1-OE strain was significantly lighter than that of the WT strain, with a narrower outer staining ring and a lighter central staining, indicating that its O2 levels were abnormally high. - Accumulation levels decreased. In summary, DAB and NBT staining results consistently indicate that the expression level of the PaAFG1 gene is related to intracellular ROS (H2O2 and O2). - The accumulation of ROS was negatively correlated with the amount of ROS. Gene knockout led to abnormal ROS accumulation, while overexpression effectively reduced ROS levels. In summary, DAB and NBT staining results consistently showed that the expression level of the PaAFG1 gene was negatively correlated with the intracellular ROS (H2O2 and O2). - The accumulation of ROS was negatively correlated with the gene knockout. Gene knockout led to abnormal ROS accumulation, while overexpression effectively reduced ROS levels. Excessive accumulation of reactive oxygen species (ROS) triggers oxidative damage, a key factor driving senescence in filamentous fungi. Based on this, it is hypothesized that PaAFG1 maintains redox homeostasis by regulating intracellular ROS levels: gene deletion leads to continuously elevated ROS, exacerbating cellular oxidative stress and accelerating fungal senescence; gene overexpression, on the other hand, alleviates oxidative stress, reduces damage to biomolecules, and thus slows down the senescence process. This also indicates that PaAFG1 participates in regulating the senescence process of *Neurospora* and is an important functional gene connecting redox homeostasis and senescence phenotype.

[0166] To further investigate the regulatory function of PaAFG1 in fungal oxidative stress response, this study measured the changes in the antioxidant enzyme activities of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) on days 3, 5, and 7 of culture in wild-type WT, knockout mutant ΔPaAFG1, and overexpression strain PaAFG1-OE under M2 medium and continuous light at 27°C. The results are as follows: Figures 19 to 21 As shown. Figure 19 This is the result of SOD enzyme activity detection. Figure 20 This is the result of CAT enzyme activity assay. Figure 21 The results show the POD enzyme activity assay. SOD activity results revealed significant differences among the three groups. PaAFG1-OE SOD activity was significantly higher than WT and ΔPaAFG1 in both the early and late stages of culture, while ΔPaAFG1 SOD activity only decreased significantly in the mid-stage of culture. CAT activity showed a persistent decrease in the knockout strain. ΔPaAFG1 CAT activity was significantly lower than WT at all detection time points, while PaAFG1-OE CAT activity showed no significant difference from WT but was significantly higher than the mutant. POD activity regulation exhibited a phased characteristic: the enzyme activity levels of the three groups were similar in the early stage, PaAFG1-OE POD activity was significantly upregulated in the mid-stage of culture, and remained at a high level in the late stage. The comprehensive enzyme activity data indicate that PaAFG1 has significant enzyme specificity in regulating the antioxidant system. Gene overexpression can effectively maintain high levels of SOD activity and induce increased POD activity in the mid-stage, stabilizing cellular antioxidant capacity. Gene knockout, on the other hand, continuously impairs CAT function and reduces SOD activity at critical stages, weakening ROS scavenging efficiency. Based on the aforementioned ROS accumulation phenotype, PaAFG1 finely regulates intracellular redox homeostasis by differentially controlling the balance of SOD, CAT, and POD activities. PaAFG1 deficiency leads to a weakened antioxidant defense system and insufficient ROS clearance, which in turn exacerbates oxidative damage, induces premature aging, and inhibits sexual reproduction and development. Overexpression, on the other hand, can maintain stable antioxidant enzyme activity, reduce ROS stress, and ensure the balance of normal vegetative growth, reproductive development, and aging time of fungi.

[0167] 7. PaAFG1 does not affect cellulase activity.

[0168] To elucidate the regulatory role of PaAFG1 in cellulose degradation metabolism, this study measured the relative cellulase activities during the growth of wild-type WT, ΔPaAFG1, and PaAFG1-OE strains. The results are as follows: Figure 22 As shown in the figure, the results indicated that the cellulase activity of all three strains gradually increased with prolonged culture time. However, the enzyme activities of ΔPaAFG1 and PaAFG1-OE showed no statistically significant difference compared to WT throughout the entire observation period, indicating that PaAFG1 knockout and overexpression did not significantly affect the cellulase secretion activity of the strains under the experimental conditions. Combined with previous phenotypic results, although ΔPaAFG1 exhibits defects such as inhibited mycelial growth and premature senescence in lignocellulose carbon sources, this phenotype is not directly related to changes in cellulase activity. In conclusion, PaAFG1 is not a key gene regulating the expression of cellulase systems. Its influence on lignocellulose utilization does not depend on directly regulating hydrolytic enzyme activity, but rather indirectly affects the growth adaptability and reproductive senescence process of fungi under different carbon source environments by regulating cellular energy metabolism, redox homeostasis, and developmental timing.

[0169] 8. Omics evidence that PaAFG1 promotes sexual reproduction and delays aging

[0170] To reveal the regulatory network of PaAFG1 at the molecular level, we performed RNA-seq analysis on WT, ΔPaAFG1, and PaAFG1-OE. The results are shown in Table 3 and... Figure 23 As shown. The sequencing data quality is good (Q30 > 92%, alignment rate > 87%). Principal component analysis (PCA) shows that the three groups of samples are clearly separated, with good intragroup reproducibility.

[0171] Table 3

[0172] WT-1 41963318 100.00 94.67 55.13 WT-2 51747342 100.00 94.62 55.09 WT-3 40820240 100.00 94.71 55.45 ΔPaAFG1-1 51563090 100.00 94.17 55.22 ΔPaAFG1-2 68311120 100.00 92.67 55.16 ΔPaAFG1-3 41724154 100.00 94.56 55.16 PaAFG1-OE-1 42032398 100.00 94.73 55.44 PaAFG1-OE-2 40963080 100.00 94.73 55.46 PaAFG1-OE-3 40680508 100.00 94.47 55.16

[0173] Figure 23 In the figure, (a) shows the results of principal component analysis of the sample, and (b) shows the heatmap of sample correlation.

[0174] Differentially expressed gene (DEG) analysis, as shown in Table 4, revealed that compared to WT, ΔPaAFG1 induced only 320 DEGs (214 upregulated and 106 downregulated), while PaAFG1-OE triggered large-scale transcriptional reprogramming with a total of 2,314 DEGs (1,157 upregulated and 1,157 downregulated), approximately eight times the number of WT. This indicates that PaAFG1 overexpression possesses strong transcriptional regulatory potential.

[0175] Table 4

[0176] WT vs ΔPaAFG1 320 214 106 WT vs PaAFG1-OE 2314 1157 1157 PaAFG1 vs PaAFG1-OE 2073 771 1302

[0177] To systematically elucidate the molecular mechanisms of PaAFG1-mediated regulation of fungal energy metabolism, oxidative homeostasis, and senescence development, and to clarify the transcriptional regulatory mechanisms behind early physiological, biochemical, and phenotypic differences, this study investigated three strains: wild-type, PaAFG1 knockout, and overexpressing. Transcriptome sequencing and differential gene functional enrichment analysis were conducted. Based on KEGG pathway enrichment results corrected by BH multiplex tests, physiological data on strain growth and development, sexual reproduction, senescence phenotype, intracellular ATP homeostasis, ROS accumulation, and antioxidant enzyme activity were integrated. This revealed the core network of PaAFG1 regulation of fungal metabolic reprogramming and phenotypic formation at the global transcriptional level, avoiding the limitations of single-phenotype or single-gene analyses and achieving a precise correspondence between physiological phenotypes and molecular mechanisms.

[0178] The statistical results of differentially expressed genes directly reflect the global transcriptional regulatory capacity and dose-dependent regulatory characteristics of PaAFG1. The WT vs ΔPaAFG1 comparison group identified only 320 differentially expressed genes, including 214 upregulated genes and 106 downregulated genes. This indicates that PaAFG1 knockout alone only induces localized fine-tuning of fungal transcriptional levels, without causing large-scale gene expression disorders. This also explains why knockout strains only exhibit mild defect phenotypes such as slow growth, mild premature aging, and decreased reproductive capacity, without extreme traits such as lethality or sterility. In stark contrast, the WT vs PaAFG1-OE comparison group identified 2314 differentially expressed genes, with 1157 upregulated and 1157 downregulated genes—eight times the number in the knockout group. This demonstrates that PaAFG1 overexpression can trigger global transcriptional reprogramming, exhibiting a broad-spectrum and significant regulatory effect on fungal metabolic, developmental, and aging-related pathways, making it a core key gene driving fungal physiological state and phenotypic remodeling. Meanwhile, the significant expression differences of 2073 differentially expressed genes in the ΔPaAFG1 vs PaAFG1-OE group further confirm that the expression abundance of PaAFG1 directly determines the fungal transcriptome pattern and is the core node regulating the differential differentiation of strain physiological phenotypes.

[0179] KEGG pathway enrichment analysis showed that peroxisome metabolism, carbon metabolism, and cofactor biosynthesis were the core conserved pathways that were enriched in all three groups, indicating that these pathways are the basic target pathways for PaAFG1 to regulate the life activities of Podospora anserina, and run through the entire process of fungal vegetative growth, metabolic homeostasis and aging, as shown in Table 5.

[0180] Table 5

[0181] Cofactor biosynthesis 4↑，3↓ carbon metabolism 5↑，23↓ Cofactor biosynthesis 6↑，23↓ Glycolysis / Gluconeogenesis 2↑，2↓ Cofactor biosynthesis 9↑，18↓ carbon metabolism 7↑，16↓ Pyruvate metabolism 1↑，3↓ Peroxisomes 3↑，17↓ Amino acid biosynthesis 10↑，11↓ Peroxisomes 1↑，3↓ Amino acid biosynthesis 6↑，14↓ Peroxisomes 2↑，15↓ carbon metabolism 0↑，4↓ Longevity regulatory pathways (multi-species) 1↑，4↓ Longevity regulatory pathways (multi-species) 1↑，3↓

[0182] Twenty differentially expressed genes were enriched in the peroxisome pathway in the PaAFG1-OE strain, with 3 genes upregulated and 17 genes downregulated, showing a predominance of downregulation. These differentially expressed genes were mainly distributed in functional modules such as peroxisome biogenesis (PEX family), ROS scavenging systems (SOD, CAT), and fatty acid β-oxidation. Specifically, genes encoding antioxidant enzymes such as SOD and CAT were downregulated, while several fatty acid β-oxidation-related genes also showed significant expression changes, indicating that PaAFG1 can simultaneously affect peroxisome structure maintenance, reactive oxygen species metabolism, and lipid metabolism. Combined with physiological index analysis, PaAFG1 overexpression does not lead to a decrease in antioxidant capacity, but rather, due to enhanced peroxisome function and efficient ROS scavenging, cellular oxidative stress is reduced, thereby inhibiting antioxidant gene transcription through negative feedback. Conversely, PaAFG1 knockout causes impaired peroxisome function; even with upregulation of antioxidant gene expression, it is difficult to restore ROS scavenging capacity, ultimately leading to continuous ROS accumulation and accelerated strain senescence.

[0183] Differential enrichment of longevity regulatory pathways revealed that differentially expressed genes were mainly enriched in conserved longevity regulatory networks such as AMPK, mTOR, and PKA, as well as their downstream functional modules including oxidative stress, autophagy, and cell cycle. In PaAFG1-overexpressing strains, the oxidative stress-related gene SOD2 and the cell cycle regulatory gene CLG1 were upregulated, while the lipid metabolism-related gene ATG15 was downregulated, indicating that PaAFG1 participates in longevity regulation by coordinating energy metabolism, oxidative stress, and cellular homeostasis. Combined with strain phenotypic analysis, PaAFG1 overexpression helps maintain the stability of the longevity regulatory network, enhances oxidative stress tolerance, and thus delays strain senescence; while PaAFG1 deficiency leads to imbalance in the longevity regulatory network, disrupts cellular metabolic homeostasis, and accelerates ROS accumulation and the senescence process. These results demonstrate that PaAFG1 can participate in fungal senescence by regulating conserved longevity signaling networks.

[0184] Furthermore, significant differential enrichment of the glycolysis / gluconeogenesis core energy metabolism pathway and the ribosome biosynthesis pathway elucidated the metabolic basis of PaAFG1's regulation of fungal vegetative growth and sexual reproduction. Glycolysis, as the core pathway for intracellular ATP production in fungi, directly determines intracellular energy turnover efficiency through fluctuations in the expression of its pathway genes. Combined with ATP content measurements, PaAFG1, as an AAA+ family ATPase, regulates ATP hydrolysis turnover by modulating the activity of the glycolysis pathway: in knockout strains, the glycolysis pathway is disordered, ATP hydrolysis is blocked, leading to abnormal accumulation of intracellular energy and a significant reduction in energy turnover efficiency, failing to provide usable energy for hyphal growth and fruiting body formation, thus inhibiting vegetative growth and sexual reproductive development; in overexpressing strains, the glycolysis pathway operates efficiently, ATP is continuously recycled, providing sufficient energy support for vigorous growth and abundant fruiting body formation. Simultaneously, differential expression of the ribosome biosynthesis pathway directly regulates cellular protein translation levels; PaAFG1 overexpression can improve protein synthesis efficiency, ensuring hyphal proliferation and reproductive structure development, while knockout inhibits protein synthesis, further exacerbating growth and reproductive defects.

[0185] III. Discussion

[0186] This study, combining transcriptomics and physiological and biochemical phenotypes, systematically elucidated the core function and regulatory mechanism of the AAA+ ATPase family gene PaAFG1 in the filamentous fungus *Podospora anserina*. Transcriptomic results confirmed a significant dose-dependent regulatory effect of PaAFG1: gene knockout induced only 320 differentially expressed genes, resulting in only mild developmental defects and premature aging phenotypes in the strain; while overexpression induced 2314 differentially expressed genes, triggering global transcriptional reprogramming and significantly reshaping the strain's physiological phenotype.

[0187] KEGG pathway enrichment indicates that peroxisomes, core energy metabolism, and longevity signaling pathways are key target pathways of PaAFG1. PaAFG1 maintains intracellular oxidative homeostasis by regulating peroxisome functional homeostasis. In overexpressing strains, the transcription of antioxidant genes is downregulated, but a compensatory mechanism after translation ensures efficient ROS clearance, effectively alleviating oxidative damage and delaying aging. In contrast, knockout strains experience ROS accumulation due to peroxisome pathway disorder and impaired antioxidant system, ultimately inducing premature aging. As a functional ATPase, PaAFG1 directly regulates ATP hydrolysis and turnover. Knockout strains exhibit abnormal ATP accumulation and reduced energy utilization efficiency, leading to delayed mycelial growth and inhibited fruiting body development. Overexpressing strains have efficient ATP turnover, providing sufficient energy support for strain growth and sexual reproduction. Simultaneously, PaAFG1 mediates differential changes in the aging sequence of strains by altering intracellular energy status and regulating the AMPK / mTOR longevity signaling pathway.

[0188] Furthermore, PaAFG1 does not directly regulate cellulase activity; its mediated adaptation to the lignocellulose environment mainly relies on indirect regulation through energy metabolism and developmental homeostasis. In summary, this study confirms that PaAFG1 is a core regulatory node integrating energy metabolism, oxidative homeostasis, and aging development, filling a functional gap in the AFG1 gene of filamentous fungi and providing a new target for genetic improvement of anti-aging and stable yield in industrial fungi.

[0189] The above description, in conjunction with specific embodiments, provides a further detailed explanation of this application and should not be construed as limiting the specific implementation of this application to these descriptions. Those skilled in the art to which this application pertains can make several simple deductions or substitutions without departing from the concept of this application.

Claims

1. A filamentous fungus strain (Podospora anserina) that promotes the growth and development of fungal fruiting bodies and delays senescence, characterized by: The filamentous fungus (Podospora anserina) strain was formed by overexpressing the PaAFG1 gene in wild-type filamentous fungus (Podospora anserina) and was labeled as Podospora anserina PaAFG1-OE. The PaAFG1 gene is Pa_4_2480, and its Gene ID is 6188062.

2. The filamentous fungus (Podospora anserina) strain according to claim 1, characterized in that: The accession number for the Podospora anserina PaAFG1-OE is CCTCC M 20261299.

3. The application of the filamentous fungus (Podospora anserina) strain according to claim 1 or 2 in the preparation of highly efficient mycelium.

4. The application according to claim 3, characterized in that: The highly efficient mycelium refers to the mycelium that, compared to wild-type filamentous fungi (Podospora anserina), exhibits faster mycelial growth rate, higher fruiting body yield, and / or delayed aging process.

5. A method for increasing the yield of fruiting bodies of filamentous fungi (Podospora anserina), characterized in that: This includes overexpression of the PaAFG1 gene in the filamentous fungus (Podospora anserina), the PaAFG1 gene being Pa_4_2480, with a Gene ID of 6188062.

6. A method for accelerating the hyphal growth rate of filamentous fungus (Podospora anserina), characterized in that: This includes overexpression of the PaAFG1 gene in the filamentous fungus (Podospora anserina), the PaAFG1 gene being Pa_4_2480, with a Gene ID of 6188062.

7. A method for delaying the aging process of filamentous fungi (Podospora anserina), characterized in that: This includes overexpression of the PaAFG1 gene in the filamentous fungus (Podospora anserina), the PaAFG1 gene being Pa_4_2480, with a Gene ID of 6188062.

8. The method according to any one of claims 5-7, characterized in that: The PaAFG1 gene overexpression includes constructing the complete coding sequence of the PaAFG1 gene into a plasmid vector to obtain a recombinant plasmid, transforming the recombinant plasmid into the protoplasts of wild-type filamentous fungus (Podospora anserina), culturing and screening positive transformants, sexually mating the positive transformants with wild-type filamentous fungus (Podospora anserina), and isolating and purifying pure strains from ascospores to obtain pure strains, i.e., strains that overexpress the PaAFG1 gene.

9. The method according to claim 8, characterized in that: The complete coding sequence of the PaAFG1 gene is driven by a strong promoter.

10. The method according to claim 9, characterized in that: The strong promoter includes Pwl2Pro.

Images